Search result for sequence:
TACAGAGGATGCAAGCGTTATCCGGAATGATTGGGCGTAAAGCGTCTGTAGGTGGCTTTTTAAGTCCGCCGTCAAATCCCAGGGCTCAACCCTGGACAGGCGGTGGAAACTACCAAGCTGGAGTACGGTAGGGGCAGAGGGAATTTCCGG
common ontology terms
term enrichment score
TermScore
united states of america0.217388
skin0.172107
citrus0.169014
feces0.156380
homo sapiens0.153727
leaf0.153285
whole body0.136223
rhizosphere0.129181
beetle0.117647
food product0.104689
soil0.101726
china0.094582
plant0.094044
florida0.092593
cultivated habitat0.088496
state of california0.088328
orchard0.085246
belgium0.080808
digestive system0.077037
air0.073538
poland0.070513
vitis vinifera0.068027
costa rica0.061538
monkey0.061350
herbivorous beetle0.060606
nida basin0.060606
mucus0.060606
italy0.058824
larval stage0.058140
adult0.057781
merlot0.054237
grapevine0.054237
new york0.054237
solanum lycopersicum0.047782
urban biome0.047782
ivy0.047782
hedera ibernica0.047782
pair of nares0.047498
commonwealth of virginia0.047218
child0.043933
hunter gatherer0.041812
arm0.041667
building0.041667
state of rhode island0.041237
mediterranean fruit fly0.041237
ceratitis capitata0.041237
woodland0.040956
water0.040936
austria0.040404
new york city0.039604
israel0.039216
australia0.038835
ocean0.038585
pacific ocean0.038339
city0.038339
root0.037736
body proper0.037383
research facility0.036849
capsicum annuum0.034904
dust0.034904
venezuela0.034904
amerindian0.034904
french republic0.034904
greenhouse0.034602
ethiopia0.034602
tomato0.034602
balkan mountains0.034602
bulgaria0.034602
detritivorous beetle0.034602
rural community0.033727
fermented food product0.033445
grape0.028070
peru0.028070
nectar0.028070
mongolia0.028070
ant0.027875
size < 10um0.027875
junco hyemalis0.027875
songbird0.027875
forearm0.027875
chuquisaca department0.027875
age 5-13 years0.027875
southern united states0.027875
flower0.027682
bird0.027491
wild0.027491
foot0.027491
snake0.027491
state of florida0.027491
bolivia0.027119
river0.027119
canis lupus familiaris0.026876
fresh water0.026519
stomach0.026403
summer0.025890
bombus terrestris0.021164
apis mellifera0.021164
cebus capucinus0.021164
white-faced capuchin0.021164
state of illinois0.021164
Fraction of dbbact annotations with this term covered by the query
TermScore
hunter gatherer0.750000
citrus0.666667
vitis vinifera0.666667
grape0.666667
beetle0.666667
peru0.666667
costa rica0.666667
nectar0.666667
bombus terrestris0.666667
belgium0.666667
capsicum annuum0.666667
mongolia0.666667
apis mellifera0.666667
dust0.666667
arm0.666667
venezuela0.666667
amerindian0.666667
building0.666667
cebus capucinus0.666667
white-faced capuchin0.666667
french republic0.666667
state of illinois0.666667
newt0.666667
particle bound0.666667
ph>50.666667
monkey0.625000
food product0.600000
air0.545455
red pepper0.500000
malus x domestica0.500000
apple0.500000
greenhouse0.500000
malvaviscus penduliflorus0.500000
vero beach, fl0.500000
merlot0.500000
grapevine0.500000
new york0.500000
immokalee, fl0.500000
gainesville, fl0.500000
cauliflower0.500000
solanum lycopersicum0.500000
ft. pierce, fl0.500000
quincy, fl0.500000
state of rhode island0.500000
orchard0.500000
argoptochus quadrisignatus0.500000
herbivorous beetle0.500000
nida basin0.500000
whole body0.500000
squash0.500000
ants0.500000
neoponera0.500000
endosphere0.500000
eusomus ovulum0.500000
reunion island0.500000
polydrusus inustus0.500000
azteca0.500000
fungus growing ant0.500000
atta colombica0.500000
ant0.500000
pseudomyrmex cubaensis0.500000
nicotiana glauca0.500000
spice product0.500000
spice0.500000
chlorocebus djamdjamensis0.500000
bale monkey0.500000
ethiopia0.500000
citrus sinensis0.500000
orange0.500000
mediterranean fruit fly0.500000
ceratitis capitata0.500000
prickly pear0.500000
opuntia ficus indica0.500000
bumble bee0.500000
queen0.500000
no hibernation0.500000
galapagos islands0.500000
finch0.500000
green warbler-finch0.500000
certhidea olivacea0.500000
contaminant0.500000
beach0.500000
aerosol0.500000
santa cruz province0.500000
ficus carica0.500000
fig0.500000
swan goose0.500000
psiguria triphylla0.500000
centris atripes0.500000
urban biome0.500000
train0.500000
boston0.500000
size < 10um0.500000
clear day0.500000
fish sauce0.500000
annona cherimola0.500000
pocillopora damicornis0.500000
mucus0.500000
red pepper sauce0.500000
skin0.500000
Fraction of annotations for the query sequences containing the term
TermScore
united states of america0.297491
feces0.164875
homo sapiens0.154122
skin0.103943
leaf0.096774
citrus0.096774
rhizosphere0.086022
whole body0.078853
soil0.075269
china0.068100
beetle0.064516
food product0.057348
plant0.053763
florida0.053763
cultivated habitat0.053763
state of california0.050179
orchard0.046595
digestive system0.046595
belgium0.043011
poland0.039427
air0.039427
adult0.039427
vitis vinifera0.035842
larval stage0.035842
italy0.032258
herbivorous beetle0.032258
nida basin0.032258
costa rica0.032258
monkey0.032258
mucus0.032258
merlot0.028674
grapevine0.028674
new york0.028674
research facility0.028674
solanum lycopersicum0.025090
urban biome0.025090
commonwealth of virginia0.025090
child0.025090
