Search result for sequence:
GACGGGGGGGGCAAGTGTTCTTCGGAATGACTGGGCGTAAAGGGCACGTAGGCGGTGAATCGGGTTGAAAGTGAAAGTCGCCAAAAAGTGGTGGAATGCTCTCGAAACCAATTCACTTGAGTGAGACAGAGGAGAGTGGAATTTCGTGTG
common ontology terms
term enrichment score
TermScore
canada0.307692
food product type0.300000
vigna radiata0.222222
mung bean sprouts0.222222
african lion safari0.222222
producer c10.176471
producer c20.176471
captive0.157895
zoological garden0.136364
toronto zoo0.125000
alfalfa sprouts0.125000
medicago sativa0.125000
alpine meadow0.125000
ruminal fluid0.125000
grass growth diet0.125000
fragaria x ananassa0.125000
strawberry0.125000
yellow brown soil0.125000
nanjing city prefecture0.125000
skin0.120401
yak0.117647
israel0.113208
caecum0.111111
bos grunniens0.111111
greenhouse soil0.111111
summer0.109091
cecal content0.105263
tibetan plateau0.100000
LOWER IN winter0.095238
chicken0.090909
gallus gallus0.090909
cultivated environment0.090909
farm0.085714
rumen0.076923
LOWER IN infectious bronchitis virus0.066667
LOWER IN bronchitis0.066667
skin of body0.066667
umbilicus0.066667
poland0.066667
nida basin0.066667
herbivorous beetle0.066667
argoptochus quadrisignatus0.066667
eidolon helvum0.066667
fruit bat0.066667
mucosa of stomach0.066667
sciurus carolinensis0.066667
eastern gray squirrel0.066667
pteropus giganteus0.066667
indian flying fox0.066667
swan goose0.066667
alpine pasture0.066667
alpine0.066667
cow milk (raw)0.066667
cow milk (fluid)0.066667
milk0.066667
estonia0.066667
LOWER IN russia0.066667
ammotragus lervia0.066667
barbary sheep0.066667
LOWER IN green stage diet0.066667
LOWER IN spring0.066667
LOWER IN withered grass diet0.066667
romania0.066667
ursu lake0.066667
hypersaline water0.066667
depth 4-9m0.066667
monimolimnion0.066667
LOWER IN depth 0-3m0.066667
LOWER IN mixolimnion0.066667
continuous cropping0.066667
age 5 years0.066667
age 10 years0.066667
ph 6.70.066667
china0.065574
beetle0.064516
anser cygnoides0.064516
mongolia0.064516
age < 3 years0.064516
pongo abelii0.064516
sumatran orangutan0.064516
giraffe0.064516
lake water0.064516
high salinity0.064516
LOWER IN low salinity0.064516
sugarcane0.064516
saccharum0.064516
guangzhou city prefecture0.064516
non-fertilized soil0.064516
LOWER IN china0.062500
giraffa camelopardalis0.062500
commonwealth of pennsylvania0.060606
south korea0.060606
ceratotherium simum0.060606
white rhinoceros0.060606
whole body0.058824
biopsy0.058824
lake0.058824
topsoil0.057143
depth 0-20cm0.057143
age 1 year0.057143
Fraction of dbbact annotations with this term covered by the query
TermScore
food product type0.500000
producer c10.500000
vigna radiata0.500000
mung bean sprouts0.500000
LOWER IN infectious bronchitis virus0.500000
LOWER IN bronchitis0.500000
skin of body0.500000
umbilicus0.500000
poland0.500000
nida basin0.500000
herbivorous beetle0.500000
argoptochus quadrisignatus0.500000
producer c20.500000
eidolon helvum0.500000
fruit bat0.500000
toronto zoo0.500000
mucosa of stomach0.500000
sciurus carolinensis0.500000
eastern gray squirrel0.500000
alfalfa sprouts0.500000
medicago sativa0.500000
pteropus giganteus0.500000
indian flying fox0.500000
african lion safari0.500000
swan goose0.500000
alpine pasture0.500000
alpine0.500000
cow milk (raw)0.500000
cow milk (fluid)0.500000
milk0.500000
estonia0.500000
LOWER IN russia0.500000
ammotragus lervia0.500000
barbary sheep0.500000
alpine meadow0.500000
ruminal fluid0.500000
grass growth diet0.500000
LOWER IN green stage diet0.500000
LOWER IN spring0.500000
LOWER IN withered grass diet0.500000
romania0.500000
ursu lake0.500000
hypersaline water0.500000
depth 4-9m0.500000
monimolimnion0.500000
LOWER IN depth 0-3m0.500000
LOWER IN mixolimnion0.500000
