Search result for sequence:
GATGAACGCTAGCGGCAGGCCTAATACATGCAAGTCGGACGGGATTCAGGGAGTAGCTTGCTACGAACTGATGAGAGTGGCGCACGGGTGCGTAACGCGTGAGCAACCTACCCATATCAGGGGGATAGCCTCTCGAAAGAGAGATTAACA
common ontology terms
term enrichment score
TermScore
skin0.326531
frog0.191489
pond0.187500
cambridgeshire0.186047
salamandra salamandra0.173913
newt0.170213
united kingdom0.162896
germany0.160714
fire salamander0.146341
brazil0.137931
amphibian larval stage0.136364
larval stage0.117647
triturus cristatus0.102564
lissotriton vulgaris0.102564
ensete ventricosum0.102564
ethiopian banana0.102564
days 30-600.102564
anaerobic fermentation0.102564
intestine0.097561
whole body0.095238
wheat0.093023
ethiopia0.093023
late timepoint0.093023
triticum aestivum0.088889
fresh water0.083916
rhizosphere0.080000
food (fermented)0.078431
toad0.075949
stream0.075949
farm0.073620
digestive system0.071429
mucus0.065934
soil0.063158
australia0.060914
water0.056872
ixodes fecialis0.054054
bufo bufo0.054054
common toad0.054054
chile0.054054
eupsophus vertebralis0.054054
southern united states0.054054
lithobates catesbeianus0.054054
lesser foam frog0.054054
LOWER IN bulk soil0.054054
ensete ventricosum var. gena0.054054
alpine pasture0.054054
alpine0.054054
cow milk (raw)0.054054
cow milk (fluid)0.054054
milk0.054054
size < 10um0.054054
clear day0.054054
chuquisaca department0.054054
forearm0.054054
days 30-400.054054
ryegrass0.054054
tick0.052632
snake0.052632
rana catesbeiana0.052632
bullfrog0.052632
brassica oleracea0.052632
seed0.052632
dust0.052632
age 5-13 years0.052632
arm0.052632
10 cm depth0.052632
beetle0.052632
united states of america0.051423
LOWER IN pond0.051282
jiangxi province0.051282
bolivia0.051282
river0.048780
hunan province0.048780
jiangsu province0.048780
adult0.048760
french republic0.047619
ph 7-80.047619
body proper0.045455
LOWER IN wild0.044444
rural community0.044444
air0.043478
china0.043400
italy0.041667
israel0.040816
fish0.040816
root0.040000
child0.033333
homo sapiens0.031373
research facility0.029851
coluber constrictor0.027778
eastern racer snake0.027778
scinax perereca0.027778
lesser treefrog0.027778
leptodactylus latrans0.027778
LOWER IN ensete ventricosum var. maze0.027778
rhinella icterica0.027778
yellow cururu toad0.027778
spring0.027778
remartinia0.027778
aeshnidae0.027778
Fraction of dbbact annotations with this term covered by the query
TermScore
pond1.500000
salamandra salamandra0.666667
ixodes fecialis0.500000
bufo bufo0.500000
common toad0.500000
cambridgeshire0.500000
triturus cristatus0.500000
fire salamander0.500000
lissotriton vulgaris0.500000
chile0.500000
eupsophus vertebralis0.500000
southern united states0.500000
coluber constrictor0.500000
eastern racer snake0.500000
lithobates catesbeianus0.500000
lesser foam frog0.500000
scinax perereca0.500000
lesser treefrog0.500000
leptodactylus latrans0.500000
LOWER IN bulk soil0.500000
ensete ventricosum0.500000
ethiopian banana0.500000
days 30-600.500000
anaerobic fermentation0.500000
ensete ventricosum var. gena0.500000
LOWER IN ensete ventricosum var. maze0.500000
rhinella icterica0.500000
yellow cururu toad0.500000
spring0.500000
remartinia0.500000
aeshnidae0.500000
dragonfly0.500000
LOWER IN ensete ventricosum var. ketishe0.500000
kitchen0.500000
sink0.500000
alpine pasture0.500000
alpine0.500000
cow milk (raw)0.500000
cow milk (fluid)0.500000
milk0.500000
size < 10um0.500000
clear day0.500000
