Search result for sequence:
GACGGGGGGGGCAAGTGTTCTTCGGAATGACTGGGCGTAAAGGGCACGTAGGCGGTGAATCGGGTTGAAAGTGAAAGTCGCCAAAAAGTGGTGGAATGCTCTCGAAACCAATTCACTTGAGTGAGACAGAGGAGAGTGGAATTTCGTGTG
common ontology terms
term enrichment score
TermScore
canada0.484848
african lion safari0.320000
captive0.226415
toronto zoo0.190476
grass growth diet0.190476
ruminal fluid0.190476
alpine meadow0.190476
fragaria x ananassa0.190476
strawberry0.190476
yellow brown soil0.190476
nanjing city prefecture0.190476
zoological garden0.184615
yak0.173913
bos grunniens0.160000
greenhouse soil0.160000
tibetan plateau0.137931
summer0.136364
LOWER IN winter0.129032
cultivated environment0.121212
nida basin0.105263
herbivorous beetle0.105263
argoptochus quadrisignatus0.105263
fruit bat0.105263
eidolon helvum0.105263
mucosa of stomach0.105263
eastern gray squirrel0.105263
sciurus carolinensis0.105263
indian flying fox0.105263
pteropus giganteus0.105263
swan goose0.105263
estonia0.105263
LOWER IN russia0.105263
sumatran orangutan0.105263
pongo abelii0.105263
barbary sheep0.105263
ammotragus lervia0.105263
LOWER IN green stage diet0.105263
LOWER IN withered grass diet0.105263
LOWER IN mixolimnion0.105263
LOWER IN depth 0-3m0.105263
monimolimnion0.105263
depth 4-9m0.105263
hypersaline water0.105263
ursu lake0.105263
romania0.105263
continuous cropping0.105263
age 5 years0.105263
age 10 years0.105263
poland0.100000
beetle0.100000
anser cygnoides0.100000
mongolia0.100000
age < 3 years0.100000
giraffe0.100000
LOWER IN low salinity0.100000
high salinity0.100000
lake water0.100000
rumen0.097561
whole body0.095238
LOWER IN china0.095238
giraffa camelopardalis0.095238
south korea0.090909
white rhinoceros0.090909
ceratotherium simum0.090909
LOWER IN spring0.090909
biopsy0.086957
lake0.086957
age 1 year0.086957
bird0.083333
plant0.080000
skin0.073733
dog0.068966
stomach0.066667
farm0.063492
canis lupus familiaris0.060606
infant0.057143
rhizosphere0.056338
china0.040201
water0.031250
homo sapiens0.021739
feces0.017699
Fraction of dbbact annotations with this term covered by the query
TermScore
nida basin0.500000
herbivorous beetle0.500000
argoptochus quadrisignatus0.500000
toronto zoo0.500000
fruit bat0.500000
eidolon helvum0.500000
canada0.500000
mucosa of stomach0.500000
eastern gray squirrel0.500000
sciurus carolinensis0.500000
african lion safari0.500000
indian flying fox0.500000
pteropus giganteus0.500000
swan goose0.500000
estonia0.500000
LOWER IN russia0.500000
sumatran orangutan0.500000
pongo abelii0.500000
barbary sheep0.500000
ammotragus lervia0.500000
LOWER IN green stage diet0.500000
grass growth diet0.500000
ruminal fluid0.500000
alpine meadow0.500000
LOWER IN withered grass diet0.500000
LOWER IN mixolimnion0.500000
LOWER IN depth 0-3m0.500000
monimolimnion0.500000
depth 4-9m0.500000
hypersaline water0.500000
ursu lake0.500000
romania0.500000
fragaria x ananassa0.500000
strawberry0.500000
yellow brown soil0.500000
nanjing city prefecture0.500000
continuous cropping0.500000
age 5 years0.500000
age 10 years0.500000
poland0.333333
beetle0.333333
anser cygnoides0.333333
mongolia0.333333
age < 3 years0.333333
yak0.333333
giraffe0.333333
LOWER IN low salinity0.333333
high salinity0.333333
lake water0.333333
whole body0.250000
LOWER IN china0.250000
bos grunniens0.250000
giraffa camelopardalis0.250000
greenhouse soil0.250000
south korea0.200000
white rhinoceros0.200000
ceratotherium simum0.200000
LOWER IN spring0.200000
captive0.166667
biopsy0.166667
tibetan plateau0.166667
lake0.166667
age 1 year0.166667
bird0.142857
LOWER IN winter0.142857
plant0.125000
zoological garden0.125000
cultivated environment0.125000
summer0.111111
dog0.083333
rumen0.083333
stomach0.076923
canis lupus familiaris0.062500
infant0.055556
farm0.043478
skin0.040000
rhizosphere0.037037
china0.021978
water0.021277
homo sapiens0.011976
feces0.009569
Fraction of annotations for the query sequences containing the term
TermScore
canada0.470588
skin0.470588
captive0.352941
zoological garden0.352941
african lion safari0.235294
china0.235294
summer0.176471
toronto zoo0.117647
homo sapiens0.117647
feces0.117647
LOWER IN winter0.117647