ivy0.025090
hedera ibernica0.025090
pair of nares0.025090
water0.025090
austria0.021505
state of rhode island0.021505
israel0.021505
body proper0.021505
mediterranean fruit fly0.021505
ceratitis capitata0.021505
new york city0.021505
pacific ocean0.021505
city0.021505
ocean0.021505
arm0.021505
hunter gatherer0.021505
building0.021505
woodland0.021505
australia0.021505
root0.021505
greenhouse0.017921
ethiopia0.017921
capsicum annuum0.017921
dust0.017921
fermented food product0.017921
venezuela0.017921
amerindian0.017921
tomato0.017921
rural community0.017921
french republic0.017921
balkan mountains0.017921
bulgaria0.017921
detritivorous beetle0.017921
grape0.014337
peru0.014337
ant0.014337
flower0.014337
nectar0.014337
bird0.014337
mongolia0.014337
summer0.014337
size < 10um0.014337
junco hyemalis0.014337
songbird0.014337
forearm0.014337
chuquisaca department0.014337
bolivia0.014337
age 5-13 years0.014337
wild0.014337
canis lupus familiaris0.014337
foot0.014337
stomach0.014337
fresh water0.014337
southern united states0.014337
snake0.014337
state of florida0.014337
river0.014337
red pepper0.010753
vero beach, fl0.010753
fruit0.010753
immokalee, fl0.010753
gainesville, fl0.010753
Exp. ID User ID Description Date Region Flag Sequences
311amnonred pepper chloroplast (other red pepper, chloroplast)2018-04-09v4No1 / 1
343amnonapple chloroplast (other chloroplast, malus x domestica, apple)2018-05-28v4No1 / 1
361amnonhighfreq leaf, austria, greenhouse, plant, malvaviscus penduliflorus2018-08-21v4No1 / 1
98amnonhighfreq citrus, florida, leaf, vero beach, fl2017-04-01v4No1 / 2
101amnonhighfreq merlot, vitis vinifera, grapevine, new york, united states of america, leaf2017-04-03v4No1 / 2
101amnonhighfreq vitis vinifera, united states of america, merlot, grapevine, new york, grape, fruit2017-04-03v4No1 / 2
98amnonhighfreq citrus, florida, leaf, immokalee, fl2017-04-01v4No1 / 3
98amnonhighfreq citrus, florida, leaf, gainesville, fl2017-04-01v4No1 / 3
74amnonhighfreq food product, united states of america, cauliflower2017-02-27v4No1 / 4
74amnonhighfreq food product, solanum lycopersicum, united states of america2017-02-27v4No1 / 4
98amnonhighfreq citrus, florida, leaf, ft. pierce, fl2017-04-01v4No1 / 4
98amnonhighfreq citrus, florida, leaf, quincy, fl2017-04-01v4No1 / 4
311amnonhighfreq food product, united states of america, state of rhode island, red pepper2018-04-09v4No1 / 4
415amnonhighfreq rhizosphere, soil, citrus, orchard, cultivated habitat, italy2018-11-27v4No1 / 4
515amnonhighfreq argoptochus quadrisignatus, herbivorous beetle, nida basin, plant, beetle, whole body, poland2019-04-18v4No1 / 4
74amnonhighfreq food product, united states of america, squash2017-02-27v4No1 / 5
74amnoncommon food product, usa, cauliflower2017-02-27v4No1 / 5
184amnoncommon peru, digestive system, ants, neoponera2017-08-15v4No1 / 5
189amnonhighfreq united states of america, state of california, grape, vitis vinifera, stem, endosphere2017-08-30v4No1 / 5
515amnonhighfreq eusomus ovulum, herbivorous beetle, nida basin, plant, beetle, whole body, poland2019-04-18v4No1 / 5
415amnonhighfreq rhizosphere, soil, citrus, orchard, cultivated habitat, reunion island2018-11-27v4No1 / 6
415amnonhighfreq rhizosphere, soil, citrus, orchard, cultivated habitat, united states of america2018-11-27v4No1 / 6
515amnonhighfreq polydrusus inustus, herbivorous beetle, nida basin, plant, beetle, whole body, poland2019-04-18v4No1 / 6
184amnoncommon peru, digestive system, azteca, ants2017-08-15v4No1 / 7
397amnoncommon panama, digestive system, intestine, fungus growing ant, atta colombica2018-11-14v4No1 / 7
408amnonhighfreq ant, costa rica, united states of america, pseudomyrmex cubaensis, larval stage2018-11-22v4No1 / 7
415amnonhighfreq rhizosphere, soil, citrus, orchard, cultivated habitat, china2018-11-27v4No1 / 7
56amnonhighfreq nicotiana glauca, israel, flower, nectar2017-01-30v4No1 / 8
74amnonhighfreq food product, spice product, spice, united states of america2017-02-27v4No1 / 8
274amnonhighfreq monkey, chlorocebus djamdjamensis, bale monkey, ethiopia, feces2018-01-16v4No1 / 8
346amnonhigh freq. in fruitfly larva grown on orange (highfreq larval stage, body proper, citrus sinensis, italy, whole body, orange, mediterranean fruit fly, ceratitis capitata)2018-06-11v4No1 / 8
346amnonhigh freq. in fruitfly larva grown on prickly pear (highfreq larval stage, body proper, italy, whole body, prickly pear, opuntia ficus indica, mediterranean fruit fly, ceratitis capitata)2018-06-11v4No1 / 8
415amnonhighfreq rhizosphere, soil, citrus, orchard, cultivated habitat, brazil2018-11-27v4No1 / 8
431amnoncommon in midgut of non-hibernating bumble bees (common bombus terrestris, bumble bee, midgut, research facility, queen, no hibernation, belgium)2018-12-16v4No1 / 8
440amnonhighfreq galapagos islands, feces, bird, finch, green warbler-finch, certhidea olivacea2019-01-06v4No1 / 8
101amnoncommon merlot, vitis vinifera, grapevine, new york, united states of america, leaf2017-04-03v4No1 / 9
58amnonhighfreq homo sapiens, new york city, conjunctiva2017-02-02v4No1 / 10
