Search result for sequence:
GACGGGGGGGGCAAGTGTTCTTCGGAATGACTGGGCGTAAAGGGCACGTAGGCGGTGAATCGGGTTGAAAGTGAAAGTCGCCAAAAACTGGTGGAATGCTCTCGAAACCAATTCACTTGAGTGAGACAGAGGAGAGTGGAATTTCGTGTG
common ontology terms
term enrichment score
TermScore
costa rica0.210896
cannabis sativa0.194444
reforestation0.194444
shaanxi province0.194444
robinia pseudoacacia0.194444
loess plateau0.177215
ant0.159420
root endosphere0.147059
silt loam0.140000
root0.136364
farm0.134632
larval stage0.113990
united states of america0.107295
glycine max0.099644
30 years0.093750
wild0.088608
rhizosphere0.087137
air0.085714
soybean0.076336
plant0.073529
germany0.071247
canada0.068293
leaf0.068182
pre-vegetative stage0.064516
urban biome0.064516
early flowering stage0.064516
republic of congo0.064516
nouabale-ndoki national park0.064516
10 years0.064516
20 years0.064516
depth 0-20cm0.063830
sus scrofa0.058252
pig0.058252
root nodule0.049793
building0.049793
pseudomyrmex nigropilosus0.049180
pseudomyrmex flavicornis0.049180
late flowering stage0.049180
pseudomyrmex spinicola0.049180
liolaemus ruibali0.049180
holstein-friesian bull0.049180
aerosol0.049180
beach0.049180
moor0.049180
ivy0.049180
hedera hibernica0.049180
depth 100-300cm0.049180
depth 40-100cm0.049180
depth 0-40cm0.049180
LOWER IN agricultural field0.049180
tonsil0.048583
pan troglodytes troglodytes0.048000
LOWER IN zea mays0.048000
monkey0.047619
LOWER IN zoological garden0.047431
feces0.046960
argentina0.046875
greenhouse0.046875
ireland0.046875
chimpanzee0.046875
state of michigan0.046332
austria0.043796
stomach0.042857
belgium0.042857
LOWER IN stomach0.041958
skin0.040268
research facility0.039604
soil0.036878
bos taurus0.035928
pacific ocean0.035294
china0.034768
rumen0.034091
state of missouri0.033333
soy bean0.033333
nida basin0.033333
herbivorous beetle0.033333
cheilotoma musciformis0.033333
boston0.033333
train0.033333
pseudomyrmex nigrocinctus0.033333
dipteryx oleifera0.033333
root structure0.033333
propagation stage0.033333
LOWER IN left colon0.033333
LOWER IN juvenile organism0.033333
ria formosa0.033333
open water pond0.033333
nile tilapia0.033333
scrubland0.033333
tropical grassland biome0.033333
nanger granti0.033333
gazelle0.033333
other plants0.033333
onobrychis viciifolia0.033333
common sainfoin0.033333
LOWER IN other plants0.033333
meadow pea-vine0.033333
lathyrus pratensis0.033333
size < 10um0.033333
LOWER IN triticum aestivum0.033333
Fraction of dbbact annotations with this term covered by the query
TermScore
root nodule0.666667
building0.666667
costa rica0.571429
ant0.500000
pseudomyrmex nigropilosus0.500000
state of missouri0.500000
soy bean0.500000
nida basin0.500000
herbivorous beetle0.500000
cheilotoma musciformis0.500000
cannabis sativa0.500000
pre-vegetative stage0.500000
urban biome0.500000
boston0.500000
train0.500000
pseudomyrmex nigrocinctus0.500000
root endosphere0.500000
pseudomyrmex flavicornis0.500000
late flowering stage0.500000
dipteryx oleifera0.500000
root structure0.500000
propagation stage0.500000
ailurus fulgens0.500000
red panda0.500000
pseudomyrmex spinicola0.500000
early flowering stage0.500000
liolaemus ruibali0.500000
musa acuminate0.500000
LOWER IN transverse colon0.500000
LOWER IN left colon0.500000
trigona hyalinata0.500000
acacia ants0.500000
LOWER IN pseudomyrmex gracilis0.500000
LOWER IN generalist0.500000
douchi0.500000
mold0.500000
LOWER IN no mold0.500000
bedroom0.500000
LOWER IN juvenile organism0.500000
LOWER IN age 1-2 years0.500000
sparus aurata0.500000
