Search result for sequence:
TAAAGAGGATGCAAGTGCTATCCAGAATGATTAGGCGTTAAGCGTTTGTAGGTGGCTTTTTAAGTCCTCCATCAAATCCCAGGACTCAACTCTGGACAGGCGGTGGAAACAACCAAGCTCGAGTACGATAGAGGCAGAGGGAATTTTCAG
common ontology terms
term enrichment score
TermScore
maryland county0.500000
solanum lycopersicum0.413793
foodon product type0.222222
leaf0.090909
united states of america0.008065
Fraction of dbbact annotations with this term covered by the query
TermScore
maryland county0.500000
solanum lycopersicum0.285714
foodon product type0.200000
leaf0.050000
united states of america0.004098
Fraction of annotations for the query sequences containing the term
TermScore
solanum lycopersicum0.750000
leaf0.500000
maryland county0.500000
united states of america0.250000
foodon product type0.250000

Problems / suggestions? Please email info AT dbbact DOT org