74amnonhighfreq food product, capsicum annuum, united states of america2017-02-27v4No1 / 10
74amnoncommon food product, solanum lycopersicum, united states of america2017-02-27v4No1 / 10
152amnonhigh in blanks compares to dust/nose samples (contamination)2017-05-04v4No1 / 10
304amnonhighfreq united states of america, state of california, beach, pacific ocean, air, aerosol, santa cruz province2018-03-12v4No1 / 10
346amnoncommon in fruitfly larva grown on orange (common larval stage, body proper, citrus sinensis, italy, whole body, orange, ceratitis capitata, mediterranean fruit fly)2018-06-11v4No1 / 10
346amnonhigh freq. in fruitfly larva grown on figs (highfreq larval stage, body proper, italy, whole body, ficus carica, fig, ceratitis capitata, mediterranean fruit fly)2018-06-11v4No1 / 10
417amnonhighfreq anser cygnoides, swan goose, bird, feces, mongolia, summer2018-12-01v4No1 / 10
501amnonhighfreq costa rica, psiguria triphylla, flower, nectar2019-03-08v4No1 / 10
57amnonhighfreq apis mellifera, digestive system, forager, state of california2017-01-31v4No1 / 11
59amnonhighfreq centris atripes, digestive system2017-02-03v4No1 / 11
195amnonhigh freq. in boston subway surfaces (highfreq city, urban biome, train, boston)2017-09-07v4No1 / 11
206amnonhigh freq. in air from israel particles <10um size (highfreq air, dust, israel, size < 10um, clear day)2017-10-04v4No1 / 11
311amnonhighfreq food product, united states of america, state of rhode island, fish sauce2018-04-09v4No1 / 11
346amnoncommon in fruitfly larva grown on annona (common larval stage, body proper, italy, whole body, annona cherimola, ceratitis capitata, mediterranean fruit fly)2018-06-11v4No1 / 11
418amnonhighfreq coral, ocean, pocillopora damicornis, mucus2018-12-02v4No1 / 11
547amnonhighfreq sichuan province, china, capsicum annuum, red pepper sauce, fermented food product2019-08-15v4No1 / 11
75amnonhighfreq homo sapiens, skin, arm, venezuela, amerindian, hunter gatherer2017-02-27v4No1 / 12
89amnonhighfreq junco hyemalis, commonwealth of virginia, songbird, cloaca2017-03-08v4No1 / 12
146amnonhighfreq united states of america, solanum lycopersicum, tomato, blossom, flower structure2017-04-20v4No1 / 12
206amnonhigh freq. in dust storm air from israel particles <10um size (highfreq israel, air, size < 10um, dust, dust storm)2017-10-04v4No1 / 12
279amnonhighfreq china, grassland, leaf, stem, steppe, mongolia2018-01-24v4No1 / 12
515amnonhighfreq crioceris duodecimpunctata, herbivorous beetle, nida basin, plant, beetle, whole body, poland2019-04-18v4No1 / 12
63amnonhigh freq. in skin in american gut (highfreq skin, homo sapiens)2017-02-15v4No1 / 13
97amnoncommon calophya, adult, florida, brazil2017-04-01v4No1 / 13
199amnonhigh freq. on shower wall tile (highfreq bathroom, shower, building, tile, wall, urban biome, united states of america)2017-10-01v4No1 / 13
243amnonhighfreq beetle, anoplophora glabripennis, digestive system, united states of america2017-11-15v4No1 / 13
515amnoncommon polydrusus inustus, herbivorous beetle, nida basin, plant, beetle, whole body, poland2019-04-18v4No1 / 13
517amnonhighfreq forearm, arm, skin, chuquisaca department, rural community, bolivia, age 5-13 years, child, homo sapiens2019-05-29v4No1 / 13
58amnonhighfreq homo sapiens, new york city, skin of face, skin under eyes2017-02-02v4No1 / 14
89amnonhighfreq junco hyemalis, uropygial gland, commonwealth of virginia, songbird2017-03-08v4No1 / 14
304amnoncandidate contaminants - higher in blanks (contamination)2018-03-12v4No1 / 14
371amnonhighfreq homo sapiens, skin, amerindian, hunter gatherer, venezuela2018-09-06v4No1 / 14
58amnonhighfreq homo sapiens, new york city, contact lens2017-02-02v4No1 / 15
397amnonhighfreq panama, digestive system, intestine, fungus growing ant, atta sexdens2018-11-14v4No1 / 16
108amnonincreases during fasting in nile tilapia caecum ( high in fasting late timepoints compared to early timepoints in research facility texas united states of america caecum oreochromis niloticus nile tilapia )2017-04-07v4No1 / 17
199amnonhigh freq. in kitchen sink (highfreq building, urban biome, united states of america, kitchen, sink)2017-10-01v4No1 / 17
311amnoncommon united states of america, state of rhode island, fermented food product, kimchi2018-04-09v4No1 / 17
128amnonhighfreq belgium, ivy, hedera ibernica, leaf, city, dense settlement biome2017-04-14v4No1 / 18
408amnonhighfreq ant, costa rica, united states of america, larval stage, pseudomyrmex simplex2018-11-22v4No1 / 18
515amnoncommon eusomus ovulum, herbivorous beetle, nida basin, plant, beetle, whole body, poland2019-04-18v4No1 / 18
101amnoncommon united states of america, fruit, vitis vinifera, merlot, grapevine, new york, grape2017-04-03v4No1 / 19
59amnoncommon centris atripes, digestive system2017-02-03v4No1 / 20
184amnoncommon peru, digestive system, ants, odontomachus2017-08-15v4No1 / 20
277amnoncommon homo sapiens, belgium, adult, nasopharynx2018-01-23v4No1 / 20
58amnoncommon homo sapiens, new york city, skin of face, skin under eyes2017-02-02v4No1 / 21