ria formosa0.500000
open water pond0.500000
seabream0.500000
rumen solids0.500000
LOWER IN rumen liquid0.500000
holstein-friesian bull0.500000
aerosol0.500000
beach0.500000
nile tilapia0.500000
age <=24 hours0.500000
LOWER IN age &gt;= 7 days0.500000
guanajuato0.500000
agave0.500000
agave salmiana0.500000
bathroom0.500000
shower0.500000
tile0.500000
building wall0.500000
LOWER IN skin under eye0.500000
dracaena fragrans0.500000
LOWER IN stream0.500000
fire salamander0.500000
age 6-10 weeks0.500000
moor0.500000
scrubland0.500000
LOWER IN forest ecosystem0.500000
ivy0.500000
hedera hibernica0.500000
kitchen0.500000
sink0.500000
skh-1 hairless mouse0.500000
LOWER IN cyprinus carpio0.500000
LOWER IN common carp0.500000
england0.500000
dicentrarchus labrax0.500000
seabass0.500000
papio kindae0.500000
papio ursinus0.500000
LOWER IN papio anubis0.500000
papio0.500000
zambia0.500000
baboon0.500000
dracaena draco0.500000
LOWER IN age 1-3 weeks0.500000
dry forest0.500000
LOWER IN tropical moist broadleaf forest biome0.500000
central america0.500000
alouatta pigra0.500000
howler monkey0.500000
republic of congo0.500000
nouabale-ndoki national park0.500000
dicerorhinus sumatrensis0.500000
sumatran rhinoceros0.500000
tropical grassland biome0.500000
nanger granti0.500000
gazelle0.500000
guanacaste conservation area0.500000
food processing factory0.500000
state of rhode island0.500000
Fraction of annotations for the query sequences containing the term
TermScore
united states of america0.284483
china0.181034
farm0.163793
costa rica0.129310
soil0.129310
rhizosphere0.120690
canada0.120690
cannabis sativa0.120690
silt loam0.120690
reforestation0.120690
shaanxi province0.120690
loess plateau0.120690
robinia pseudoacacia0.120690
feces0.112069
root0.103448
larval stage0.094828
ant0.094828
root endosphere0.086207
research facility0.068966
glycine max0.060345
wild0.060345
germany0.060345
depth 0-20cm0.051724
leaf0.051724
air0.051724
30 years0.051724
plant0.043103
soybean0.043103
pre-vegetative stage0.034483
urban biome0.034483
early flowering stage0.034483
sus scrofa0.034483
pig0.034483
republic of congo0.034483
nouabale-ndoki national park0.034483
10 years0.034483
20 years0.034483
LOWER IN stomach0.025862
pseudomyrmex nigropilosus0.025862
root nodule0.025862
pseudomyrmex flavicornis0.025862
late flowering stage0.025862
pseudomyrmex spinicola0.025862
argentina0.025862
liolaemus ruibali0.025862
austria0.025862
greenhouse0.025862
stomach0.025862
building0.025862
rumen0.025862
bos taurus0.025862
ireland0.025862
holstein-friesian bull0.025862
tonsil0.025862
state of michigan0.025862
aerosol0.025862
beach0.025862
state of california0.025862
pacific ocean0.025862
monkey0.025862
homo sapiens0.025862
moor0.025862
belgium0.025862
ivy0.025862
hedera hibernica0.025862
skin0.025862
LOWER IN zoological garden0.025862
chimpanzee0.025862
pan troglodytes troglodytes0.025862
depth 100-300cm0.025862
depth 40-100cm0.025862
depth 0-40cm0.025862
LOWER IN zea mays0.025862
LOWER IN agricultural field0.025862
state of missouri0.017241
soy bean0.017241
poland0.017241
whole body0.017241
beetle0.017241
nida basin0.017241
herbivorous beetle0.017241
cheilotoma musciformis0.017241
crematogaster0.017241
state of minnesota0.017241
fish feed0.017241
city0.017241
boston0.017241
train0.017241
pseudomyrmex nigrocinctus0.017241
tree0.017241
dipteryx oleifera0.017241
botanical fruit food product0.017241
root structure0.017241
seedling0.017241
propagation stage0.017241
zoological garden0.017241