LOWER IN dust day0.500000
scinax fuscovarius0.500000
pantherophis obsoletus0.500000
black rat snake0.500000
arboreal snake0.500000
koshi river0.500000
tributary0.500000
LOWER IN lowland farm0.500000
LOWER IN lowland pasture0.500000
hirundo rustica0.500000
colorado0.500000
barn swallow0.500000
LOWER IN barn0.500000
LOWER IN hay0.500000
chlorophytum comosum0.500000
astyanax paranae0.500000
astyanax0.500000
bank vole0.500000
myodes glareolus0.500000
ukraine0.500000
poecilia reticulata0.500000
guppy0.500000
denali national park and preserve0.500000
terminus of glacier0.500000
LOWER IN top of glacier0.500000
LOWER IN caecum0.500000
LOWER IN digestive system0.500000
LOWER IN colon0.500000
LOWER IN quasipaa spinosa0.500000
LOWER IN giant spiny frog0.500000
LOWER IN days 1-150.500000
LOWER IN aerobic fermentation0.500000
nanger granti0.500000
kenya0.500000
tropical grassland biome0.500000
gazelle0.500000
LOWER IN wound0.500000
LOWER IN ulcer0.500000
chuquisaca department0.500000
forearm0.500000
days 30-400.500000
ryegrass0.500000
carnivorous beetle0.500000
poland0.500000
carabidae0.500000
LOWER IN staphylinidae0.500000
detritivorous beetle0.500000
bulgaria0.500000
LOWER IN herbivorous beetle0.500000
frog0.375000
tick0.333333
toad0.333333
newt0.333333
amphibian larval stage0.333333
snake0.333333
rana catesbeiana0.333333
bullfrog0.333333
dendropsophus minutus0.333333
Fraction of annotations for the query sequences containing the term
TermScore
skin0.400000
adult0.271429
brazil0.142857
germany0.128571
united kingdom0.128571
frog0.128571
newt0.114286
cambridgeshire0.114286
united states of america0.114286
china0.114286
research facility0.100000
salamandra salamandra0.100000
larval stage0.100000
intestine0.100000
pond0.100000
soil0.100000
fire salamander0.085714
amphibian larval stage0.085714
rhizosphere0.071429
digestive system0.071429
homo sapiens0.071429
whole body0.057143
triturus cristatus0.057143
lissotriton vulgaris0.057143
triticum aestivum0.057143
wheat0.057143
ethiopia0.057143
ensete ventricosum0.057143
ethiopian banana0.057143
late timepoint0.057143
days 30-600.057143
anaerobic fermentation0.057143
food (fermented)0.057143
farm0.057143
water0.057143
fresh water0.057143
australia0.042857
toad0.042857
mucus0.042857
stream0.042857
feces0.042857
ixodes fecialis0.028571
tick0.028571
body proper0.028571
bufo bufo0.028571
common toad0.028571
chile0.028571
eupsophus vertebralis0.028571
snake0.028571
southern united states0.028571
rana catesbeiana0.028571
bullfrog0.028571
lithobates catesbeianus0.028571
lesser foam frog0.028571
LOWER IN bulk soil0.028571
ensete ventricosum var. gena0.028571
LOWER IN pond0.028571
LOWER IN wild0.028571
alpine pasture0.028571
alpine0.028571
italy0.028571
cow milk (raw)0.028571
cow milk (fluid)0.028571
milk0.028571
brassica oleracea0.028571
french republic0.028571
seed0.028571
israel0.028571
air0.028571
dust0.028571
size < 10um0.028571
clear day0.028571
river0.028571
fish0.028571
hunan province0.028571
jiangxi province0.028571
child0.028571
age 5-13 years0.028571
bolivia0.028571
rural community0.028571
chuquisaca department0.028571
arm0.028571
forearm0.028571
days 30-400.028571
ryegrass0.028571
ph 7-80.028571
10 cm depth0.028571
jiangsu province0.028571
beetle0.028571
root0.028571
coluber constrictor0.014286
eastern racer snake0.014286
scinax perereca0.014286
dendropsophus minutus0.014286
lesser treefrog0.014286
