Search result for sequence:
GACGTAGGGGGCAAGCGTTGTTCGGAATTATTGGGCGTAAAGCGCTCGTAGGCGGGACTGGAAGTCCGTGTTGAAAGACCTCGGCTCAACTGAGGGACCGGCTCGGATACTCTAGTTCTTGAGGCAATCAGAGGGTGATGGAATTCCCGG
common ontology terms
term enrichment score
TermScore
soil0.363353
rhizosphere0.298572
bulk soil0.184143
china0.164725
zhejiang province0.163934
alabama0.163265
ultisol0.163265
auburn0.150943
minas gerais state0.145833
campos rupestres0.145833
upland soil0.145833
wheat0.140704
ph 4-50.137143
mature barley plants0.127660
days 1800.127660
quzhou county0.127660
hordeum vulgare0.120000
depth (soil) 0-10cm0.118227
depth (soil) 0-20cm0.117073
depth (soil) 15cm0.113208
triticum aestivum0.104348
brazil0.101266
park0.090909
agricultural field0.089888
north china plain0.088889
taihu lake0.088889
taihu national park0.088889
pot expreiment0.088889
cultivated environment0.081633
topsoil0.080000
zea mays0.078431
lake sediment0.078431
soybean0.069364
red soil0.068182
fragaria x ananassa0.068182
strawberry0.068182
yellow brown soil0.068182
vellozia epidendroides0.068182
oak0.068182
lower saxony0.068182
sandy soil0.068182
depth 0-12cm0.068182
hapludalf0.068182
alfisol0.068182
illinois0.068182
dekalb county0.068182
cambisol0.065934
paddy field soil0.065934
ph 60.065934
quercus0.065934
depth (soil) 25-50cm0.065934
sandy loam0.065934
sandy loam soil0.065934
depth (water) 20-100cm0.065574
glycine max0.064865
ph<50.063830
greenhouse soil0.063830
nanjing city prefecture0.063830
LOWER IN biochar0.063830
depth (soil) 0-30 cm0.063830
maize field0.063830
LOWER IN root0.061856
ph 50.061856
germany0.061728
hunan province0.058252
agricultural feature0.057971
state of illinois0.056604
farm0.051282
winter0.050633
ph 4-60.047059
depth (soil) 10-25cm0.047059
rice0.046512
LOWER IN rhizosphere0.046512
subtropical broadleaf forest biome0.046512
continuous cropping0.046512
age 10 years0.046512
barbacenia macrantha0.046512
unamended with biochar0.046512
lushan mountain0.046512
mesocosm0.046512
depth (sediment) 0cm0.046512
elevation 2000-3000m0.046512
siliceous parent material0.046512
acute oak decline0.046512
panax notoginseng0.046512
sanqi plants0.046512
xundian county0.046512
thyrow0.046512
albic luvisol0.046512
lettuce0.046512
brassica oleracea0.045455
ph 4.50.045455
depth (sediment) 0-20cm0.045455
sediment surface0.045455
mountain0.045455
yunnan province0.045455
oryza sativa0.044944
rock0.044444
age 5 years0.044444
plant disease0.044444
Fraction of dbbact annotations with this term covered by the query
TermScore
quaternary laterite soil1.000000
cucurbita moschata1.000000
pumpkin1.000000
banana1.000000
musa acuminata1.000000
volcan sumaco1.000000
park0.666667
soybean0.666667
ph 4-60.666667
depth (soil) 10-25cm0.666667
bulk soil0.571429
field soil0.500000
central park0.500000
ph<5.50.500000
LOWER IN ph&gt;5.50.500000
rice0.500000
phyllosphere0.500000
quarry0.500000
duluth complex0.500000
north china plain0.500000
ph>7, ph<80.500000
ph>5, ph<60.500000
ph>4, ph<50.500000
subtropical broadleaf forest biome0.500000
red soil0.500000
copper0.500000
fragaria x ananassa0.500000
strawberry0.500000
yellow brown soil0.500000
continuous cropping0.500000
age 10 years0.500000
boreal wetland0.500000
seasonal frozen marsh0.500000
minas gerais state0.500000
campos rupestres0.500000
ph 3.50.500000
vellozia epidendroides0.500000
barbacenia macrantha0.500000
coarse-loamy soil0.500000
day 820.500000
LOWER IN stover amended0.500000
mature barley plants0.500000
days 1800.500000
quzhou county0.500000
unamended with biochar0.500000
lushan mountain0.500000
elevation 200-300m0.500000
elevation 500-600m0.500000