small intestine0.017241
duodenum0.017241
jejunum0.017241
ileum0.017241
Exp. ID User ID Description Date Region Flag Sequences
309amnonplant mitochondrial DNA (other mitochondrion)2018-04-01v4No1 / 1
408amnon high in larval stage compared to stomach in united states of america costa rica ant pseudomyrmex nigropilosus 2018-11-22v4No1 / 2
747amnondominant in soy bean root nodules (dominant united states of america, farm, glycine max, root nodule, state of missouri, soy bean)2021-03-10v4No1 / 4
515amnondominant poland, whole body, plant, beetle, nida basin, herbivorous beetle, cheilotoma musciformis2019-04-18v4No1 / 5
747amnoncommon in soy bean root nodules (common united states of america, farm, glycine max, root nodule, state of missouri, soy bean)2021-03-10v4No1 / 7
408amnondominant united states of america, larval stage, costa rica, crematogaster, ant2018-11-22v4No1 / 8
271amnondominant rhizosphere, glycine max, soybean, depth 0-20cm, china2018-01-09v4No1 / 9
255amnoncommon in fish feed (dominant united states of america, research facility, state of minnesota, fish feed)2017-11-24v4No1 / 10
618amnondominant farm, rhizosphere, canada, cannabis sativa, pre-vegetative stage2020-05-04v4No1 / 10
195amnonhigh freq. in boston subway surfaces (dominant city, urban biome, boston, train)2017-09-07v4No1 / 11
408amnoncommon united states of america, larval stage, costa rica, ant, pseudomyrmex nigrocinctus2018-11-22v4No1 / 11
515amnoncommon poland, whole body, plant, beetle, nida basin, herbivorous beetle, cheilotoma musciformis2019-04-18v4No1 / 11
408amnondominant united states of america, larval stage, costa rica, ant, pseudomyrmex nigropilosus2018-11-22v4No1 / 12
618amnondominant farm, canada, root endosphere, root, cannabis sativa, pre-vegetative stage2020-05-04v4No1 / 13
408amnoncommon united states of america, larval stage, costa rica, ant, pseudomyrmex flavicornis2018-11-22v4No1 / 15
618amnondominant farm, canada, root endosphere, root, cannabis sativa, late flowering stage2020-05-04v4No1 / 15
501amnondominant costa rica, tree, dipteryx oleifera, botanical fruit food product2019-03-08v4No1 / 17
408amnoncommon united states of america, larval stage, costa rica, ant, pseudomyrmex nigropilosus2018-11-22v4No1 / 18
408amnoncommon united states of america, larval stage, costa rica, crematogaster, ant2018-11-22v4No1 / 19
271amnoncommon root structure, glycine max, soybean, depth 0-20cm, root, root nodule, china2018-01-09v4No1 / 20
618amnondominant farm, seedling, canada, root endosphere, root, cannabis sativa, propagation stage2020-05-04v4No1 / 21
399amnoncommon feces, united states of america, state of tennessee, zoological garden, ailurus fulgens, red panda2018-11-16v4No1 / 22
408amnoncommon united states of america, larval stage, costa rica, ant, pseudomyrmex spinicola2018-11-22v4No1 / 22
618amnondominant farm, canada, root endosphere, root, cannabis sativa, early flowering stage2020-05-04v4No1 / 24
501amnoncommon costa rica, tree, dipteryx oleifera, botanical fruit food product2019-03-08v4No1 / 25
71amnoncommon research facility, small intestine, argentina, liolaemus ruibali2017-02-25v4No1 / 33
361amnoncommon leaf, austria, plant, greenhouse, musa acuminate2018-08-21v4No1 / 37
14amnon high in stomach duodenum jejunum ileum compared to feces caecum transverse colon left colon right colon in united states of america gastrointestinal system mus musculus 2016-11-08v4No1 / 42
59amnoncommon digestive system, trigona hyalinata2017-02-02v4No1 / 43
