Search result for sequence:
TACAGAGGATGCAAGCGTTATCCGGAATGATTGGGCGTAAAGCGTCTGTAGGTGGCTTTTTAAGTCCGCCGTCAAATCCCAGGGCTCAACCCTGGACAGGCGGTGGAAACTACCAAGCTGGAGTACGGTAGGGGCAGAGGGAATTTCCGG
common ontology terms
term enrichment score
TermScore
united states of america0.215619
skin0.165147
rhizosphere0.156890
feces0.156007
citrus0.143426
homo sapiens0.142857
leaf0.130705
canada0.119403
state of florida0.112532
soil0.110061
whole body0.109453
china0.102312
beetle0.099174
foodon product type0.088235
cannabis sativa0.086957
belgium0.084034
wild0.080552
plant0.079787
cultivated environment0.075758
state of california0.074866
poland0.074499
root0.072993
solanum lycopersicum0.072693
orchard0.071823
digestive system0.065546
costa rica0.062607
adult0.061920
israel0.061856
air0.061769
farm0.061224
vitis vinifera0.056980
monkey0.051370
nida basin0.050847
herbivorous beetle0.050847
mucus0.050847
pair of nares0.050590
larval stage0.049875
italy0.048780
root endosphere0.048387
merlot0.045455
grapevine0.045455
new york0.044444
child0.041885
urban biome0.040000
ivy0.040000
hedera ibernica0.040000
nouabale-ndoki national park0.040000
republic of congo0.040000
water0.039735
commonwealth of virginia0.039604
zoological garden0.038961
research facility0.038760
summer0.038095
australia0.038095
hunter gatherer0.034884
arm0.034783
building0.034783
state of rhode island0.034483
mediterranean fruit fly0.034483
ceratitis capitata0.034483
bird0.034091
austria0.033898
new york city0.033333
ocean0.032609
pacific ocean0.032432
city0.032258
body proper0.031250
capsicum annuum0.029112
dust0.029112
venezuela0.029112
amerindian0.029112
french republic0.029007
ethiopia0.028902
early flowering stage0.028902
tomato0.028902
potting mix0.028902
detritivorous beetle0.028902
bulgaria0.028902
balkan mountains0.028902
greenhouse0.028490
depth 0-20cm0.028289
food (fermented)0.028090
captive0.028090
rural community0.027894
stomach0.027829
fresh water0.027797
grape0.023392
peru0.023392
nectar0.023392
mongolia0.023392
alouatta palliata0.023392
mantled howler monkey0.023392
ant0.023256
pre-vegetative stage0.023256
size < 10um0.023256
junco hyemalis0.023256
songbird0.023256
late flowering stage0.023256
chuquisaca department0.023256
forearm0.023256
Fraction of dbbact annotations with this term covered by the query
TermScore
canada1.333333
poland1.000000
LOWER IN sinusitis1.000000
hunter gatherer0.750000
costa rica0.714286
belgium0.714286
citrus0.666667
vitis vinifera0.666667
grape0.666667
beetle0.666667
peru0.666667
nectar0.666667
bombus terrestris0.666667
capsicum annuum0.666667
mongolia0.666667
apis mellifera0.666667
dust0.666667
arm0.666667
venezuela0.666667
amerindian0.666667
building0.666667
alouatta palliata0.666667
mantled howler monkey0.666667
cebus capucinus0.666667
white-faced capuchin0.666667
age 1-3 years0.666667
state of illinois0.666667
newt0.666667
particle bound0.666667
ph>50.666667
monkey0.625000
foodon product type0.600000
solanum lycopersicum0.600000
french republic0.571429
air0.545455
skin0.518519
red pepper0.500000
malus x domestica0.500000
apple0.500000
malvaviscus penduliflorus0.500000
vero beach, fl0.500000
merlot0.500000
grapevine0.500000
immokalee, fl0.500000
gainesville, fl0.500000
cauliflower0.500000
ft. pierce, fl0.500000
quincy, fl0.500000
state of rhode island0.500000
orchard0.500000
nida basin0.500000
herbivorous beetle0.500000
argoptochus quadrisignatus0.500000
squash0.500000
ants0.500000
neoponera0.500000
eusomus ovulum0.500000
reunion island0.500000
polydrusus inustus0.500000
azteca0.500000
fungus growing ant0.500000
atta colombica0.500000
ant0.500000
pseudomyrmex cubaensis0.500000
nicotiana glauca0.500000
spice0.500000
spice or herb0.500000
chlorocebus djamdjamensis0.500000
bale monkey0.500000
ethiopia0.500000
citrus sinensis0.500000
orange0.500000
mediterranean fruit fly0.500000
ceratitis capitata0.500000
prickly pear0.500000
opuntia ficus indica0.500000
bumble bee0.500000
queen0.500000
no hibernation0.500000
galapagos islands0.500000
finch0.500000
green warbler-finch0.500000
certhidea olivacea0.500000
early flowering stage0.500000
cannabis sativa0.500000
beach0.500000
aerosol0.500000
santa cruz province0.500000
ficus carica0.500000
fig0.500000
swan goose0.500000
psiguria triphylla0.500000
pre-vegetative stage0.500000
centris atripes0.500000
urban biome0.500000
train0.500000
boston0.500000
size < 10um0.500000
clear day0.500000
fish sauce0.500000
Fraction of annotations for the query sequences containing the term