350amnonhigh freq. in feces of white faced capuchin from costa rica rain forest (highfreq monkey, cebus capucinus, feces, costa rica, white-faced capuchin, woodland)2018-07-30v4No1 / 21
501amnoncommon costa rica, psiguria triphylla, flower, nectar2019-03-08v4No1 / 21
515amnoncommon argoptochus quadrisignatus, herbivorous beetle, nida basin, plant, beetle, whole body, poland2019-04-18v4No1 / 22
58amnoncommon homo sapiens, new york city, contact lens2017-02-02v4No1 / 23
74amnoncommon food product, capsicum annuum, united states of america2017-02-27v4No1 / 23
74amnoncommon food product, prosciutto, united states of america2017-02-27v4No1 / 23
128amnonhighfreq belgium, ivy, hedera ibernica, leaf, moor, scrubland2017-04-14v4No1 / 23
346amnoncommon in fruitfly larva grown on prickly pear (common larval stage, body proper, italy, whole body, prickly pear, opuntia ficus indica, ceratitis capitata, mediterranean fruit fly)2018-06-11v4No1 / 23
418amnonhighfreq coral, ocean, acropora hyacinthus, mucus2018-12-02v4No1 / 23
489amnoncommon feces, anal swab, myotis myotis, bat, greater mouse eared bat, french republic2019-02-25v4No1 / 24
59amnon high in austin united states of america compared to australia china malaysia seoul in apis mellifera digestive system 2017-02-02v4No1 / 25
181amnoncommon bombus terrestris, bumblebee, belgium, research facility, digestive system2017-08-15v4No1 / 25
146amnoncommon united states of america, solanum lycopersicum, tomato, blossom, flower structure2017-04-20v4No1 / 26
158amnonhigher in skin sites compared to mouth in cats ( high in skin compared to mouth saliva in felis catus cat united states of america )2017-07-06v4No1 / 26
74amnoncommon food product, squash, united states of america2017-02-27v4No1 / 27
58amnoncommon homo sapiens, new york city, conjunctiva2017-02-02v4No1 / 28
246amnon high in obesity high bmi body mass index compared to control in homo sapiens saliva italy 2017-11-21v4No1 / 30
490amnonobserved in amniotic fluid and buffer and water controls (contamination)2019-02-25v4No1 / 32
57amnoncommon apis mellifera, digestive system, state of california, forager2017-01-31v4No1 / 33
407amnoncommon costa rica, feces, monkey, cebus capucinus, white-faced capuchin, wild2018-11-21v4No1 / 34
146amnoncommon united states of america, fruit, solanum lycopersicum, tomato2017-04-20v4No1 / 35
350amnoncommon in feces of white faced capuchin from costa rica rain forest (common monkey, cebus capucinus, feces, costa rica, white-faced capuchin, woodland)2018-07-30v4No1 / 35
180amnoncommon dermanyssus gallinae, red poulty mite, czech republic, poulty farm, adult2017-08-14v4No1 / 36
231amnonhigher in urine compared to genitalia in dogs ( high in urine compared to reproductive organ reproductive system genitalia in dog canis lupus familiaris united states of america )2017-11-02v4No1 / 36
232amnoncommon in foot of diabetic patients (common homo sapiens, skin, australia, foot, diabetes mellitus)2017-11-05v4No1 / 37
277amnoncommon homo sapiens, belgium, adult, nasal cavity, pair of nares2018-01-23v4No1 / 37
243amnoncommon beetle, anoplophora glabripennis, digestive system, united states of america2017-11-15v4No1 / 38
541amnonhigher in koalas eating Eucalyptus obliqua leaves comapred to Eucalyptus viminalis ( high in eucalyptus obliqua eucalyptus obliqua diet compared to eucalyptus viminalis diet eucalyptus viminalis in cape otway wild australia feces koala phascolarctos cinereus )2019-08-01v4No1 / 38
74amnoncommon food product, spice product, spices, united states of america2017-02-27v4No1 / 39
28amnoncommon in various trees in hawaii (common hawaii, organic material, forest, forest biome, whole plant, leaf)2016-12-05v4No1 / 41
89amnoncommon junco hyemalis, uropygial gland, commonwealth of virginia, songbird2017-03-08v4No1 / 43
189amnoncommon united states of america, state of california, grape, vitis vinifera, stem, endosphere2017-08-30v4No1 / 43
547amnon high in high salt concentration compared to low salt concentration in sichuan province china capsicum annuum red pepper sauce fermented food product 2019-08-15v4No1 / 43
69amnoncommon canis lupus familiaris, beagle dog, united states of america, research facility, bronchoalveolar lavage2017-02-21v4No1 / 44
408amnon high in larval stage compared to stomach in ant costa rica united states of america pseudomyrmex flavicornis 2018-11-22v4No1 / 47
89amnoncommon junco hyemalis, commonwealth of virginia, songbird, cloaca2017-03-08v4No1 / 48
547amnoncommon sichuan province, china, capsicum annuum, red pepper sauce, fermented food product2019-08-15v4No1 / 49
515amnoncommon herbivorous beetle, nida basin, plant, aphthona venustula, beetle, whole body, poland2019-04-18v4No1 / 54
354amnon high in bronchus bronchial epithelium bronchial brush compared to sputum induced sputum in homo sapiens united states of america adult 2018-07-30v4No1 / 55
63amnoncommon in skin in american gut (common homo sapiens, skin)2017-02-15v4No1 / 56
423amnon high in male compared to female in bank vole myodes glareolus ukraine skin 2018-12-05v4No1 / 56
56amnoncommon nicotiana galuca, flower, nectar, israel2017-01-30v4No1 / 57