618amnoncommon farm, seedling, canada, root endosphere, root, cannabis sativa, propagation stage2020-05-04v4No1 / 44
408amnon high in larval stage compared to stomach in united states of america costa rica ant pseudomyrmex flavicornis 2018-11-22v4No1 / 47
408amnon high in pseudomyrmex nigrocinctus pseudomyrmex flavicornis pseudomyrmex spinicola acacia ants compared to pseudomyrmex gracilis generalist in united states of america costa rica pseudomyrmex ant 2018-11-22v4No1 / 53
90amnoncommon douchi, food (fermented), china2017-03-08v4No1 / 61
523amnonhigher in houses with mold ( high in mold compared to no mold in united states of america building air state of illinois chicago bedroom )2019-07-03v4No1 / 61
782amnon high in adult organism age 3 years compared to juvenile organism age 1-2 years in fish farm gill portuguese republic sparus aurata ria formosa open water pond seabream 2021-05-06v4No1 / 66
71amnon high in stomach small intestine compared to feces hindgut colon in research facility argentina liolaemus ruibali 2017-02-25v4No1 / 67
83amnonhigher in rumen solids compared to liquid in normal diet cows ( high in rumen solids compared to rumen liquid in rumen bos taurus ireland holstein-friesian bull )2017-03-05v4No1 / 67
389amnoncommon united states of america, farm, tonsil, sus scrofa, state of michigan, pig, age 4 weeks2018-11-04v4No1 / 71
304amnonlower in seawater compared sea spray aerosol ( high in air aerosol compared to water sea water in united states of america beach state of california pacific ocean )2018-03-12v4No1 / 77
407amnon high in wet season compared to dry season in feces costa rica monkey wild cebus capucinus white-faced capuchin 2018-11-21v4No1 / 79
108amnon high in caecum compared to colon in united states of america research facility oreochromis niloticus state of texas nile tilapia 2017-04-07v4No1 / 80
227amnonhiger in first 24hrs compared to later timepoints in baby nasopharynx ( high in age age <=24 hours compared to age >= 7 days in homo sapiens nasal cavity nasopharynx infant kingdom of the netherlands )2017-10-30v4No1 / 85
26amnon high in mucus pair of nares compared to saliva mouth in united states of america felis catus 2016-12-05v4No1 / 86
360amnoncommon desert, mexico, guanajuato, agave, root endosphere, agave salmiana, root2018-08-21v4No1 / 87
71amnoncommon research facility, stomach, argentina, liolaemus ruibali2017-02-25v4No1 / 88
199amnoncommon on shower wall tile (common united states of america, building, urban biome, bathroom, shower, tile, building wall)2017-10-01v4No1 / 90
58amnon high in conjunctiva compared to skin skin under eye in homo sapiens new york city 2017-02-02v4No1 / 96
361amnoncommon leaf, austria, plant, greenhouse, dracaena fragrans2018-08-21v4No1 / 100
149amnon high in pond compared to stream in larval stage intestine amphibian larval stage germany salamandra salamandra fire salamander 2017-04-24v4No1 / 103
271amnon high in root structure root compared to soil rhizosphere in glycine max soybean depth 0-20cm china 2018-01-09v4No1 / 110
388amnoncommon united states of america, farm, tonsil, sus scrofa, state of michigan, pig, age 6-10 weeks2018-11-03v4No1 / 112
128amnonhigher in ivy leaves from moor compared to forest ( high in moor scrubland compared to forest ecosystem in leaf belgium ivy hedera hibernica )2017-04-14v4No1 / 114
195amnoncommon in boston subway surfaces (common city, urban biome, boston, train)2017-09-07v4No1 / 116