TermScore
united states of america0.270833
feces0.175595
homo sapiens0.142857
rhizosphere0.110119
skin0.098214
leaf0.080357
citrus0.080357
soil0.080357
china0.077381
state of florida0.065476
whole body0.065476
canada0.062500
beetle0.053571
farm0.053571
foodon product type0.047619
cannabis sativa0.047619
plant0.044643
cultivated environment0.044643
belgium0.044643
adult0.044643
root0.044643
wild0.044643
state of california0.041667
solanum lycopersicum0.038690
orchard0.038690
poland0.038690
digestive system0.038690
israel0.035714
costa rica0.032738
air0.032738
vitis vinifera0.029762
larval stage0.029762
research facility0.029762
italy0.026786
nida basin0.026786
herbivorous beetle0.026786
monkey0.026786
mucus0.026786
root endosphere0.026786
pair of nares0.026786
merlot0.023810
grapevine0.023810
new york0.023810
child0.023810
water0.023810
summer0.020833
urban biome0.020833
commonwealth of virginia0.020833
ivy0.020833
hedera ibernica0.020833
nouabale-ndoki national park0.020833
republic of congo0.020833
australia0.020833
zoological garden0.020833
austria0.017857
state of rhode island0.017857
body proper0.017857
mediterranean fruit fly0.017857
ceratitis capitata0.017857
bird0.017857
new york city0.017857
pacific ocean0.017857
city0.017857
ocean0.017857
arm0.017857
hunter gatherer0.017857
building0.017857
control0.017857
greenhouse0.014881
ethiopia0.014881
early flowering stage0.014881
capsicum annuum0.014881
dust0.014881
food (fermented)0.014881
venezuela0.014881
amerindian0.014881
tomato0.014881
rural community0.014881
depth 0-20cm0.014881
potting mix0.014881
french republic0.014881
stomach0.014881
fresh water0.014881
captive0.014881
detritivorous beetle0.014881
bulgaria0.014881
balkan mountains0.014881
grape0.011905
peru0.011905
ant0.011905
flower0.011905
nectar0.011905
mongolia0.011905
pre-vegetative stage0.011905
size < 10um0.011905
junco hyemalis0.011905
songbird0.011905
late flowering stage0.011905
age 5-13 years0.011905
bolivia0.011905
Exp. ID User ID Description Date Region Flag Sequences
311amnonred pepper chloroplast (other red pepper, chloroplast)2018-04-09v4No1 / 1
343amnonapple chloroplast (other chloroplast, malus x domestica, apple)2018-05-28v4No1 / 1
361amnondominant leaf, austria, greenhouse, plant, malvaviscus penduliflorus2018-08-21v4No1 / 1
98amnondominant citrus, leaf, vero beach, fl, state of florida2017-04-01v4No1 / 2
101amnondominant merlot, vitis vinifera, grapevine, new york, united states of america, leaf2017-04-03v4No1 / 2
101amnondominant vitis vinifera, united states of america, merlot, grapevine, new york, grape, botanical fruit food product2017-04-03v4No1 / 2
98amnondominant citrus, leaf, immokalee, fl, state of florida2017-04-01v4No1 / 3
98amnondominant citrus, leaf, gainesville, fl, state of florida2017-04-01v4No1 / 3
74amnondominant united states of america, cauliflower, foodon product type2017-02-27v4No1 / 4
74amnondominant solanum lycopersicum, united states of america, foodon product type2017-02-27v4No1 / 4
98amnondominant citrus, leaf, ft. pierce, fl, state of florida2017-04-01v4No1 / 4
98amnondominant citrus, leaf, quincy, fl, state of florida2017-04-01v4No1 / 4
311amnondominant united states of america, state of rhode island, red pepper, foodon product type2018-04-09v4No1 / 4
415amnondominant rhizosphere, soil, citrus, orchard, italy, cultivated environment2018-11-27v4No1 / 4
515amnondominant poland, whole body, beetle, plant, nida basin, herbivorous beetle, argoptochus quadrisignatus2019-04-18v4No1 / 4
74amnondominant united states of america, squash, foodon product type2017-02-27v4No1 / 5
74amnoncommon usa, cauliflower, foodon product type2017-02-27v4No1 / 5
184amnoncommon peru, digestive system, ants, neoponera2017-08-15v4No1 / 5
189amnondominant united states of america, state of california, grape, vitis vinifera, stem, endosphere2017-08-30v4No1 / 5
515amnondominant poland, whole body, beetle, plant, nida basin, herbivorous beetle, eusomus ovulum2019-04-18v4No1 / 5
415amnondominant rhizosphere, soil, citrus, orchard, reunion island, cultivated environment2018-11-27v4No1 / 6
415amnondominant rhizosphere, soil, citrus, orchard, united states of america, cultivated environment2018-11-27v4No1 / 6
515amnondominant poland, whole body, beetle, plant, nida basin, herbivorous beetle, polydrusus inustus2019-04-18v4No1 / 6
184amnoncommon peru, digestive system, azteca, ants2017-08-15v4No1 / 7