leptodactylus latrans0.014286
LOWER IN ensete ventricosum var. maze0.014286
rhinella icterica0.014286
yellow cururu toad0.014286
desert0.014286
Exp. ID User ID Description Date Region Flag Sequences
621amnoncommon ixodes fecialis, tick, body proper, whole body, australia2020-05-07v1No1 / 5
492amnondominant skin, adult, germany, bufo bufo, toad, common toad2019-02-27v4No1 / 12
353amnonhigh freq. in captive Triturus cristatus newts skin (dominant newt, adult, skin, cambridgeshire, triturus cristatus, research facility, united kingdom)2018-07-30v4No1 / 16
149amnondominant salamandra salamandra, fire salamander, germany, larval stage, amphibian larval stage, skin, mucus2017-04-24v4No1 / 17
353amnonhigh freq. in captive Lissotriton vulgaris newts skin (dominant newt, adult, skin, cambridgeshire, research facility, lissotriton vulgaris, united kingdom)2018-07-30v4No1 / 19
492amnondominant skin, adult, chile, eupsophus vertebralis, frog2019-02-27v4No1 / 19
536amnondominant snake, skin, united states of america, southern united states, coluber constrictor, eastern racer snake2019-07-28v4No1 / 19
492amnoncommon skin, adult, brazil, rana catesbeiana, bullfrog, lithobates catesbeianus, frog2019-02-27v4No1 / 22
621amnondominant ixodes fecialis, tick, body proper, whole body, australia2020-05-07v1No1 / 23
492amnoncommon brazil, skin, adult, lesser foam frog, scinax perereca, frog2019-02-27v4No1 / 29
149amnoncommon salamandra salamandra, fire salamander, germany, larval stage, amphibian larval stage, intestine, pond2017-04-24v4No1 / 30
492amnoncommon brazil, skin, frog, dendropsophus minutus, lesser treefrog, adult2019-02-27v4No1 / 30
492amnoncommon brazil, skin, adult, leptodactylus latrans, frog, lesser foam frog2019-02-27v4No1 / 33
149amnoncommon salamandra salamandra, fire salamander, germany, larval stage, amphibian larval stage, skin, mucus2017-04-24v4No1 / 48
492amnoncommon skin, adult, chile, eupsophus vertebralis, frog2019-02-27v4No1 / 54
149amnoncommon salamandra salamandra, fire salamander, germany, larval stage, amphibian larval stage, intestine, stream2017-04-24v4No1 / 59
155amnonlower in bulk soil compared to loose bound root soil ( high in rhizosphere compared to bulk soil in triticum aestivum wheat soil china )2017-07-02v4No1 / 62
539amnon high in ensete ventricosum var. gena compared to ensete ventricosum var. maze in ethiopia ensete ventricosum ethiopian banana late timepoint days 30-60 anaerobic fermentation food (fermented) 2019-07-31v4No1 / 64
353amnoncommon in captive Triturus cristatus newts skin (common newt, adult, skin, cambridgeshire, triturus cristatus, research facility, united kingdom)2018-07-30v4No1 / 83
353amnoncommon in captive Lissotriton vulgaris newts skin (common newt, adult, skin, cambridgeshire, research facility, lissotriton vulgaris, united kingdom)2018-07-30v4No1 / 85
492amnoncommon brazil, skin, adult, rhinella icterica, toad, yellow cururu toad2019-02-27v4No1 / 94
360amnon high in spring compared to summer in desert mexico state of california soil rhizosphere 2018-08-21v4No1 / 96
499amnoncommon digestive system, pond, intestine, brazil, remartinia, aeshnidae, dragonfly, larval stage2019-03-05v4No1 / 103
377amnoncommon salamandra salamandra, salamander, skin, germany2018-09-12v4No1 / 105
149amnon high in stream compared to pond in salamandra salamandra fire salamander germany larval stage amphibian larval stage intestine 2017-04-24v4No1 / 106