108amnondecreases during fasting in nile tilapia caecum ( high in early timepoints compared to fasting late timepoints in united states of america research facility caecum oreochromis niloticus state of texas nile tilapia )2017-04-07v4No1 / 122
199amnoncommon in kitchen sink (common united states of america, building, urban biome, kitchen, sink)2017-10-01v4No1 / 130
176amnoncommon in skin of hairless mice (common united states of america, female, research facility, dorsum, mus musculus, skin, mouse, skh-1 hairless mouse)2017-07-29v4No1 / 133
255amnoncommon in fish feed (common united states of america, research facility, state of minnesota, fish feed)2017-11-24v4No1 / 141
396amnon high in oncorhynchus mykiss rainbow trout compared to cyprinus carpio common carp in digestive system intestine england fish 2018-11-14v4No1 / 142
782amnon high in adult organism age 3 years compared to juvenile organism age 1 year in fish farm gill portuguese republic dicentrarchus labrax ria formosa open water pond seabass 2021-05-07v4No1 / 147
411amnon high in wild papio kindae papio ursinus compared to zoological garden papio anubis in feces papio zambia monkey baboon 2018-11-23v4No1 / 151
361amnoncommon leaf, austria, plant, greenhouse, dracaena draco2018-08-21v4No1 / 155
408amnon high in larval stage compared to stomach in united states of america costa rica ant pseudomyrmex spinicola 2018-11-22v4No1 / 165
389amnon high in age 4 weeks compared to age 1-3 weeks in united states of america farm tonsil sus scrofa state of michigan pig 2018-11-04v4No1 / 168
80amnon high in dry forest compared to tropical moist broadleaf forest biome in feces state of florida central america alouatta pigra howler monkey 2017-03-03v4No1 / 193
618amnoncommon farm, canada, root endosphere, root, cannabis sativa, early flowering stage2020-05-04v4No1 / 205
620amnoncommon feces, wild, chimpanzee, pan troglodytes troglodytes, republic of congo, nouabale-ndoki national park2020-05-06v4No1 / 238
304amnoncommon united states of america, beach, air, aerosol, state of california, pacific ocean, monterey bay2018-03-12v4No1 / 263
559amnoncommon feces, united states of america, zoological garden, captive, dicerorhinus sumatrensis, sumatran rhinoceros2019-11-03v4No1 / 267
78amnonhigher in younger gazelles ( high in age young age compared to old age in feces tropical grassland biome kenya nanger granti gazelle )2017-03-01v4No1 / 268
625amnoncommon feces, costa rica, alouatta palliata, mantled howler monkey, wild, guanacaste conservation area2020-05-16v4No1 / 309
618amnoncommon farm, canada, root endosphere, root, cannabis sativa, pre-vegetative stage2020-05-04v4No1 / 318
311amnoncommon in floor of kimchi production facility (common united states of america, food processing factory, state of rhode island, floor)2018-04-09v4No1 / 324
620amnon high in wild pan troglodytes troglodytes republic of congo nouabale-ndoki national park compared to united states of america zoological garden pan troglodytes in feces chimpanzee 2020-05-06v4No1 / 351
618amnoncommon farm, canada, root endosphere, root, cannabis sativa, late flowering stage2020-05-04v4No1 / 352
620amnon high in wild republic of congo nouabale-ndoki national park compared to united states of america zoological garden in feces gorilla gorilla gorilla 2020-05-06v4No1 / 368
256amnonhigher in small intestine compared to colon in pigs ( high in duodenum jejunum ileum compared to caecum left colon right colon in sus scrofa pig united kingdom )2017-11-26v4No1 / 387