397amnoncommon panama, digestive system, intestine, fungus growing ant, atta colombica2018-11-14v4No1 / 7
408amnondominant ant, costa rica, united states of america, pseudomyrmex cubaensis, larval stage2018-11-22v4No1 / 7
415amnondominant rhizosphere, soil, citrus, orchard, china, cultivated environment2018-11-27v4No1 / 7
56amnondominant nicotiana glauca, israel, flower, nectar2017-01-30v4No1 / 8
74amnondominant spice, united states of america, foodon product type, spice or herb2017-02-27v4No1 / 8
274amnondominant monkey, chlorocebus djamdjamensis, bale monkey, ethiopia, feces2018-01-16v4No1 / 8
346amnonhigh freq. in fruitfly larva grown on orange (dominant larval stage, body proper, citrus sinensis, italy, whole body, orange, mediterranean fruit fly, ceratitis capitata)2018-06-11v4No1 / 8
346amnonhigh freq. in fruitfly larva grown on prickly pear (dominant larval stage, body proper, italy, whole body, prickly pear, opuntia ficus indica, mediterranean fruit fly, ceratitis capitata)2018-06-11v4No1 / 8
415amnondominant rhizosphere, soil, citrus, orchard, brazil, cultivated environment2018-11-27v4No1 / 8
431amnoncommon in midgut of non-hibernating bumble bees (common bombus terrestris, bumble bee, midgut, research facility, queen, no hibernation, belgium)2018-12-16v4No1 / 8
440amnondominant galapagos islands, feces, bird, finch, green warbler-finch, certhidea olivacea2019-01-06v4No1 / 8
618amnondominant early flowering stage, rhizosphere, canada, farm, cannabis sativa2020-05-04v4No1 / 8
101amnoncommon merlot, vitis vinifera, grapevine, new york, united states of america, leaf2017-04-03v4No1 / 9
58amnondominant homo sapiens, new york city, conjunctiva2017-02-02v4No1 / 10
74amnondominant capsicum annuum, united states of america, foodon product type2017-02-27v4No1 / 10
74amnoncommon solanum lycopersicum, united states of america, foodon product type2017-02-27v4No1 / 10
152amnonhigh in blanks compares to dust/nose samples (contamination)2017-05-04v4No1 / 10
304amnondominant united states of america, state of california, beach, pacific ocean, air, aerosol, santa cruz province2018-03-12v4No1 / 10
346amnoncommon in fruitfly larva grown on orange (common larval stage, body proper, citrus sinensis, italy, whole body, orange, ceratitis capitata, mediterranean fruit fly)2018-06-11v4No1 / 10
346amnonhigh freq. in fruitfly larva grown on figs (dominant larval stage, body proper, italy, whole body, ficus carica, fig, ceratitis capitata, mediterranean fruit fly)2018-06-11v4No1 / 10
417amnondominant anser cygnoides, swan goose, bird, feces, mongolia, summer2018-12-01v4No1 / 10
501amnondominant costa rica, psiguria triphylla, flower, nectar2019-03-08v4No1 / 10
618amnondominant pre-vegetative stage, rhizosphere, canada, farm, cannabis sativa2020-05-04v4No1 / 10
57amnondominant apis mellifera, digestive system, forager, state of california2017-01-31v4No1 / 11
59amnondominant centris atripes, digestive system2017-02-03v4No1 / 11
195amnonhigh freq. in boston subway surfaces (dominant city, urban biome, train, boston)2017-09-07v4No1 / 11
206amnonhigh freq. in air from israel particles <10um size (dominant air, dust, israel, size < 10um, clear day)2017-10-04v4No1 / 11
311amnondominant united states of america, state of rhode island, fish sauce, foodon product type2018-04-09v4No1 / 11
346amnoncommon in fruitfly larva grown on annona (common larval stage, body proper, italy, whole body, annona cherimola, ceratitis capitata, mediterranean fruit fly)2018-06-11v4No1 / 11
418amnondominant coral, ocean, pocillopora damicornis, mucus2018-12-02v4No1 / 11
547amnondominant red pepper sauce, capsicum annuum, sichuan province, china, food (fermented)2019-08-15v4No1 / 11
75amnondominant homo sapiens, skin, arm, venezuela, amerindian, hunter gatherer2017-02-27v4No1 / 12
89amnondominant junco hyemalis, commonwealth of virginia, songbird, cloaca2017-03-08v4No1 / 12
146amnondominant united states of america, solanum lycopersicum, tomato, blossom, flower structure2017-04-20v4No1 / 12
206amnonhigh freq. in dust storm air from israel particles <10um size (dominant israel, air, size < 10um, dust, dust storm)2017-10-04v4No1 / 12
279amnondominant grassland, leaf, stem, steppe, mongolia, china2018-01-24v4No1 / 12
515amnondominant poland, whole body, beetle, plant, nida basin, herbivorous beetle, crioceris duodecimpunctata2019-04-18v4No1 / 12
618amnondominant late flowering stage, rhizosphere, canada, farm, cannabis sativa2020-05-04v4No1 / 12