LOWER IN cherokia georgiana georgiana0.500000
LOWER IN millipede0.500000
mesocosm0.500000
taihu lake0.500000
taihu national park0.500000
depth (sediment) 0cm0.500000
elevation 2000-3000m0.500000
siliceous parent material0.500000
rhone river valley0.500000
ph 4.5-70.500000
canton of graubunden0.500000
baijiu0.500000
hefei city prefecture0.500000
days 0-900.500000
oak0.500000
acute oak decline0.500000
panax notoginseng0.500000
sanqi plants0.500000
xundian county0.500000
pot expreiment0.500000
bacillus amyloliquefaciens sqr90.500000
lower saxony0.500000
sandy soil0.500000
mineral fertilization0.500000
thyrow0.500000
albic luvisol0.500000
ph 6.40.500000
lettuce0.500000
alabama0.500000
upland soil0.500000
ultisol0.500000
depth 50-70cm0.500000
depth 70-100cm0.500000
LOWER IN depth 50-70cm0.500000
LOWER IN depth 50-90cm0.500000
foot slope 0.500000
depth 0-12cm0.500000
hapludalf0.500000
alfisol0.500000
illinois0.500000
dekalb county0.500000
LOWER IN depth 12-44cm0.500000
king george island0.500000
antarctic pearlwort0.500000
colobanthus quitensis0.500000
ph 5.50.500000
nanning city prefecture0.500000
stratovolcano0.500000
wheat0.400000
nicotiana tabacum0.333333
ph 5.60.333333
brassica oleracea0.333333
Fraction of annotations for the query sequences containing the term
TermScore
soil0.682927
china0.536585
rhizosphere0.280488
depth (soil) 0-20cm0.146341
zhejiang province0.121951
united states of america0.109756
bulk soil0.109756
ph 4-50.097561
brazil0.097561
auburn0.097561
alabama0.097561
agricultural field0.097561
ultisol0.097561
wheat0.085366
minas gerais state0.085366
campos rupestres0.085366
upland soil0.085366
triticum aestivum0.073171
depth (soil) 0-10cm0.073171
mature barley plants0.073171
days 1800.073171
hordeum vulgare0.073171
depth (soil) 15cm0.073171
quzhou county0.073171
germany0.060976
park0.048780
north china plain0.048780
agricultural feature0.048780
winter0.048780
topsoil0.048780
zea mays0.048780
farm0.048780
cultivated environment0.048780
taihu lake0.048780
taihu national park0.048780
depth (water) 20-100cm0.048780
lake sediment0.048780
pot expreiment0.048780
LOWER IN root0.036585
LOWER IN rhizosphere0.036585
glycine max0.036585
soybean0.036585
hunan province0.036585
red soil0.036585
cambisol0.036585
ph<50.036585
research facility0.036585
paddy field soil0.036585
fragaria x ananassa0.036585
strawberry0.036585
greenhouse soil0.036585
yellow brown soil0.036585
nanjing city prefecture0.036585
vellozia epidendroides0.036585
ph 60.036585
LOWER IN biochar0.036585
depth (soil) 0-30 cm0.036585
united kingdom0.036585
oak0.036585
quercus0.036585
ph 50.036585
lower saxony0.036585
sandy soil0.036585
maize field0.036585
depth (soil) 25-50cm0.036585
depth 0-12cm0.036585
sandy loam0.036585
sandy loam soil0.036585
hapludalf0.036585
alfisol0.036585
state of illinois0.036585
illinois0.036585
dekalb county0.036585
oryza sativa0.024390
rice0.024390
brassica0.024390
brassica oleracea0.024390
leaf0.024390
rock0.024390
guangdong province0.024390
subtropical broadleaf forest biome0.024390
forest ecosystem0.024390
woodland area0.024390
continuous cropping0.024390
age 5 years0.024390
age 10 years0.024390
ph 4-60.024390
root0.024390
barbacenia macrantha0.024390
biochar0.024390
unamended with biochar0.024390
jiangxi province0.024390
lushan mountain0.024390
forested area0.024390
ph 4.50.024390
mesocosm0.024390
state of georgia0.024390
depth (sediment) 0-20cm0.024390
sediment surface0.024390
depth (sediment) 0cm0.024390
Exp. ID User ID Description Date Region Flag Sequences