309amnon high in other plants compared to veronica chamaedrys germander speedwell in rhizosphere germany 2018-04-05v4No1 / 404
309amnon high in onobrychis viciifolia common sainfoin compared to other plants in rhizosphere germany 2018-04-05v4No1 / 420
274amnoncommon feces, chlorocebus aethiops, ethiopia, monkey, vervet monkey2018-01-16v4No1 / 446
620amnon high in chimpanzee pan troglodytes troglodytes compared to gorilla gorilla in feces wild republic of congo nouabale-ndoki national park 2020-05-06v4No1 / 478
618amnon high in root endosphere root compared to rhizosphere in farm canada cannabis sativa 2020-05-04v4No1 / 510
304amnoncommon united states of america, beach, air, aerosol, state of california, pacific ocean, santa cruz province2018-03-12v4No1 / 518
128amnonhigher in ivy leaves from moor and forest compared to city ( high in moor forest ecosystem compared to city dense settlement biome in leaf belgium ivy hedera hibernica )2017-04-14v4No1 / 525
618amnoncommon farm, rhizosphere, canada, cannabis sativa, pre-vegetative stage2020-05-04v4No1 / 530
309amnon high in other plants compared to prunella vulgaris woundwort in rhizosphere germany 2018-04-05v4No1 / 550
536amnon high in terrestrial snake compared to aquatic snake in united states of america skin snake southern united states 2019-07-28v4No1 / 590
128amnoncommon moor, scrubland, leaf, belgium, ivy, hedera hibernica2017-04-14v4No1 / 623
309amnon high in meadow pea-vine lathyrus pratensis compared to other plants in rhizosphere germany 2018-04-05v4No1 / 680
232amnonlower in diabetec patient foot skin compared to healthy controls ( high in control compared to diabetes mellitus in homo sapiens skin foot australia )2017-11-05v4No1 / 708
271amnon high in rhizosphere glycine max soybean compared to soil in depth 0-20cm china 2018-01-09v4No1 / 750
83amnoncommon rumen, bos taurus, ireland, holstein-friesian bull2017-03-05v4No1 / 757
206amnoncommon in air from israel particles <10um size (common air, dust, israel, size < 10um, clear day)2017-10-04v4No1 / 765
78amnon high in female compared to male in feces tropical grassland biome kenya nanger granti gazelle 2017-03-01v4No1 / 811
618amnoncommon farm, rhizosphere, canada, cannabis sativa, late flowering stage2020-05-04v4No1 / 819
618amnoncommon farm, rhizosphere, canada, cannabis sativa, early flowering stage2020-05-04v4No1 / 873
206amnoncommon in dust storm air from israel particles <10um size (common air, dust, israel, size < 10um, dust storm)2017-10-04v4No1 / 902
83amnon high in control diet normal diet compared to restricted diet in rumen bos taurus ireland holstein-friesian bull 2017-03-05v4No1 / 1023
618amnon high in early flowering stage compared to late flowering stage in farm rhizosphere canada cannabis sativa 2020-05-04v4No1 / 1040
837sheryoCommon in soil after 10 years reforestation with Black locust trees at 100-300cm depth, shaanxi, China (common soil, silt loam, reforestation, china, shaanxi province, loess plateau, robinia pseudoacacia, depth 100-300cm, 10 years)2021-09-26v4No1 / 1061
837sheryoCommon in soil after 10 years reforestation with Black locust trees at 40-100cm depth, shaanxi, China (common soil, silt loam, reforestation, china, shaanxi province, loess plateau, robinia pseudoacacia, depth 40-100cm, 10 years)2021-09-26v4No1 / 1065
837sheryoCommon in soil at 0-40-100cm depth after 20 years reforestation with Black locust trees, shaanxi, China (common soil, silt loam, reforestation, china, shaanxi province, loess plateau, robinia pseudoacacia, depth 40-100cm, 20 years)2021-09-26v4No1 / 1294