308amnoncommon in neonatal intensive care unit floor (common united states of america, state of california, hospital, floor, dust)2018-03-31v4No1 / 57
431amnoncommon in midgut of hibernating bumble bees (common research facility, midgut, belgium, bombus terrestris, bumble bee, queen, hibernation)2018-12-16v4No1 / 57
523amnoncommon state of illinois, chicago, united states of america, bedroom, building, air2019-07-03v4No1 / 58
228amnonlower in chronic sinositis compared to healthy controls in sinus brushing ( high in control compared to sinusitis in homo sapiens mucosa sinusoidal space paranasal sinus united states of america )2017-10-31v4No1 / 60
199amnonlower in bathroom shower compared to kitchen sink ( high in kitchen sink compared to bathroom shower tile wall in building urban biome united states of america )2017-10-01v4No1 / 61
311amnonlower in fermneted kimchi days>1 compared to day 0 ( high in day 0 early timepoints compared to days 1-9 in united states of america state of rhode island fermented food product kimchi )2018-04-09v4No1 / 62
311amnoncommon food product, united states of america, state of rhode island, red pepper2018-04-09v4No1 / 63
17amnon high in high altitude compared to low altitude in ochotona feces stomach tibetan plateau 2016-11-09v4No1 / 65
341amnoncommon water, drinking water, united states of america, tap water, state of illinois, fresh water2018-05-28v4No1 / 66
311amnoncommon food product, united states of america, state of rhode island, fish sauce2018-04-09v4No1 / 68
417amnoncommon anser cygnoides, swan goose, bird, feces, mongolia, summer2018-12-01v4No1 / 68
231amnoncommon in dog urine (common dog, canis lupus familiaris, united states of america, urine)2017-11-02v4No1 / 69
28amnoncommon hawaii, feces, organism-associated habitat, terrestrial biome, achatinella mustelina2016-12-05v4No1 / 71
26amnoncommon united states of america, homo sapiens, pair of nares, mucus2016-12-05v4No1 / 73
99amnoncommon commonwealth of virginia, united states of america, skin, mucus, notophthalmus viridescens, newt2017-04-02v4No1 / 74
26amnoncommon united states of america, felis catus, mucus, pair of nares2016-12-05v4No1 / 80
26amnon high in pair of nares mucus compared to mouth saliva in united states of america felis catus 2016-12-05v4No1 / 86
199amnoncommon on shower wall tile (common bathroom, shower, building, tile, wall, urban biome, united states of america)2017-10-01v4No1 / 90
26amnon high in pair of nares mucus compared to inguinal region axilla sebum in united states of america homo sapiens 2016-12-05v4No1 / 92
354amnon high in bronchus bronchial brush bronchial epithelium compared to saliva oral wash in homo sapiens united states of america adult 2018-07-30v4No1 / 94
238amnoncommon homo sapiens, feces, colombia2017-11-07v4No1 / 96
361amnoncommon leaf, austria, greenhouse, plant, dracaena fragrans2018-08-21v4No1 / 100
536amnoncommon timber rattlesnake, southern united states, united states of america, skin, snake, crotalus horridus2019-07-28v4No1 / 101
361amnoncommon leaf, austria, greenhouse, plant, malvaviscus penduliflorus2018-08-21v4No1 / 102
515amnoncommon onthophagus similis, balkan mountains, bulgaria, feces, detritivorous beetle, beetle, whole body2019-04-18v4No1 / 104
323amnonhigher in sharks compared to sea water ( high in shark compared to water ocean water surface water depth 0m in atlantic ocean south florida state of florida united states of america )2018-04-24v4No1 / 107
269amnoncommon in fresh yao meat food (common china, food product, meat food product)2018-01-09v4No1 / 113
128amnonhigher in ivy leaves from moor compared to forest ( high in scrubland moor compared to forest in belgium ivy hedera ibernica leaf )2017-04-14v4No1 / 114
417amnon high in mongolia summer compared to china winter in anser cygnoides swan goose bird feces 2018-12-01v4No1 / 114
98amnoncommon citrus, florida, leaf, vero beach, fl2017-04-01v4No1 / 115
492amnoncommon skin, adult, germany, bufo bufo, toad, common toad2019-02-27v4No1 / 115
195amnoncommon in boston subway surfaces (common city, urban biome, train, boston)2017-09-07v4No1 / 116
515amnoncommon balkan mountains, bulgaria, feces, detritivorous beetle, aphodius depressus, beetle, whole body2019-04-18v4No1 / 121
517amnoncommon forearm, arm, skin, chuquisaca department, rural community, bolivia, age 5-13 years, child, homo sapiens2019-05-29v4No1 / 121
98amnoncommon citrus, florida, leaf, ft. pierce, fl2017-04-01v4No1 / 126
199amnoncommon in kitchen sink (common building, urban biome, united states of america, kitchen, sink)2017-10-01v4No1 / 130
515amnoncommon bembidion modestum, beetle, whole body, raba river, poland, river, carnivorous beetle2019-04-18v4No1 / 131
291amnoncommon canis lupus familiaris, dog, pair of nares, nasal cavity, germany2018-02-01v4No1 / 144
132amnoncommon homo sapiens, feces, united states of america2017-04-16v4No1 / 145
475amnoncommon in air next to subway stations in hong kong (common air, hong kong, city)2019-01-20v4No1 / 147
515amnoncommon aphodius haemorrhoidalis, balkan mountains, bulgaria, feces, detritivorous beetle, beetle, whole body2019-04-18v4No1 / 147