63amnonhigh freq. in skin in american gut (dominant skin, homo sapiens)2017-02-15v4No1 / 13
97amnoncommon calophya, adult, brazil, state of florida2017-04-01v4No1 / 13
199amnonhigh freq. on shower wall tile (dominant bathroom, shower, building, tile, urban biome, united states of america, building wall)2017-10-01v4No1 / 13
243amnondominant beetle, anoplophora glabripennis, digestive system, united states of america2017-11-15v4No1 / 13
515amnoncommon poland, whole body, beetle, plant, nida basin, herbivorous beetle, polydrusus inustus2019-04-18v4No1 / 13
517amnondominant homo sapiens, child, age 5-13 years, bolivia, rural community, chuquisaca department, skin, arm, forearm2019-05-29v4No1 / 13
609sheryoDominant in soil with tobacco plants amended with difenoconazole fungicide (dominant tobacco plant present, difenoconazole, fungicide, ph 7-8, china, tobacco field, limestone, depth 0-20cm, soil)2020-04-21v4No1 / 13
618amnondominant pre-vegetative stage, canada, farm, root, root endosphere, cannabis sativa2020-05-04v4No1 / 13
58amnondominant homo sapiens, new york city, skin of face, skin under eyes2017-02-02v4No1 / 14
89amnondominant junco hyemalis, uropygial gland, commonwealth of virginia, songbird2017-03-08v4No1 / 14
304amnoncandidate contaminants - higher in blanks (contamination)2018-03-12v4No1 / 14
371amnondominant homo sapiens, skin, amerindian, hunter gatherer, venezuela2018-09-06v4No1 / 14
602sheryocommon in rhizoshere of tomato plant roots planted in potting mix amended with biochar (common ph 7.3, potting mix, biochar, solanum lycopersicum, israel, rhizosphere)2020-04-03v4No1 / 14
602sheryocommon rhizosphere, soil, israel, solanum lycopersicum, biochar2020-04-03v4No1 / 14
602sheryodominant in rhizoshere of tomato plant roots planted in potting mix amended with biochar (dominant ph 7.3, potting mix, biochar, rhizosphere, israel, solanum lycopersicum)2020-04-05v4No1 / 14
58amnondominant homo sapiens, new york city, contact lens2017-02-02v4No1 / 15
613amnondominant olsztyn, poland, aquarium, research facility, gastrointestinal system, gut, esox lucius, pike fry, fish2020-04-25v3No1 / 15
618amnondominant late flowering stage, canada, farm, root, root endosphere, cannabis sativa2020-05-04v4No1 / 15
397amnondominant panama, digestive system, intestine, fungus growing ant, atta sexdens2018-11-14v4No1 / 16
625amnondominant feces, guanacaste conservation area, costa rica, wild, alouatta palliata, mantled howler monkey2020-05-16v4No1 / 16
108amnonincreases during fasting in nile tilapia caecum ( high in fasting late timepoints compared to early timepoints in research facility texas united states of america caecum oreochromis niloticus nile tilapia )2017-04-07v4No1 / 17
199amnonhigh freq. in kitchen sink (dominant building, urban biome, united states of america, kitchen, sink)2017-10-01v4No1 / 17
311amnoncommon united states of america, state of rhode island, kimchi, food (fermented)2018-04-09v4No1 / 17
602sheryocommon in rhizoshere of tomato plant roots planted in unamended potting mix (common ph 6.5, unamended, potting mix, solanum lycopersicum, israel, rhizosphere)2020-04-03v4No1 / 17
602sheryodominant in rhizoshere of tomato plant roots planted in unamended potting mix (dominant ph 6.5, potting mix, unamended, rhizosphere, israel, solanum lycopersicum)2020-04-03v4No1 / 17
128amnondominant belgium, ivy, hedera ibernica, leaf, city, dense settlement biome2017-04-14v4No1 / 18
408amnondominant ant, costa rica, united states of america, larval stage, pseudomyrmex simplex2018-11-22v4No1 / 18
515amnoncommon poland, whole body, beetle, plant, nida basin, herbivorous beetle, eusomus ovulum2019-04-18v4No1 / 18
623amnoncommon skin of body, skin, homo sapiens, umbilicus, united states of america, adult, commonwealth of pennsylvania2020-05-10v3No1 / 18
101amnoncommon united states of america, vitis vinifera, merlot, grapevine, new york, grape, botanical fruit food product2017-04-03v4No1 / 19
59amnoncommon centris atripes, digestive system2017-02-03v4No1 / 20
184amnoncommon peru, digestive system, ants, odontomachus2017-08-15v4No1 / 20
277amnoncommon homo sapiens, belgium, adult, nasopharynx2018-01-23v4No1 / 20
58amnoncommon homo sapiens, new york city, skin of face, skin under eyes2017-02-02v4No1 / 21
350amnonhigh freq. in feces of white faced capuchin from costa rica rain forest (dominant monkey, cebus capucinus, feces, costa rica, white-faced capuchin, woodland area)2018-07-30v4No1 / 21