309amnoncommon rhizosphere, germany, meadow pea-vine, lathyrus pratensis2018-04-05v4No1 / 1296
837sheryoCommon in soil at 40-100cm depth after 30 years reforestation with Black locust trees, shaanxi, China (common soil, silt loam, reforestation, china, shaanxi province, loess plateau, robinia pseudoacacia, depth 40-100cm, 30 years)2021-09-26v4No1 / 1311
837sheryoCommon in soil after 10 years reforestation with Black locust trees at 0-40cm depth, shaanxi, China (common soil, silt loam, reforestation, china, shaanxi province, loess plateau, robinia pseudoacacia, depth 0-40cm, 10 years)2021-09-26v4No1 / 1317
837sheryoCommon in soil at 100-300cm depth after 20 years reforestation with Black locust trees, shaanxi, China (common soil, silt loam, reforestation, china, shaanxi province, loess plateau, robinia pseudoacacia, depth 100-300cm, 20 years)2021-09-26v4No1 / 1317
309amnoncommon rhizosphere, germany, onobrychis viciifolia, common sainfoin2018-04-05v4No1 / 1323
837sheryoבCommon in soil at 0-40cm depth after 20 years reforestation with Black locust trees, shaanxi, China (common soil, silt loam, reforestation, china, shaanxi province, loess plateau, robinia pseudoacacia, depth 0-40cm, 20 years)2021-09-26v4No1 / 1323
837sheryoCommon in soil at 0-40 cm depth after 30 years reforestation with Black locust trees, shaanxi, China (common soil, silt loam, reforestation, china, shaanxi province, loess plateau, robinia pseudoacacia, depth 0-40cm, 30 years)2021-09-26v4No1 / 1346
837sheryoCommon in soil at 100-300cm depth after 30 years reforestation with Black locust trees, shaanxi, China (common soil, silt loam, reforestation, china, shaanxi province, loess plateau, robinia pseudoacacia, depth 100-300cm, 30 years)2021-09-26v4No1 / 1354
271amnoncommon rhizosphere, glycine max, soybean, depth 0-20cm, china2018-01-09v4No1 / 1459
271amnoncommon soil, depth 0-20cm, china2018-01-09v4No1 / 2856
837sheryoHigher in soil after 10 years reforestation with Black locust trees compared to agricultural feild, shaanxi, China ( high in reforestation robinia pseudoacacia 10 years compared to zea mays wheat agricultural field in soil silt loam china shaanxi province loess plateau )2021-09-26v4No1 / 3932
837sheryoHigher in soil after 30 years compared to 20 years of reforestation with Black locust trees, shaanxi, China ( high in 30 years compared to 20 years in soil silt loam reforestation china shaanxi province loess plateau robinia pseudoacacia )2021-09-27v4No1 / 3936
837sheryoHigher in soil after 30 years compared to 10 years of reforestation with Black locust trees, shaanxi, China ( high in 30 years compared to 10 years in soil silt loam reforestation china shaanxi province loess plateau robinia pseudoacacia )2021-09-27v4No1 / 5245
837sheryoHigher in soil after 30 years reforestation with Black locust trees compared to agricultural feild, shaanxi, China ( high in reforestation robinia pseudoacacia 30 years compared to zea mays triticum aestivum agricultural field in soil silt loam china shaanxi province loess plateau )2021-09-27v4No1 / 5596
837sheryoHigher in soil after 20 years reforestation with Black locust trees compared agricultural feild, shaanxi, China ( high in reforestation robinia pseudoacacia 20 years compared to zea mays triticum aestivum agricultural field in soil silt loam china shaanxi province loess plateau )2021-09-26v4No1 / 5661

Problems / suggestions? Please email info AT dbbact DOT org