Search result for sequence:
GACGTAGGGGGCAAGCGTTGTTCGGAATTATTGGGCGTAAAGCGCTCGTAGGCGGGACTGGAAGTCCGTGAAGAAATACCTCGGCTCAACTGAGGGGACGGCACGGATACTCTAGTTCTTGAGGCAATCAGAGGGTGATGGAATTCCCGG
common ontology terms
term enrichment score
TermScore
minas gerais state0.666667
campos rupestres0.666667
barbacenia macrantha0.666667
root endosphere0.333333
root0.117647
brazil0.100000
rhizosphere0.040816
Fraction of dbbact annotations with this term covered by the query
TermScore
minas gerais state0.500000
campos rupestres0.500000
barbacenia macrantha0.500000
root endosphere0.250000
root0.066667
brazil0.052632
rhizosphere0.021277
Fraction of annotations for the query sequences containing the term
TermScore
minas gerais state1.000000
campos rupestres1.000000
brazil1.000000
barbacenia macrantha1.000000
root endosphere0.500000
root0.500000
rhizosphere0.500000

Problems / suggestions? Please email info AT dbbact DOT org