361amnoncommon leaf, austria, greenhouse, plant, howea forsteriana2018-08-21v4No1 / 154
361amnoncommon leaf, austria, greenhouse, plant, dracaena draco2018-08-21v4No1 / 155
108amnon high in colon compared to caecum in research facility texas united states of america coturnix coturnix common quail 2017-04-07v4No1 / 157
515amnoncommon crioceris duodecimpunctata, herbivorous beetle, nida basin, plant, beetle, whole body, poland2019-04-18v4No1 / 157
98amnoncommon citrus, florida, leaf, immokalee, fl2017-04-01v4No1 / 160
209amnoncommon in whale blow condensate (common north america, megaptera novaeangliae, humpback whale, respiratory airway, exhaled air condensate, whale blow)2017-10-15v4No1 / 161
408amnon high in larval stage compared to stomach in ant costa rica united states of america pseudomyrmex spinicola 2018-11-22v4No1 / 165
232amnoncoomon in foot of healthy controls (common homo sapiens, skin, australia, foot)2017-11-05v4No1 / 166
197amnoncommon feces, homo sapiens, obsolete_juvenile stage, age 13, juvenile organism, india2017-09-12v4No1 / 170
241amnonlower in babies age <1 year compared to age 1-3 years ( high in age age 1-3 years compared to age < 1 year in homo sapiens feces infant )2017-11-13v4No1 / 173
163amnoncommon china, stomach, ochotonidae, pika, ochotona curzoniae, mongolia grassland2017-07-13v4No1 / 174
99amnoncommon commonwealth of virginia, united states of america, skin, mucus, anaxyrus americanus, american toad2017-04-02v4No1 / 176
403amnon high in winter compared to summer in air kingdom of spain pyrenees autumn 2018-11-18v4No1 / 176
515amnoncommon onthophagus ruficapillus, balkan mountains, bulgaria, feces, detritivorous beetle, beetle, whole body2019-04-18v4No1 / 178
536amnoncommon arboreal snake, black rat snake, pantherophis obsoletus, southern united states, united states of america, skin, snake2019-07-28v4No1 / 184
98amnoncommon citrus, florida, leaf, quincy, fl2017-04-01v4No1 / 188
197amnon high in india compared to finland in feces homo sapiens obsolete_juvenile stage age 13 juvenile organism 2017-09-12v4No1 / 189
75amnoncommon homo sapiens, skin, arm, venezuela, amerindian, hunter gatherer2017-02-27v4No1 / 191
534amnoncommon filtered 2.7um, particle bound, nepal, tributary, koshi river, depth 10 cm, fresh water, water, river2019-07-22v4No1 / 193
88amnondifferent between herds in cape buffalo feces ( high in herd lower sabie herd compared to croc bridge herd in syncerus caffer caffer cape buffalo feces south africa )2017-03-08v4No1 / 194
371amnoncommon homo sapiens, skin, amerindian, hunter gatherer, venezuela2018-09-06v4No1 / 195
312amnoncommon feces, homo sapiens, french republic, adult, spondylitis, spondyloarthritis2018-04-09v4No1 / 197
80amnoncommon feces, alouatta pigra, howler monkey, woodland, tropical broadleaf forest biome, central america2017-03-03v4No1 / 198
6amnoncommon urine, female, homo sapiens, pregnancy, state of tennessee2016-10-13v4No1 / 201
323amnoncommon in shark skin (common atlantic ocean, south florida, state of florida, united states of america, shark, skin)2018-04-24v4No1 / 213
17amnoncommon ochotona, feces, stomach, tibetan plateau2016-11-09v4No1 / 214
98amnoncommon citrus, florida, leaf, gainesville, fl2017-04-01v4No1 / 215
201amnonhigher in cactus fly compared to decaying cactus ( high in drosophila fly drosophila nigrospiracula compared to cactus decaying in mexico desert )2017-10-01v4No1 / 215
130amnon high in sphagnum compared to vaccinium in peatland leaf plant austria alpine bog plant surface sphagnum bog 2017-04-15v4No1 / 222
505amnon high in early time points compared to late time points in water ocean water pacific ocean state of california surface water particle bound size 1-80um 2019-03-16v4No1 / 223
78amnoncommon nanger granti, kenya, feces, tropical grassland biome, gazelle2017-03-01v4No1 / 236
492amnoncommon skin, adult, japan, rana catesbeiana, bullfrog, lithobates catesbeianus, frog2019-02-27v4No1 / 236
536amnoncommon copperhead snake, agkistrodon contortrix, southern united states, united states of america, skin, snake2019-07-28v4No1 / 236
406amnoncommon feces, zoological garden, french republic, gorilla gorilla, monkey, gorilla2018-11-21v4No1 / 239
161amnoncommon in barn swallows in colorado (common hirundo rustica, feces, united states of america, colorado, barn swallow)2017-07-12v4No1 / 245
425amnon high in antananarivo madagascar compared to bangui central african republic in homo sapiens feces africa child 2018-12-08v4No1 / 248
351amnoncommon sea urchin, lytechinus variegatus, coelomic fluid, research facility, eagle harbor, state of florida, united states of america2018-07-30v4No1 / 249
45amnonlower in young babies compared to 2 year olds in india ( high in age age 1-2 compared to age 0-1 in homo sapiens feces india infant )2016-12-19v4No1 / 253
304amnoncommon united states of america, state of california, beach, pacific ocean, air, aerosol, monterey bay2018-03-12v4No1 / 263
253amnoncommon in clouds in puy de dome mountain in france (common cloud, french republic, air, fall)2017-11-22v4No1 / 267
