Search result for sequence:
GACGTAGGATGCAAGCGTTGTCCGGATTTATTGGGCGTAAAGAGTTCGTAGGCGGTTTGTTAAGTCTGATGTTAAAGATCGGGGCCCAACCCTGGGAGTGCATTGGATACTGGCAGACTGGAGTGCGGTAGAGGCTAGTGGAATTCCCAG
common ontology terms
term enrichment score
TermScore
minas gerais state0.571429
campos rupestres0.571429
barbacenia macrantha0.571429
philippine sea0.400000
depth (water) 300m0.333333
stem endosphere0.333333
root endosphere0.285714
stem0.200000
root0.111111
brazil0.097561
pacific ocean0.068966
sea water0.051282
water0.034483
Fraction of dbbact annotations with this term covered by the query
TermScore
philippine sea0.500000
minas gerais state0.500000
campos rupestres0.500000
barbacenia macrantha0.500000
depth (water) 300m0.333333
stem endosphere0.333333
root endosphere0.250000
stem0.142857
root0.066667
brazil0.052632
pacific ocean0.038462
sea water0.027778
water0.018182
Fraction of annotations for the query sequences containing the term
TermScore
minas gerais state0.666667
campos rupestres0.666667
brazil0.666667
barbacenia macrantha0.666667
water0.333333
pacific ocean0.333333
philippine sea0.333333
depth (water) 300m0.333333
sea water0.333333
root endosphere0.333333
root0.333333
stem0.333333
stem endosphere0.333333

Problems / suggestions? Please email info AT dbbact DOT org