501amnoncommon costa rica, psiguria triphylla, flower, nectar2019-03-08v4No1 / 21
618amnondominant canada, farm, seedling, propagation stage, root, root endosphere, cannabis sativa2020-05-04v4No1 / 21
515amnoncommon poland, whole body, beetle, plant, nida basin, herbivorous beetle, argoptochus quadrisignatus2019-04-18v4No1 / 22
58amnoncommon homo sapiens, new york city, contact lens2017-02-02v4No1 / 23
74amnoncommon capsicum annuum, united states of america, foodon product type2017-02-27v4No1 / 23
74amnoncommon prosciutto, united states of america, foodon product type2017-02-27v4No1 / 23
128amnondominant belgium, ivy, hedera ibernica, leaf, moor, scrubland2017-04-14v4No1 / 23
346amnoncommon in fruitfly larva grown on prickly pear (common larval stage, body proper, italy, whole body, prickly pear, opuntia ficus indica, ceratitis capitata, mediterranean fruit fly)2018-06-11v4No1 / 23
418amnondominant coral, ocean, acropora hyacinthus, mucus2018-12-02v4No1 / 23
489amnoncommon feces, anal swab, myotis myotis, bat, greater mouse eared bat, french republic2019-02-25v4No1 / 24
618amnondominant early flowering stage, canada, farm, root, root endosphere, cannabis sativa2020-05-04v4No1 / 24
620amnondominant feces, wild, nouabale-ndoki national park, republic of congo, gorilla gorilla2020-05-06v4No1 / 24
59amnon high in austin united states of america compared to australia malaysia seoul china in apis mellifera digestive system 2017-02-02v4No1 / 25
181amnoncommon bombus terrestris, bumblebee, belgium, research facility, digestive system2017-08-15v4No1 / 25
146amnoncommon united states of america, solanum lycopersicum, tomato, blossom, flower structure2017-04-20v4No1 / 26
158amnonhigher in skin sites compared to mouth in cats ( high in skin compared to saliva mouth in felis catus cat united states of america )2017-07-06v4No1 / 26
74amnoncommon squash, united states of america, foodon product type2017-02-27v4No1 / 27
605amnon high in control compared to recurrent otitis media in australia nasopharynx child age 1-3 years perth 2020-04-07v3No1 / 27
58amnoncommon homo sapiens, new york city, conjunctiva2017-02-02v4No1 / 28
620amnondominant chimpanzee, pan troglodytes troglodytes, wild, nouabale-ndoki national park, republic of congo, feces2020-05-06v4No1 / 28
246amnon high in high bmi body mass index obesity compared to control in homo sapiens saliva italy 2017-11-21v4No1 / 30
490amnonobserved in amniotic fluid and buffer and water controls (contamination)2019-02-25v4No1 / 32
57amnoncommon apis mellifera, digestive system, state of california, forager2017-01-31v4No1 / 33
407amnoncommon costa rica, feces, monkey, cebus capucinus, white-faced capuchin, wild2018-11-21v4No1 / 34
146amnoncommon united states of america, solanum lycopersicum, tomato, botanical fruit food product2017-04-20v4No1 / 35
350amnoncommon in feces of white faced capuchin from costa rica rain forest (common monkey, cebus capucinus, feces, costa rica, white-faced capuchin, woodland area)2018-07-30v4No1 / 35
180amnoncommon dermanyssus gallinae, red poulty mite, czech republic, poulty farm, adult2017-08-14v4No1 / 36
231amnonhigher in urine compared to genitalia in dogs ( high in urine compared to reproductive organ reproductive system genitalia in dog canis lupus familiaris united states of america )2017-11-02v4No1 / 36
232amnoncommon in foot of diabetic patients (common homo sapiens, skin, australia, foot, diabetes mellitus)2017-11-05v4No1 / 37
277amnoncommon homo sapiens, belgium, adult, nasal cavity, pair of nares2018-01-23v4No1 / 37
243amnoncommon beetle, anoplophora glabripennis, digestive system, united states of america2017-11-15v4No1 / 38
541amnonhigher in koalas eating Eucalyptus obliqua leaves comapred to Eucalyptus viminalis ( high in eucalyptus obliqua diet eucalyptus obliqua compared to eucalyptus viminalis eucalyptus viminalis diet in phascolarctos cinereus koala feces australia wild cape otway )2019-08-01v4No1 / 38
74amnoncommon spices, united states of america, foodon product type, spice or herb2017-02-27v4No1 / 39
28amnoncommon in various trees in hawaii (common hawaii, organic material, forest biome, whole plant, leaf, forest ecosystem)2016-12-05v4No1 / 41
89amnoncommon junco hyemalis, uropygial gland, commonwealth of virginia, songbird2017-03-08v4No1 / 43
189amnoncommon united states of america, state of california, grape, vitis vinifera, stem, endosphere2017-08-30v4No1 / 43