fragaria x ananassa0.500000
strawberry0.500000
yellow brown soil0.500000
nanjing city prefecture0.500000
continuous cropping0.500000
age 5 years0.500000
age 10 years0.500000
ph 6.70.500000
beetle0.333333
canada0.333333
anser cygnoides0.333333
mongolia0.333333
age < 3 years0.333333
pongo abelii0.333333
sumatran orangutan0.333333
yak0.333333
giraffe0.333333
lake water0.333333
high salinity0.333333
LOWER IN low salinity0.333333
sugarcane0.333333
saccharum0.333333
guangzhou city prefecture0.333333
non-fertilized soil0.333333
caecum0.250000
LOWER IN china0.250000
bos grunniens0.250000
giraffa camelopardalis0.250000
greenhouse soil0.250000
cecal content0.200000
commonwealth of pennsylvania0.200000
south korea0.200000
ceratotherium simum0.200000
white rhinoceros0.200000
whole body0.166667
biopsy0.166667
tibetan plateau0.166667
lake0.166667
LOWER IN winter0.142857
topsoil0.142857
depth 0-20cm0.142857
age 1 year0.142857
chicken0.125000
gallus gallus0.125000
plant0.125000
captive0.125000
bird0.125000
cultivated environment0.125000
summer0.111111
zoological garden0.100000
italy0.090909
dog0.083333
rumen0.083333
Fraction of annotations for the query sequences containing the term
TermScore
skin0.321429
canada0.285714
china0.250000
israel0.214286
food product type0.214286
zoological garden0.214286
captive0.214286
vigna radiata0.142857
mung bean sprouts0.142857
african lion safari0.142857
producer c10.107143
homo sapiens0.107143
producer c20.107143
summer0.107143
farm0.107143
chicken0.071429
gallus gallus0.071429
cecal content0.071429
caecum0.071429
research facility0.071429
toronto zoo0.071429
alfalfa sprouts0.071429
medicago sativa0.071429
feces0.071429
LOWER IN winter0.071429
bos grunniens0.071429
yak0.071429
tibetan plateau0.071429
alpine meadow0.071429
rumen0.071429
ruminal fluid0.071429
grass growth diet0.071429
rhizosphere0.071429
fragaria x ananassa0.071429
strawberry0.071429
greenhouse soil0.071429
yellow brown soil0.071429
nanjing city prefecture0.071429
cultivated environment0.071429
control0.035714
LOWER IN infectious bronchitis virus0.035714
LOWER IN bronchitis0.035714
skin of body0.035714
umbilicus0.035714
united states of america0.035714
adult0.035714
commonwealth of pennsylvania0.035714
poland0.035714
whole body0.035714
beetle0.035714
plant0.035714
nida basin0.035714
herbivorous beetle0.035714
argoptochus quadrisignatus0.035714
canis lupus familiaris0.035714
dog0.035714
eidolon helvum0.035714
fruit bat0.035714
south korea0.035714
mucosa of stomach0.035714
stomach0.035714
biopsy0.035714
sciurus carolinensis0.035714
eastern gray squirrel0.035714
pteropus giganteus0.035714
indian flying fox0.035714
anser cygnoides0.035714
swan goose0.035714
bird0.035714
mongolia0.035714
LOWER IN china0.035714
ceratotherium simum0.035714
white rhinoceros0.035714
alpine pasture0.035714
alpine0.035714
italy0.035714
cow milk (raw)0.035714
cow milk (fluid)0.035714
milk0.035714
infant0.035714
age < 3 years0.035714
estonia0.035714
LOWER IN russia0.035714
pongo abelii0.035714
sumatran orangutan0.035714
ammotragus lervia0.035714
barbary sheep0.035714
LOWER IN green stage diet0.035714
LOWER IN spring0.035714
LOWER IN withered grass diet0.035714
giraffa camelopardalis0.035714
giraffe0.035714
lake0.035714
romania0.035714
ursu lake0.035714
water0.035714
lake water0.035714
hypersaline water0.035714
high salinity0.035714
depth 4-9m0.035714
Exp. ID User ID Description Date Region Flag Sequences
587amnondominant israel, food product type, producer c1, vigna radiata, mung bean sprouts2020-02-10v3No1 / 15
604amnon high in control compared to infectious bronchitis virus bronchitis in chicken gallus gallus cecal content caecum china research facility 2020-04-06v3No1 / 16