829sheryoDominant in soil depth of 0-12m in Alfisol soil, Dekalb, Illinois, united states of america (dominant depth 0-12cm, sandy loam, sandy loam soil, hapludalf, alfisol, united states of america, soil, state of illinois, illinois, dekalb county)2021-08-26v3No1 / 7
359amnondominant soil, topsoil, depth (soil) 0-10cm, guangdong province, subtropical broadleaf forest biome, china, forest ecosystem, woodland area2018-08-19v4No1 / 10
412amnondominant soil, hunan province, red soil, cambisol, zea mays, triticum aestivum, ph<5, china2018-11-26v4No1 / 11
823sheryoHigher in 25-50cm depth compared to 50-70cm depth in ultisol soil in auburn, alabama ( high in depth (soil) 25-50cm compared to depth 50-70cm in alabama auburn upland soil ultisol agricultural field soil )2021-08-07v3No1 / 161
628sheryoHigher in rhizosphere of barley roots after 180 days in treatments unamended with biochar ( high in unamended with biochar compared to biochar in china zhejiang province quzhou county soil depth (soil) 15cm ph 4-5 hordeum vulgare rhizosphere days 180 mature barley plants )2020-05-18v4No1 / 190
205amnoncommon in rock piles from duluth complex (common rock, united states of america, quarry, duluth complex, ph 4-5, state of minnesota, sulfide)2017-10-03v4No1 / 205
583amnoncommon soil, mountain, switzerland, ph 4-6, depth (soil) 0-10cm, elevation 2000-3000m, siliceous parent material, rhone river valley2020-01-27v3No1 / 234
698amnon high in ph 5-6 plant disease disease acute oak decline compared to ph 6-7 control in depth (soil) 0-30 cm depth (soil) 0-20cm park united kingdom oak quercus rhizosphere 2028-04-01v3No1 / 266
752sheryoHigher in treatments without biochar compared to treatments with biochar in soil planted with Panax notoginseng amended with 2% biochar ( high in without biochar compared to biochar in panax notoginseng sanqi plants ph 6 xundian county yunnan province china pot expreiment soil )2021-03-11v3No1 / 273
823sheryoHigher in 25-50cm depth compared to 10-25cm depth in ultisol soil in auburn, alabama ( high in depth (soil) 25-50cm compared to depth (soil) 10-25cm in alabama auburn upland soil ultisol agricultural field soil )2021-08-07v3No1 / 283
156amnoncommon brassica, brassica oleracea, leaf, phyllosphere, china2017-07-27v4No1 / 292
761sheryoHigher in bulk soil compared to maize rhizosphere in sandy soil maize field in Germany ( high in bulk soil compared to rhizosphere in ph 5 lower saxony sandy soil germany maize field )2021-04-06v3No1 / 294
882amnoncommon king george island, antarctic pearlwort, colobanthus quitensis, antarctica, rhizosphere2022-03-20v3No1 / 325
628sheryoHigher in bulk soil with barley plants after 180 days in treatments unamended with biochar ( high in unamended with biochar compared to biochar in bulk soil china zhejiang province quzhou county soil depth (soil) 15cm ph 4-5 hordeum vulgare days 180 mature barley plants )2020-05-18v4No1 / 327
583amnoncommon soil, mountain, switzerland, depth (soil) 0-10cm, elevation 2000-3000m, siliceous parent material, ph 4.5-7, canton of graubunden2020-01-27v3No1 / 359
823sheryoCommon at 70-100cm depth in ultisol soil in auburn, alabama (common depth 70-100cm, alabama, auburn, upland soil, ultisol, agricultural field, soil)2021-08-07v3No1 / 459
964amnoncommon stratovolcano, ph 4-5, soil, depth (soil) 10-25cm, ecuador, volcan sumaco2022-12-21v3No1 / 472
942amnoncommon banana, rhizosphere, nanning city prefecture, china, musa acuminata2022-11-25v3No1 / 505
762sheryocommin in bulk soil of a pot experiment with lettuce planted in npk fertilzed albic luvisol from Germany (common mineral fertilization, npk fertilization, germany, soil, bulk soil, thyrow, albic luvisol, ph 6.4, lettuce, pot expreiment)2021-04-07v3No1 / 531