547amnon high in high salt concentration compared to low salt concentration in red pepper sauce capsicum annuum sichuan province china food (fermented) 2019-08-15v4No1 / 43
69amnoncommon canis lupus familiaris, beagle dog, united states of america, research facility, bronchoalveolar lavage2017-02-21v4No1 / 44
618amnoncommon canada, farm, seedling, propagation stage, root, root endosphere, cannabis sativa2020-05-04v4No1 / 44
408amnon high in larval stage compared to stomach in ant costa rica united states of america pseudomyrmex flavicornis 2018-11-22v4No1 / 47
89amnoncommon junco hyemalis, commonwealth of virginia, songbird, cloaca2017-03-08v4No1 / 48
547amnoncommon red pepper sauce, capsicum annuum, sichuan province, china, food (fermented)2019-08-15v4No1 / 49
515amnoncommon poland, whole body, beetle, aphthona venustula, plant, nida basin, herbivorous beetle2019-04-18v4No1 / 54
354amnon high in bronchus bronchial epithelium bronchial brush compared to sputum induced sputum in homo sapiens united states of america adult 2018-07-30v4No1 / 55
63amnoncommon in skin in american gut (common homo sapiens, skin)2017-02-15v4No1 / 56
423amnon high in male compared to female in bank vole myodes glareolus ukraine skin 2018-12-05v4No1 / 56
56amnoncommon nicotiana galuca, flower, nectar, israel2017-01-30v4No1 / 57
308amnoncommon in neonatal intensive care unit floor (common united states of america, state of california, hospital, floor, dust)2018-03-31v4No1 / 57
431amnoncommon in midgut of hibernating bumble bees (common research facility, midgut, belgium, bombus terrestris, bumble bee, queen, hibernation)2018-12-16v4No1 / 57
523amnoncommon air, building, bedroom, united states of america, chicago, state of illinois2019-07-03v4No1 / 58
228amnonlower in chronic sinositis compared to healthy controls in sinus brushing ( high in control compared to sinusitis in homo sapiens mucosa sinusoidal space paranasal sinus united states of america )2017-10-31v4No1 / 60
199amnonlower in bathroom shower compared to kitchen sink ( high in kitchen sink compared to bathroom shower tile building wall in building urban biome united states of america )2017-10-01v4No1 / 61
311amnonlower in fermneted kimchi days>1 compared to day 0 ( high in day 0 early timepoints compared to days 1-9 in united states of america state of rhode island kimchi food (fermented) )2018-04-09v4No1 / 62
311amnoncommon united states of america, state of rhode island, red pepper, foodon product type2018-04-09v4No1 / 63
558amnon high in duodenum compared to caecum in bird centrocercus urophasianus greater sage-grouse united states of america state of wyoming 2019-09-20v4No1 / 64
17amnon high in high altitude compared to low altitude in ochotona feces stomach tibetan plateau 2016-11-09v4No1 / 65
341amnoncommon water, drinking water, united states of america, tap water, state of illinois, fresh water2018-05-28v4No1 / 66
311amnoncommon united states of america, state of rhode island, fish sauce, foodon product type2018-04-09v4No1 / 68
417amnoncommon anser cygnoides, swan goose, bird, feces, mongolia, summer2018-12-01v4No1 / 68
231amnoncommon in dog urine (common dog, canis lupus familiaris, united states of america, urine)2017-11-02v4No1 / 69
28amnoncommon hawaii, feces, terrestrial biome, achatinella mustelina, environmental system determined by an organism2016-12-05v4No1 / 71
26amnoncommon united states of america, homo sapiens, pair of nares, mucus2016-12-05v4No1 / 73
99amnoncommon commonwealth of virginia, united states of america, skin, mucus, notophthalmus viridescens, newt2017-04-02v4No1 / 74
26amnoncommon united states of america, felis catus, mucus, pair of nares2016-12-05v4No1 / 80
565amnoncommon skin, canada, eidolon helvum, fruit bat, zoological garden, toronto zoo, captive2019-11-21v3No1 / 83
569amnoncommon in gastric biopsies of patients negative for h. pylori (common homo sapiens, south korea, mucosa of stomach, stomach, biopsy)2019-12-16v3No1 / 85
26amnon high in pair of nares mucus compared to saliva mouth in united states of america felis catus 2016-12-05v4No1 / 86
199amnoncommon on shower wall tile (common bathroom, shower, building, tile, urban biome, united states of america, building wall)2017-10-01v4No1 / 90
26amnon high in pair of nares mucus compared to inguinal region axilla sebum in united states of america homo sapiens 2016-12-05v4No1 / 92
354amnon high in bronchus bronchial brush bronchial epithelium compared to saliva oral wash in homo sapiens united states of america adult 2018-07-30v4No1 / 94