grass growth diet0.117647
ruminal fluid0.117647
rumen0.117647
alpine meadow0.117647
tibetan plateau0.117647
yak0.117647
bos grunniens0.117647
rhizosphere0.117647
fragaria x ananassa0.117647
strawberry0.117647
greenhouse soil0.117647
farm0.117647
yellow brown soil0.117647
nanjing city prefecture0.117647
cultivated environment0.117647
poland0.058824
whole body0.058824
beetle0.058824
plant0.058824
nida basin0.058824
herbivorous beetle0.058824
argoptochus quadrisignatus0.058824
fruit bat0.058824
eidolon helvum0.058824
dog0.058824
canis lupus familiaris0.058824
biopsy0.058824
stomach0.058824
mucosa of stomach0.058824
south korea0.058824
eastern gray squirrel0.058824
sciurus carolinensis0.058824
indian flying fox0.058824
pteropus giganteus0.058824
anser cygnoides0.058824
swan goose0.058824
bird0.058824
mongolia0.058824
LOWER IN china0.058824
white rhinoceros0.058824
ceratotherium simum0.058824
infant0.058824
age < 3 years0.058824
estonia0.058824
LOWER IN russia0.058824
sumatran orangutan0.058824
pongo abelii0.058824
barbary sheep0.058824
ammotragus lervia0.058824
LOWER IN spring0.058824
LOWER IN green stage diet0.058824
LOWER IN withered grass diet0.058824
giraffe0.058824
giraffa camelopardalis0.058824
LOWER IN low salinity0.058824
LOWER IN mixolimnion0.058824
LOWER IN depth 0-3m0.058824
monimolimnion0.058824
depth 4-9m0.058824
high salinity0.058824
hypersaline water0.058824
lake water0.058824
water0.058824
ursu lake0.058824
romania0.058824
lake0.058824
continuous cropping0.058824
age 5 years0.058824
age 10 years0.058824
age 1 year0.058824
Exp. ID User ID Description Date Region Flag Sequences
515amnoncommon poland, whole body, beetle, plant, nida basin, herbivorous beetle, argoptochus quadrisignatus2019-04-18v4No1 / 22
565amnoncommon captive, toronto zoo, zoological garden, fruit bat, eidolon helvum, canada, skin2019-11-21v3No1 / 83
565amnoncommon dog, canis lupus familiaris, canada, skin2019-11-21v3No1 / 83
569amnoncommon in gastric biopsies of patients negative for h. pylori (common biopsy, stomach, mucosa of stomach, south korea, homo sapiens)2019-12-16v3No1 / 85
565amnoncommon eastern gray squirrel, sciurus carolinensis, canada, skin2019-11-21v3No1 / 104
565amnoncommon african lion safari, captive, zoological garden, indian flying fox, pteropus giganteus, canada, skin2019-11-21v3No1 / 109
417amnon high in mongolia summer compared to winter china in anser cygnoides swan goose bird feces 2018-12-01v4No1 / 114
565amnoncommon white rhinoceros, ceratotherium simum, african lion safari, captive, zoological garden, canada, skin2019-11-21v3No1 / 122
241amnonlower in babies from russia compared to estonia ( high in estonia compared to russia in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 169
565amnoncommon sumatran orangutan, pongo abelii, toronto zoo, captive, zoological garden, canada, skin2019-11-21v3No1 / 174
565amnoncommon african lion safari, captive, zoological garden, barbary sheep, ammotragus lervia, canada, skin2019-11-21v3No1 / 205
561amnon high in summer grass growth diet compared to spring green stage diet in ruminal fluid rumen alpine meadow tibetan plateau china yak bos grunniens 2019-11-05v3No1 / 256
561amnon high in summer grass growth diet compared to winter withered grass diet in bos grunniens yak china tibetan plateau alpine meadow rumen ruminal fluid 2019-11-05v3No1 / 294
565amnoncommon giraffe, giraffa camelopardalis, african lion safari, captive, zoological garden, canada, skin2019-11-21v3No1 / 310
577amnon high in monimolimnion depth 4-9m high salinity hypersaline water compared to low salinity mixolimnion depth 0-3m in lake water water ursu lake romania lake 2020-01-09v3No1 / 439
444amnoncommon rhizosphere, fragaria x ananassa, strawberry, greenhouse soil, farm, yellow brown soil, nanjing city prefecture, continuous cropping, age 5 years, age 10 years, china, cultivated environment2019-01-07v4No1 / 833
444amnoncommon rhizosphere, fragaria x ananassa, strawberry, greenhouse soil, farm, yellow brown soil, nanjing city prefecture, age 1 year, china, cultivated environment2019-01-07v4No1 / 1439

Problems / suggestions? Please email info AT dbbact DOT org