438amnon high in age 3-6 age 8-12 child compared to adult age 30-50 age 60-79 in homo sapiens feces china 2018-12-30v4No1 / 279
128amnonhigher in ivy leaves from city compared to moor and forest ( high in city dense settlement biome compared to forest moor in belgium ivy hedera ibernica leaf )2017-04-14v4No1 / 287
423amnoncommon bank vole, myodes glareolus, ukraine, skin2018-12-05v4No1 / 291
331amnoncommon feces, monkey, theropithecus gelada, ethiopia2018-05-13v4No1 / 298
515amnoncommon bembidion punctulatum, beetle, whole body, raba river, poland, river, carnivorous beetle2019-04-18v4No1 / 305
80amnoncommon feces, woodland, central america, alouatta palliata, mantled howler monkey2017-03-03v4No1 / 309
80amnon high in dry forest compared to tropical moist broadleaf forest biome in feces woodland central america alouatta palliata mantled howler monkey 2017-03-03v4No1 / 314
163amnon high in ochotona curzoniae tibet plateau compared to ochotona dauurica mongolia grassland in china ochotonidae pika stomach 2017-07-13v4No1 / 331
351amnoncommon in artificial sea water where sea urchins were grown (common sea urchin, lytechinus variegatus, research facility, state of florida, united states of america, artificial seawater, sea water)2018-07-30v4No1 / 338
190amnon high in wet season compared to dry season in homo sapiens tanzania hadza hunter gatherer feces 2017-09-04v4No1 / 341
537amnonlower in feces of deer mice grown in captivity compared to wild caught ( high in wild compared to research facility captive in algonquin provincial park province of ontario age 3-5 weeks deer mice peromyscus maniculatus canada feces )2019-07-28v3No1 / 358
209amnonhigher in whale blow condensate compared to ocean water ( high in whale blow exhaled air condensate respiratory airway megaptera novaeangliae humpback whale compared to sea water ocean depth 25cm in north america )2017-10-15v4No1 / 359
341amnonhigher in fresh drinking water compared to week old water ( high in fresh water compared to stagnant water in water drinking water united states of america tap water state of illinois )2018-05-28v4No1 / 365
256amnoncommon sus scrofa, pig, united kingdom, duodenum, jejunum, ileum2017-11-26v4No1 / 380
256amnonhigher in small intestine compared to colon in pigs ( high in duodenum jejunum ileum compared to caecum right colon left colon in sus scrofa pig united kingdom )2017-11-26v4No1 / 387
425amnon high in feces compared to duodenum in homo sapiens africa child 2018-12-08v4No1 / 416
515amnoncommon aphodius pusillus, balkan mountains, bulgaria, feces, detritivorous beetle, beetle, whole body2019-04-18v4No1 / 421
99amnoncommon commonwealth of virginia, united states of america, skin, mucus, pseudacris crucifer, peeper2017-04-02v4No1 / 438
274amnoncommon monkey, ethiopia, feces, chlorocebus aethiops, grivet monkey2018-01-16v4No1 / 440
128amnoncommon belgium, ivy, hedera ibernica, leaf, city, dense settlement biome2017-04-14v4No1 / 461
276amnon high in peru small village tunapuco rural community compared to united states of america city state of oklahoma in feces homo sapiens adult 2018-01-22v4No1 / 469
274amnoncommon monkey, chlorocebus djamdjamensis, bale monkey, ethiopia, feces2018-01-16v4No1 / 489
415amnoncommon rhizosphere, soil, citrus, orchard, cultivated habitat, united states of america2018-11-27v4No1 / 494
304amnoncommon united states of america, state of california, beach, pacific ocean, air, aerosol, santa cruz province2018-03-12v4No1 / 518
27amnoncommon bos grunniens, rumen, china2016-12-05v4No1 / 532
98amnoncommon citrus, rhizosphere, florida, root, immokalee, fl2017-04-01v4No1 / 543
98amnoncommon citrus, rhizosphere, florida, vero beach, fl, root2017-04-01v4No1 / 544
240amnonlower in infants age<1 year compared to 1-3 years in baby feces ( high in age age > 1 year compared to age <1 year in homo sapiens feces infant finland )2017-11-12v4No1 / 567
146amnon high in rhizosphere compared to soil in united states of america solanum lycopersicum tomato slit loam ph 6 2017-04-20v4No1 / 590
536amnon high in terrestrial snake compared to aquatic snake in southern united states united states of america skin snake 2019-07-28v4No1 / 590
415amnoncommon rhizosphere, soil, citrus, orchard, cultivated habitat, south africa2018-11-27v4No1 / 600
223amnon high in yushan islands compared to other regions in sediment marine sediment china ocean east china sea 2017-10-26v4No1 / 619
128amnoncommon belgium, ivy, hedera ibernica, leaf, moor, scrubland2017-04-14v4No1 / 623
200amnoncommon in river downstream of wastewater treatment plant (common river, fresh water, water, united states of america, wastewater treatment plant, effluent)2017-10-01v4No1 / 655
175amnonhigher in summer compared to winter in heavy metal contaminated soils in china ( high in summer compared to winter in china soil heavy metal )2017-07-29v4No1 / 658
128amnoncommon belgium, ivy, hedera ibernica, leaf, forest2017-04-14v4No1 / 693
232amnonlower in diabetec patient foot skin compared to healthy controls ( high in control compared to diabetes mellitus in homo sapiens skin australia foot )2017-11-05v4No1 / 708