238amnoncommon homo sapiens, feces, colombia2017-11-07v4No1 / 96
361amnoncommon leaf, austria, greenhouse, plant, dracaena fragrans2018-08-21v4No1 / 100
536amnoncommon crotalus horridus, snake, skin, united states of america, southern united states, timber rattlesnake2019-07-28v4No1 / 101
361amnoncommon leaf, austria, greenhouse, plant, malvaviscus penduliflorus2018-08-21v4No1 / 102
515amnoncommon whole body, beetle, detritivorous beetle, feces, bulgaria, balkan mountains, onthophagus similis2019-04-18v4No1 / 104
565amnoncommon skin, canada, sciurus carolinensis, eastern gray squirrel2019-11-21v3No1 / 104
323amnonhigher in sharks compared to sea water ( high in shark compared to water surface water depth 0m sea water in atlantic ocean south florida state of florida united states of america )2018-04-24v4No1 / 107
269amnoncommon in fresh yao meat food (common china, foodon product type)2018-01-09v4No1 / 113
128amnonhigher in ivy leaves from moor compared to forest ( high in scrubland moor compared to forest ecosystem in belgium ivy hedera ibernica leaf )2017-04-14v4No1 / 114
417amnon high in mongolia summer compared to winter china in anser cygnoides swan goose bird feces 2018-12-01v4No1 / 114
567amnon high in control compared to chronic rhinosinusitis sinusitis in homo sapiens adult belgium nasopharynx 2019-12-05v4No1 / 114
98amnoncommon citrus, leaf, vero beach, fl, state of florida2017-04-01v4No1 / 115
492amnoncommon skin, adult, germany, bufo bufo, toad, common toad2019-02-27v4No1 / 115
195amnoncommon in boston subway surfaces (common city, urban biome, train, boston)2017-09-07v4No1 / 116
613amnoncommon olsztyn, poland, aquarium, research facility, gastrointestinal system, gut, esox lucius, pike fry, fish2020-04-25v3No1 / 116
515amnoncommon whole body, beetle, aphodius depressus, detritivorous beetle, feces, bulgaria, balkan mountains2019-04-18v4No1 / 121
517amnoncommon homo sapiens, child, age 5-13 years, bolivia, rural community, chuquisaca department, skin, arm, forearm2019-05-29v4No1 / 121
98amnoncommon citrus, leaf, ft. pierce, fl, state of florida2017-04-01v4No1 / 126
199amnoncommon in kitchen sink (common building, urban biome, united states of america, kitchen, sink)2017-10-01v4No1 / 130
515amnoncommon carnivorous beetle, river, poland, raba river, whole body, beetle, bembidion modestum2019-04-18v4No1 / 131
609sheryohigher in soil with tobacco plants and with difenoconazole fungicide ( high in presence of tobacco plants compared to absence of tobacco plants in difenoconazole fungicide ph 7-8 china tobacco field limestone depth 0-20cm soil )2020-04-21v4No1 / 131
291amnoncommon canis lupus familiaris, dog, pair of nares, nasal cavity, germany2018-02-01v4No1 / 144
132amnoncommon homo sapiens, feces, united states of america2017-04-16v4No1 / 145
475amnoncommon in air next to subway stations in hong kong (common air, hong kong, city)2019-01-20v4No1 / 147
515amnoncommon whole body, beetle, detritivorous beetle, feces, bulgaria, balkan mountains, aphodius haemorrhoidalis2019-04-18v4No1 / 147
361amnoncommon leaf, austria, greenhouse, plant, howea forsteriana2018-08-21v4No1 / 154
361amnoncommon leaf, austria, greenhouse, plant, dracaena draco2018-08-21v4No1 / 155
108amnon high in colon compared to caecum in research facility texas united states of america coturnix coturnix common quail 2017-04-07v4No1 / 157
515amnoncommon poland, whole body, beetle, plant, nida basin, herbivorous beetle, crioceris duodecimpunctata2019-04-18v4No1 / 157
98amnoncommon citrus, leaf, immokalee, fl, state of florida2017-04-01v4No1 / 160
209amnoncommon in whale blow condensate (common north america, megaptera novaeangliae, humpback whale, respiratory airway, exhaled air condensate, whale blow)2017-10-15v4No1 / 161
408amnon high in larval stage compared to stomach in ant costa rica united states of america pseudomyrmex spinicola 2018-11-22v4No1 / 165
232amnoncoomon in foot of healthy controls (common homo sapiens, skin, australia, foot)2017-11-05v4No1 / 166
197amnoncommon feces, homo sapiens, obsolete_juvenile stage, age 13, juvenile organism, india2017-09-12v4No1 / 170
241amnonlower in babies age <1 year compared to age 1-3 years ( high in age age 1-3 years compared to age < 1 year in homo sapiens feces infant )2017-11-13v4No1 / 173
163amnoncommon stomach, ochotonidae, pika, ochotona curzoniae, mongolia grassland, china2017-07-13v4No1 / 174