353amnonhigher in captive compared to wild caught Lissotriton vulgaris newts skin ( high in research facility compared to wild in newt adult skin cambridgeshire lissotriton vulgaris united kingdom )2018-07-30v4No1 / 109
492amnoncommon skin, adult, germany, bufo bufo, toad, common toad2019-02-27v4No1 / 114
149amnonhigher in larvae transferred to stream compared to pond ( high in stream compared to pond in salamandra salamandra fire salamander germany larval stage amphibian larval stage skin mucus )2017-04-24v4No1 / 116
539amnon high in ensete ventricosum var. gena compared to ensete ventricosum var. ketishe in ethiopia ensete ventricosum ethiopian banana late timepoint days 30-60 anaerobic fermentation food (fermented) 2019-07-31v4No1 / 122
199amnoncommon in kitchen sink (common building, urban biome, united states of america, kitchen, sink)2017-10-01v4No1 / 129
353amnonhigher in captive compared to wild caught Lissotriton vulgaris newts skin ( high in research facility compared to wild in newt adult skin cambridgeshire triturus cristatus united kingdom )2018-07-30v4No1 / 134
617amnoncommon alpine pasture, alpine, farm, italy, cow milk (raw), cow milk (fluid), milk2020-05-03v3No1 / 136
29amnoncommon brassica oleracea, french republic, seed2016-12-05v4No1 / 145
539amnoncommon ethiopia, ensete ventricosum, ethiopian banana, late timepoint, days 30-60, anaerobic fermentation, food (fermented)2019-07-31v4No1 / 160
206amnonhigher in dust storm compared to clear day in israel air ( high in clear day compared to dust day in israel air dust size < 10um )2017-10-04v4No1 / 172
499amnoncommon brazil, pond, digestive system, intestine, scinax fuscovarius, frog, tadpole2019-03-05v4No1 / 175
536amnoncommon snake, skin, united states of america, southern united states, pantherophis obsoletus, black rat snake, arboreal snake2019-07-28v4No1 / 183
534amnoncommon river, water, fresh water, depth 10 cm, koshi river, tributary, nepal, particle bound, filtered 2.7um2019-07-22v4No1 / 192
617amnonhigher in cow milk of cows in alpine pasture compared to lowland farm ( high in alpine pasture alpine compared to lowland farm lowland pasture in farm italy cow milk (raw) cow milk (fluid) milk )2020-05-03v3No1 / 203
499amnoncommon brazil, pond, water, pond water, fresh water2019-03-05v4No1 / 227
492amnoncommon skin, adult, rana catesbeiana, bullfrog, lithobates catesbeianus, frog, japan2019-02-27v4No1 / 235
161amnoncommon in barn swallows in colorado (common hirundo rustica, feces, united states of america, colorado, barn swallow)2017-07-12v4No1 / 244
384amnon high in pasture compared to barn hay in equus caballus horse canada farm saliva mouth 2018-10-22v4No1 / 244
63amnon high in male compared to female in homo sapiens feces united states of america 2017-12-04v4No1 / 261
361amnoncommon leaf, austria, greenhouse, plant, chlorophytum comosum2018-08-21v4No1 / 269
499amnoncommon brazil, pond, digestive system, intestine, astyanax paranae, fish, astyanax2019-03-05v4No1 / 272
315amnoncommon in frog pond water (common hunan province, jiangxi province, water, fresh water, pond, china)2018-04-10v4No1 / 273
423amnoncommon bank vole, myodes glareolus, ukraine, skin2018-12-05v4No1 / 290
499amnoncommon brazil, pond, poecilia reticulata, digestive system, intestine, fish, guppy2019-03-05v4No1 / 307
