Search result for sequence:
TACAGAGACTGCGAGCGTTATTCGGATTCACTGGGCGTAAAGGGTGCGCAGGCGGTCGTGTGTGTTAGGTGTGAAAGCCCGAGGCTCAACCTCGGAACTGCGCCTAAAACTACACGACTAGAGTATTGGAGAGGGTAGCGGAATTCATGG
common ontology terms
term enrichment score
TermScore
ants0.536585
cephalotes0.428571
ant0.294118
peru0.271845
pseudomyrmex0.255319
turtle ants0.173913
solenopsis0.173913
costa rica0.169492
dolichoderus0.095238
carpenter ant0.095238
neoponera0.095238
azteca0.095238
myrmelachista0.095238
odontomachus0.095238
pseudomyrmex gracilis0.095238
generalist0.095238
LOWER IN pseudomyrmex flavicornis0.095238
LOWER IN pseudomyrmex nigrocinctus0.095238
LOWER IN pseudomyrmex spinicola0.095238
LOWER IN acacia ants0.095238
camponotus0.090909
crematogaster0.090909
eciton0.086957
stomach0.085714
LOWER IN larval stage0.060606
larval stage0.060606
digestive system0.050817
united states of america0.007610
Fraction of dbbact annotations with this term covered by the query
TermScore
cephalotes0.666667
pseudomyrmex0.666667
dolichoderus0.500000
ants0.500000
turtle ants0.500000
carpenter ant0.500000
neoponera0.500000
solenopsis0.500000
azteca0.500000
myrmelachista0.500000
odontomachus0.500000
pseudomyrmex gracilis0.500000
generalist0.500000
LOWER IN pseudomyrmex flavicornis0.500000
LOWER IN pseudomyrmex nigrocinctus0.500000
LOWER IN pseudomyrmex spinicola0.500000
LOWER IN acacia ants0.500000
camponotus0.333333
ant0.333333
crematogaster0.333333
eciton0.250000
peru0.166667
costa rica0.125000
LOWER IN larval stage0.071429
larval stage0.071429
stomach0.058824
digestive system0.026316
united states of america0.003861
Fraction of annotations for the query sequences containing the term
TermScore
peru0.736842
digestive system0.736842
ants0.578947
cephalotes0.315789
ant0.263158
costa rica0.263158
united states of america0.263158
pseudomyrmex0.157895
stomach0.157895
turtle ants0.105263
solenopsis0.105263
dolichoderus0.052632
camponotus0.052632
carpenter ant0.052632
neoponera0.052632
azteca0.052632
LOWER IN larval stage0.052632
crematogaster0.052632
larval stage0.052632
myrmelachista0.052632
eciton0.052632
odontomachus0.052632
pseudomyrmex gracilis0.052632
generalist0.052632
LOWER IN pseudomyrmex flavicornis0.052632
LOWER IN pseudomyrmex nigrocinctus0.052632
LOWER IN pseudomyrmex spinicola0.052632
LOWER IN acacia ants0.052632
Exp. ID User ID Description Date Region Flag Sequences
184amnoncommon peru, digestive system, dolichoderus, ants2017-08-15v4No1 / 2
184amnoncommon peru, digestive system, cephalotes, turtle ants2017-08-15v4No1 / 2
184amnoncommon peru, digestive system, ants, pseudomyrmex2017-08-15v4No1 / 4
184amnoncommon peru, camponotus, carpenter ant, digestive system2017-08-15v4No1 / 5
184amnoncommon peru, digestive system, ants, neoponera2017-08-15v4No1 / 5
184amnoncommon peru, digestive system, ants, solenopsis2017-08-15v4No1 / 5
184amnoncommon peru, digestive system, azteca, ants2017-08-15v4No1 / 7
184amnondominant peru, digestive system, ants, solenopsis2017-08-15v4No1 / 7
408amnon high in stomach compared to larval stage in ant cephalotes costa rica united states of america 2018-11-22v4No1 / 10
184amnondominant peru, digestive system, ants, pseudomyrmex2017-08-15v4No1 / 11
184amnoncommon peru, digestive system, ants, crematogaster2017-08-15v4No1 / 12
408amnoncommon ant, cephalotes, costa rica, united states of america, larval stage2018-11-22v4No1 / 16
184amnoncommon peru, digestive system, myrmelachista, ants2017-08-15v4No1 / 17
184amnondominant peru, digestive system, cephalotes, turtle ants2017-08-15v4No1 / 18
408amnoncommon ant, cephalotes, stomach, costa rica, united states of america2018-11-22v4No1 / 18
184amnoncommon peru, digestive system, ants, eciton2017-08-15v4No1 / 20
184amnoncommon peru, digestive system, ants, odontomachus2017-08-15v4No1 / 20
408amnondominant ant, cephalotes, stomach, costa rica, united states of america2018-11-22v4No1 / 20
408amnon high in pseudomyrmex gracilis generalist compared to pseudomyrmex flavicornis pseudomyrmex nigrocinctus pseudomyrmex spinicola acacia ants in ant costa rica united states of america pseudomyrmex 2018-11-22v4No1 / 54

Problems / suggestions? Please email info AT dbbact DOT org