603amnoncommon in baijiu fermentation pit mud in first 2 batches (common mud, fermentation pit mud, baijiu, china, hefei city prefecture, days 0-90)2020-04-05v3No1 / 542
548amnoncommon on leaf surface (common minas gerais state, campos rupestres, brazil, vellozia epidendroides, leaf)2019-08-17v4No1 / 548
548amnoncommon minas gerais state, campos rupestres, brazil, barbacenia macrantha, root endosphere, root2019-08-17v4No1 / 575
667amnoncommon depth (soil) 0-20cm, ph 4.5, elevation 500-600m, jiangxi province, lushan mountain, china, forested area, topsoil, soil2020-09-25v4No1 / 575
762sheryoHigh in bulk soil compared to rhizosphere of a pot experiment with lettuce planted in albic luvisol Germany ( high in bulk soil compared to rhizosphere in thyrow albic luvisol germany haplic luvisol pot expreiment lettuce soil )2021-04-08v3No1 / 578
444amnonhigher in continuously cropped strawberry soil ( high in continuous cropping age 5 years age 10 years compared to age 1 year in rhizosphere fragaria x ananassa strawberry greenhouse soil farm yellow brown soil nanjing city prefecture china cultivated environment )2019-01-07v4No1 / 602
667amnoncommon depth (soil) 0-20cm, jiangxi province, lushan mountain, china, forested area, ph 4.5, elevation 200-300m, topsoil, soil2020-09-25v4No1 / 613
823sheryoCommon at 50-70cm depth in ultisol soil in auburn, alabama (common depth 50-70cm, alabama, auburn, upland soil, ultisol, agricultural field, soil)2021-08-07v3No1 / 620
698amnoncommon depth (soil) 0-30 cm, depth (soil) 0-20cm, ph 4-4.5, park, london, united kingdom, oak, quercus, rhizosphere2028-04-01v3No1 / 623
548amnoncommon minas gerais state, campos rupestres, brazil, barbacenia macrantha, rhizosphere2019-08-17v4No1 / 651
823sheryoCommon at 25-50cm depth in ultisol soil in auburn, alabama (common depth (soil) 25-50cm, alabama, auburn, upland soil, ultisol, agricultural field, soil)2021-08-07v3No1 / 652
829sheryohigher soil depth of 0-12cm compared to 12-44cm in Alfisol soil, Dekalb, Illinois, united states of america ( high in depth 0-12cm compared to depth 12-44cm in sandy loam sandy loam soil hapludalf alfisol united states of america soil state of illinois illinois dekalb county )2021-08-26v3No1 / 685
506amnoncommon soil, boreal wetland, seasonal frozen marsh, depth (soil) 0-10cm, peat soil, northeast china, china, wetland area2019-03-16v4No1 / 690
754sheryoCommon in soil planted with cucmber, fertilized with bioorganic fertilizer (Bacillus amyloliquefaciens SQR 9) and infected with Fusarium oxysporum f. sp. cucumerinum (common bacillus amyloliquefaciens sqr9, zhejiang province, cucumber, fusarium oxysporum, bio-organic fertilizer, soil, china)2021-03-15v3No1 / 701
412amnon high in ph<5 compared to ph>5 in soil hunan province red soil cambisol zea mays triticum aestivum china 2018-11-26v4No1 / 706
752sheryoCommon in soil planted with Panax notoginseng (common panax notoginseng, sanqi plants, ph 6, xundian county, yunnan province, china, pot expreiment, soil)2021-03-11v3No1 / 730
823sheryoCommon at 0-10cm depth in ultisol soil in auburn, alabama (common depth (soil) 0-10cm, auburn, alabama, upland soil, agricultural field, ultisol, soil)2021-08-07v3No1 / 730
823sheryoCommon at 10-25cm depth in ultisol soil in auburn, alabama (common depth (soil) 10-25cm, alabama, auburn, upland soil, ultisol, agricultural field, soil)2021-08-07v3No1 / 732