623amnoncommon skin of body, skin, homo sapiens, umbilicus, united states of america, adult, commonwealth of pennsylvania2020-05-10v3No1 / 18
515amnoncommon poland, whole body, beetle, plant, nida basin, herbivorous beetle, argoptochus quadrisignatus2019-04-18v4No1 / 22
587amnondominant israel, food product type, vigna radiata, mung bean sprouts, producer c22020-02-10v3No1 / 23
587amnoncommon israel, food product type, producer c1, vigna radiata, mung bean sprouts2020-02-10v3No1 / 42
587amnoncommon israel, food product type, vigna radiata, mung bean sprouts, producer c22020-02-10v3No1 / 67
565amnoncommon skin, canada, canis lupus familiaris, dog2019-11-21v3No1 / 83
565amnoncommon skin, canada, eidolon helvum, fruit bat, zoological garden, toronto zoo, captive2019-11-21v3No1 / 83
569amnoncommon in gastric biopsies of patients negative for h. pylori (common homo sapiens, south korea, mucosa of stomach, stomach, biopsy)2019-12-16v3No1 / 85
565amnoncommon skin, canada, sciurus carolinensis, eastern gray squirrel2019-11-21v3No1 / 104
587amnoncommon israel, food product type, alfalfa sprouts, medicago sativa, producer c12020-02-10v3No1 / 106
565amnoncommon skin, canada, pteropus giganteus, indian flying fox, zoological garden, captive, african lion safari2019-11-21v3No1 / 109
417amnon high in mongolia summer compared to winter china in anser cygnoides swan goose bird feces 2018-12-01v4No1 / 114
565amnoncommon skin, canada, zoological garden, captive, african lion safari, ceratotherium simum, white rhinoceros2019-11-21v3No1 / 122
617amnoncommon alpine pasture, alpine, farm, italy, cow milk (raw), cow milk (fluid), milk2020-05-03v3No1 / 137
241amnonlower in babies from russia compared to estonia ( high in estonia compared to russia in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 169
565amnoncommon skin, canada, zoological garden, captive, toronto zoo, pongo abelii, sumatran orangutan2019-11-21v3No1 / 174
604amnoncommon chicken, gallus gallus, cecal content, caecum, china, research facility2020-04-06v3No1 / 185
565amnoncommon skin, canada, ammotragus lervia, barbary sheep, zoological garden, captive, african lion safari2019-11-21v3No1 / 205
587amnoncommon israel, food product type, alfalfa sprouts, medicago sativa, producer c22020-02-10v3No1 / 215
561amnon high in grass growth diet summer compared to green stage diet spring in bos grunniens yak china tibetan plateau alpine meadow rumen ruminal fluid 2019-11-05v3No1 / 256
561amnon high in grass growth diet summer compared to withered grass diet winter in ruminal fluid rumen alpine meadow tibetan plateau china yak bos grunniens 2019-11-05v3No1 / 294
565amnoncommon skin, canada, zoological garden, captive, african lion safari, giraffa camelopardalis, giraffe2019-11-21v3No1 / 310
577amnon high in hypersaline water high salinity depth 4-9m monimolimnion compared to depth 0-3m mixolimnion low salinity in lake romania ursu lake water lake water 2020-01-09v3No1 / 439
444amnoncommon rhizosphere, fragaria x ananassa, strawberry, greenhouse soil, farm, yellow brown soil, nanjing city prefecture, continuous cropping, age 5 years, age 10 years, china, cultivated environment2019-01-07v4No1 / 833
616amnoncommon in topsoil of non-fertilized sugarcane field (common ph 6.7, sugarcane, saccharum, soil, topsoil, depth 0-20cm, china, guangzhou city prefecture, non-fertilized soil)2020-04-27v3No1 / 1277
444amnoncommon rhizosphere, fragaria x ananassa, strawberry, greenhouse soil, farm, yellow brown soil, nanjing city prefecture, age 1 year, china, cultivated environment2019-01-07v4No1 / 1439

Problems / suggestions? Please email info AT dbbact DOT org