415amnoncommon rhizosphere, soil, citrus, orchard, cultivated habitat, reunion island2018-11-27v4No1 / 721
415amnoncommon rhizosphere, soil, citrus, australia, orchard, cultivated habitat2018-11-27v4No1 / 743
206amnoncommon in air from israel particles <10um size (common air, dust, israel, size < 10um, clear day)2017-10-04v4No1 / 765
157amnoncommon in naers of weened calves (common nasal cavity, bos taurus, calve, united states of america, juvenile organism, pair of nares)2017-07-04v4No1 / 766
78amnon high in female compared to male in nanger granti kenya feces tropical grassland biome gazelle 2017-03-01v4No1 / 814
331amnon high in wet season compared to dry season in feces monkey theropithecus gelada ethiopia 2018-05-13v4No1 / 818
415amnoncommon rhizosphere, soil, citrus, orchard, cultivated habitat, china2018-11-27v4No1 / 830
444amnoncommon rhizosphere, fragaria x ananassa, strawberry, china, greenhouse soil, farm, cultivated habitat, yellow brown soil, nanjing city prefecture, continuous cropping, age 5 years, age 10 years2019-01-07v4No1 / 833
232amnonlower in diabetec foot ulcers compared to non-ulcer skin in diabetic patients ( high in control compared to wound ulcer in homo sapiens skin australia foot diabetes mellitus )2017-11-05v4No1 / 836
517amnon high in forearm arm skin compared to feces in chuquisaca department rural community bolivia age 5-13 years child homo sapiens 2019-05-29v4No1 / 836
371amnonhigher in skin of amerindians compared to western visitors ( high in venezuela hunter gatherer amerindian compared to city united states of america in homo sapiens skin )2018-09-06v4No1 / 854
146amnoncommon united states of america, solanum lycopersicum, tomato, slit loam soil, ph 6, rhizosphere2017-04-20v4No1 / 894
206amnoncommon in dust storm air from israel particles <10um size (common israel, air, size < 10um, dust, dust storm)2017-10-04v4No1 / 902
98amnoncommon citrus, rhizosphere, florida, root, quincy, fl2017-04-01v4No1 / 950
412amnon high in ph>5 compared to ph<5 in soil china hunan province red soil cambisol zea mays triticum aestivum 2018-11-26v4No1 / 1005
517amnon high in forearm arm skin compared to mouth mucosa mouth in chuquisaca department rural community bolivia age 5-13 years child homo sapiens 2019-05-29v4No1 / 1014
406amnoncommon feces, zoological garden, hippotragus niger, sable antelope, french republic2018-11-21v4No1 / 1075
415amnoncommon rhizosphere, soil, citrus, orchard, cultivated habitat, brazil2018-11-27v4No1 / 1091
415amnoncommon rhizosphere, soil, citrus, orchard, cultivated habitat, kingdom of spain2018-11-27v4No1 / 1099
101amnoncommon root, merlot, vitis vinifera, grapevine, new york, united states of america2017-04-03v4No1 / 1106
236amnoncommon ocean, ocean water, state of california, pacific ocean, bodega bay, water2017-11-07v4No1 / 1156
357amnon high in ph>5 compared to ph<5 in soil topsoil depth 0-10cm forest woodland temperate woodland biome temperate deciduos forest 2018-08-18v4No1 / 1171
505amnon high in particle bound size 1-80um compared to free floating size < 1um in water ocean water pacific ocean state of california surface water 2019-03-14v4No1 / 1218
415amnoncommon rhizosphere, soil, citrus, orchard, cultivated habitat, italy2018-11-27v4No1 / 1279
454amnon high in winter compared to summer in china elaphurus davidianus pere deer deer feces 2019-01-10v4No1 / 1304
98amnoncommon citrus, rhizosphere, florida, root, gainesville, fl2017-04-01v4No1 / 1371
40amnoncommon soil, china, field soil, nicotiana tabacum, rhizosphere2016-12-09v4No1 / 1420
444amnoncommon rhizosphere, fragaria x ananassa, strawberry, china, greenhouse soil, farm, cultivated habitat, yellow brown soil, nanjing city prefecture, age 1 year2019-01-07v4No1 / 1439
353amnonlower in captive compared to wild caught Lissotriton vulgaris newts skin ( high in wild compared to research facility in newt adult united kingdom skin cambridgeshire triturus cristatus )2018-07-30v4No1 / 1834
236amnoncommon state of california, bodega bay, ocean, zostera marina, marine eelgrass, sediment, marine sediment2017-11-07v4No1 / 1904
101amnoncommon vitis vinifera, united states of america, merlot, grapevine, new york, rhizosphere2017-04-03v4No1 / 1980
101amnon high in root compared to rhizosphere in vitis vinifera united states of america merlot grapevine new york 2017-04-03v4No1 / 2075
175amnoncommon in heavy metal contaminated soils in china (common china, soil, heavy metal, ph 7-9)2017-07-29v4No1 / 2133
101amnoncommon vitis vinifera, united states of america, merlot, grapevine, new york, soil2017-04-03v4No1 / 2537
265amnon high in soil compared to soilwater water in canada province of quebec 2017-12-11v4No1 / 2715
236amnon high in sediment marine sediment compared to root in state of california bodega bay ocean zostera marina marine eelgrass 2017-11-07v4No1 / 2745
171amnonlower in roots compared to rhizosphere soil in rice ( high in rhizosphere soil compared to root in united states of america state of california oryza sativa rice )2017-07-25v4No1 / 7628

Problems / suggestions? Please email info AT dbbact DOT org