829sheryoCommon in soil depth of 0-12m in Alfisol soil, Dekalb, Illinois, united states of america (common depth 0-12cm, sandy loam, sandy loam soil, hapludalf, alfisol, united states of america, soil, state of illinois, illinois, dekalb county)2021-08-26v3No1 / 737
421amnoncommon in paddy field soil incubated with copper (common soil, research facility, zhejiang province, paddy field soil, copper, china)2018-12-02v4No1 / 740
761sheryoCommon in maize rhizosphere sandy soil maize field in Germany (common zea mays, rhizosphere, ph 5, lower saxony, sandy soil, germany, maize field)2021-04-06v3No1 / 742
548amnoncommon in endopytic roots of Vellozia epidendroides (common minas gerais state, campos rupestres, brazil, vellozia epidendroides, plant, root)2019-08-15v4No1 / 800
412amnoncommon soil, hunan province, red soil, cambisol, zea mays, triticum aestivum, ph<5, china2018-11-26v4No1 / 823
421amnoncommon in paddy field soil incubated without copper (common research facility, soil, paddy field soil, zhejiang province, china)2018-12-02v4No1 / 824
444amnoncommon rhizosphere, fragaria x ananassa, strawberry, greenhouse soil, farm, yellow brown soil, nanjing city prefecture, continuous cropping, age 5 years, age 10 years, china, cultivated environment2019-01-07v4No1 / 833
761sheryoCommon in bulk sandy soil maize field in Germany (common ph 5, lower saxony, sandy soil, germany, maize field, bulk soil)2021-04-06v3No1 / 835
698amnoncommon depth (soil) 0-30 cm, depth (soil) 0-20cm, ph 5-6, disease, plant disease, acute oak decline, park, united kingdom, oak, quercus, rhizosphere2028-04-01v3No1 / 848
788amnoncommon soil, mesocosm, state of georgia, united states of america2021-05-31v4No1 / 897
548amnoncommon minas gerais state, campos rupestres, brazil, rock2019-08-17v4No1 / 924
359amnoncommon soil, topsoil, depth (soil) 0-10cm, guangdong province, subtropical broadleaf forest biome, china, forest ecosystem, woodland area2018-08-19v4No1 / 935
823sheryoHigher at 15-30cm depth compared to 50-90cm depth in foot slope ultisol soil in auburn, alabama ( high in depth (soil) 15-30cm compared to depth 50-90cm in foot slope alabama auburn ultisol agricultural field soil )2021-08-08v3No1 / 968
474amnoncommon soil, farm, glycine max, soybean, ph 4-6, brazil, cultivated environment2019-01-16v4No1 / 974
933amnoncommon guangxi zhuang autonomous region, ph 5.5, quaternary laterite soil, research facility, china, cucurbita moschata, pumpkin, rhizosphere2022-09-11v3No1 / 1002
628sheryocommon in bulk soil with barley plants after 180 days in treatments amended with biochar (common biochar, bulk soil, china, zhejiang province, quzhou county, soil, depth (soil) 15cm, ph 4-5, hordeum vulgare, days 180, mature barley plants)2020-05-18v4No1 / 1023
548amnoncommon minas gerais state, campos rupestres, brazil, rhizosphere, vellozia epidendroides2019-08-15v4No1 / 1040
628sheryocommon in bulk soil with barley plants after 180 days in treatments unamended with biochar (common bulk soil, china, zhejiang province, quzhou county, soil, depth (soil) 15cm, ph 4-5, hordeum vulgare, days 180, mature barley plants)2020-05-18v4No1 / 1136
628sheryocommon in rhizosphere of barley roots after 180 days in treatments amended with biochar (common mature barley plants, days 180, rhizosphere, hordeum vulgare, biochar, ph 4-5, depth (soil) 15cm, china, quzhou county, zhejiang province, soil)2020-05-18v4No1 / 1192
421amnoncommon soil, paddy field soil, zhejiang province, china2018-12-04v4No1 / 1194
628sheryocommon in rhizosphere of barley roots after 180 days in treatments unamended with biochar (common china, zhejiang province, quzhou county, soil, depth (soil) 15cm, ph 4-5, hordeum vulgare, rhizosphere, days 180, mature barley plants)2020-05-18v4No1 / 1209