174amnonlower farther away from glacier terminus ( high in terminus of glacier compared to top of glacier in alaska united states of america denali national park and preserve glacier surface debris )2017-07-27v4No1 / 309
471amnon high in adult compared to tadpole in digestive system frog osteopilus septentrionalis research facility united states of america state of florida 2019-01-14v4No1 / 327
29amnon high in seed compared to seedling in brassica oleracea french republic 2016-12-05v4No1 / 378
256amnonhigher in small intestine compared to colon in pigs ( high in duodenum jejunum ileum compared to caecum right colon left colon in sus scrofa pig united kingdom )2017-11-26v4No1 / 386
353amnoncommon in wild Lissotriton vulgaris newts skin (common newt, adult, skin, lissotriton vulgaris, cambridgeshire, united kingdom)2018-07-30v4No1 / 417
353amnoncommon in wild Triturus cristatus newts skin (common newt, adult, skin, cambridgeshire, triturus cristatus, united kingdom)2018-07-30v4No1 / 455
315amnonhigher in frog pond water compared to frog gut ( high in water fresh water compared to digestive system colon frog quasipaa spinosa giant spiny frog in jiangxi province hunan province china )2018-04-10v4No1 / 504
539amnon high in days 30-60 anaerobic fermentation late timepoint compared to days 1-15 aerobic fermentation early timepoint in ethiopia ensete ventricosum ethiopian banana food (fermented) 2019-07-31v4No1 / 509
206amnoncommon in air from israel particles <10um size (common air, dust, israel, size < 10um, clear day)2017-10-04v4No1 / 764
78amnon high in female compared to male in nanger granti kenya feces tropical grassland biome gazelle 2017-03-01v4No1 / 813
232amnonlower in diabetec foot ulcers compared to non-ulcer skin in diabetic patients ( high in control compared to wound ulcer in homo sapiens skin australia foot diabetes mellitus )2017-11-05v4No1 / 835
517amnon high in skin arm forearm compared to feces in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 835
624sheryoCommon in ryegrass rhizosphere soil after 30-40 days (common days 30-40, rhizosphere, ryegrass, ph 7-8, 10 cm depth, soil, jiangsu province, china)2020-05-11v4No1 / 965
193amnonhigher in nares of people working in dairy farms ( high in bos taurus farm compared to control in homo sapiens united states of america pair of nares )2017-09-05v4No1 / 991
517amnon high in skin arm forearm compared to mouth mucosa mouth in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 1013
624sheryocommon in ryegrass rhizosphere soil amended with biochar after 30-40 days (common china, jiangsu province, soil, 10 cm depth, ph 7-8, ryegrass, rhizosphere, days 30-40, biochar)2020-05-11v4No1 / 1016
515amnon high in carabidae compared to staphylinidae in whole body beetle carnivorous beetle river poland 2019-04-19v4No1 / 1129
515amnon high in detritivorous beetle bulgaria compared to herbivorous beetle poland in whole body beetle 2019-04-19v4No1 / 1542
155amnonhigher in tightly bound root soil compared to loose soil and bulk soil ( high in root compared to bulk soil in triticum aestivum wheat soil china )2017-07-02v4No1 / 1713
155amnoncommon in soil tightly bound to wheat root (common triticum aestivum, wheat, soil, root, china)2017-07-02v4No1 / 1976
155amnoncommon in soil loosely bound to wheat root (common triticum aestivum, wheat, soil, rhizosphere, china)2017-07-02v4No1 / 2424

Problems / suggestions? Please email info AT dbbact DOT org