901amnoncommon taihu lake, depth (sediment) 0-20cm, depth (water) 20-100cm, taihu national park, china, lake sediment2022-04-25v4No1 / 1246
901amnoncommon in macrophyte plant rhizosphere (common rhizosphere, depth (sediment) 0-20cm, taihu lake, taihu national park, china, depth (water) 20-100cm, lake sediment)2022-04-25v4No1 / 1378
788amnon high in soil compared to cherokia georgiana georgiana millipede feces in mesocosm state of georgia united states of america 2021-05-31v4No1 / 1395
40amnoncommon soil, field soil, nicotiana tabacum, rhizosphere, china2016-12-09v4No1 / 1420
444amnoncommon rhizosphere, fragaria x ananassa, strawberry, greenhouse soil, farm, yellow brown soil, nanjing city prefecture, age 1 year, china, cultivated environment2019-01-07v4No1 / 1439
271amnoncommon depth (soil) 0-20cm, rhizosphere, glycine max, soybean, china2018-01-09v4No1 / 1459
548amnoncommon in phosphorus impoverished soil (common soil, minas gerais state, campos rupestres, brazil, ph 3.5)2019-08-15v4No1 / 1483
145amnoncommon soil, rhizosphere, oryza sativa, rice, united states of america, ph 5.62017-04-19v4No1 / 1515
901amnoncommon sediment surface, depth (sediment) 0cm, taihu lake, depth (water) 20-100cm, taihu national park, china, lake sediment2022-04-25v4No1 / 1550
600sheryolower in stover ammendment soil ( high in unamended soil compared to stover amended in depth (soil) 0-5cm state of new york soil united states of america coarse-loamy soil ph 6 day 82 )2020-03-27v4No1 / 1612
901amnon high in sediment surface depth (sediment) 0cm compared to depth (sediment) 0-20cm in taihu lake depth (water) 20-100cm taihu national park china lake sediment 2022-04-25v4No1 / 1819
156amnoncommon soil, rhizosphere, brassica, brassica oleracea, china2017-07-27v4No1 / 1885
296amnoncommon depth (soil) 0-20cm, soil, north china plain, agricultural feature, wheat, winter, ph>4, ph<5, china2018-02-11v4No1 / 1886
296amnoncommon depth (soil) 0-20cm, soil, north china plain, agricultural feature, wheat, winter, ph>7, ph<8, china2018-02-11v4No1 / 2160
296amnoncommon in wheat field soil (common soil, north china plain, depth 5cm, agricultural feature, wheat, winter, china)2018-02-11v4No1 / 2341
155amnoncommon in soil loosely bound to wheat root (common triticum aestivum, wheat, soil, rhizosphere, china)2017-07-02v4No1 / 2425
155amnoncommon in bulk soil in wheat field (common triticum aestivum, wheat, soil, bulk soil, china)2017-07-02v4No1 / 2594
271amnoncommon depth (soil) 0-20cm, soil, china2018-01-09v4No1 / 2856
155amnonlower in tightly bound root soil compared to loose soil and bulk soil ( high in bulk soil compared to root in triticum aestivum wheat soil china )2017-07-02v4No1 / 2933
296amnoncommon depth (soil) 0-20cm, soil, north china plain, agricultural feature, wheat, winter, ph>5, ph<6, china2018-02-11v4No1 / 3508
100amnon high in ph ph<5.5 compared to ph>5.5 in soil urban biome park new york city central park 2017-04-03v4No1 / 4262
271amnon high in soil compared to rhizosphere glycine max soybean in depth (soil) 0-20cm china 2018-01-09v4No1 / 4853
171amnonlower in roots compared to rhizosphere soil in rice ( high in rhizosphere soil compared to root in united states of america state of california oryza sativa rice )2017-07-25v4No1 / 7628
271amnon high in soil rhizosphere compared to root structure root in depth (soil) 0-20cm glycine max soybean china 2018-01-09v4No1 / 7954

Problems / suggestions? Please email info AT dbbact DOT org