99amnoncommon commonwealth of virginia, united states of america, skin, mucus, anaxyrus americanus, american toad2017-04-02v4No1 / 176
403amnon high in winter compared to summer in air kingdom of spain pyrenees autumn 2018-11-18v4No1 / 176
515amnoncommon whole body, beetle, detritivorous beetle, feces, bulgaria, balkan mountains, onthophagus ruficapillus2019-04-18v4No1 / 178
536amnoncommon snake, skin, united states of america, southern united states, pantherophis obsoletus, black rat snake, arboreal snake2019-07-28v4No1 / 184
567amnon high in anterior naris pair of nares compared to nasopharynx in homo sapiens adult belgium 2019-12-05v4No1 / 186
98amnoncommon citrus, leaf, quincy, fl, state of florida2017-04-01v4No1 / 188
197amnon high in india compared to finland in feces homo sapiens obsolete_juvenile stage age 13 juvenile organism 2017-09-12v4No1 / 189
75amnoncommon homo sapiens, skin, arm, venezuela, amerindian, hunter gatherer2017-02-27v4No1 / 191
567amnon high in control compared to sinusitis chronic rhinosinusitis in homo sapiens adult belgium anterior naris pair of nares 2019-12-05v4No1 / 191
534amnoncommon river, water, fresh water, depth 10 cm, koshi river, tributary, nepal, particle bound, filtered 2.7um2019-07-22v4No1 / 193
88amnondifferent between herds in cape buffalo feces ( high in herd lower sabie herd compared to croc bridge herd in syncerus caffer caffer cape buffalo feces south africa )2017-03-08v4No1 / 194
371amnoncommon homo sapiens, skin, amerindian, hunter gatherer, venezuela2018-09-06v4No1 / 195
620amnoncommon feces, wild, nouabale-ndoki national park, republic of congo, gorilla gorilla2020-05-06v4No1 / 196
312amnoncommon feces, homo sapiens, french republic, adult, spondyloarthritis, spondylitis2018-04-09v4No1 / 197
80amnoncommon feces, alouatta pigra, howler monkey, tropical broadleaf forest biome, central america, woodland area2017-03-03v4No1 / 198
6amnoncommon urine, female, homo sapiens, pregnancy, state of tennessee2016-10-13v4No1 / 201
618amnoncommon early flowering stage, canada, farm, root, root endosphere, cannabis sativa2020-05-04v4No1 / 205
323amnoncommon in shark skin (common atlantic ocean, south florida, state of florida, united states of america, shark, skin)2018-04-24v4No1 / 213
17amnoncommon ochotona, feces, stomach, tibetan plateau2016-11-09v4No1 / 214
98amnoncommon citrus, leaf, gainesville, fl, state of florida2017-04-01v4No1 / 215
201amnonhigher in cactus fly compared to decaying cactus ( high in drosophila fly drosophila nigrospiracula compared to cactus decaying in mexico desert )2017-10-01v4No1 / 215
130amnon high in sphagnum compared to vaccinium in peatland leaf plant austria alpine bog plant surface sphagnum bog 2017-04-15v4No1 / 222
505amnon high in early time points compared to late time points in water pacific ocean state of california surface water particle bound size 1-80um sea water 2019-03-16v4No1 / 223
78amnoncommon nanger granti, kenya, feces, tropical grassland biome, gazelle2017-03-01v4No1 / 236
492amnoncommon skin, adult, rana catesbeiana, bullfrog, lithobates catesbeianus, frog, japan2019-02-27v4No1 / 236
536amnoncommon snake, skin, united states of america, southern united states, agkistrodon contortrix, copperhead snake2019-07-28v4No1 / 236
620amnoncommon chimpanzee, pan troglodytes troglodytes, wild, nouabale-ndoki national park, republic of congo, feces2020-05-06v4No1 / 238
406amnoncommon feces, zoological garden, french republic, gorilla gorilla, monkey, gorilla2018-11-21v4No1 / 239
161amnoncommon in barn swallows in colorado (common hirundo rustica, feces, united states of america, colorado, barn swallow)2017-07-12v4No1 / 245
425amnon high in antananarivo madagascar compared to bangui central african republic in homo sapiens feces africa child 2018-12-08v4No1 / 248
351amnoncommon sea urchin, lytechinus variegatus, coelomic fluid, research facility, eagle harbor, state of florida, united states of america2018-07-30v4No1 / 249
45amnonlower in young babies compared to 2 year olds in india ( high in age age 1-2 compared to age 0-1 in homo sapiens feces infant india )2016-12-19v4No1 / 253
561amnon high in grass growth diet summer compared to green stage diet spring in bos grunniens yak china tibetan plateau alpine meadow rumen ruminal fluid 2019-11-05v3No1 / 256
304amnoncommon united states of america, state of california, beach, pacific ocean, air, aerosol, monterey bay2018-03-12v4No1 / 263
253amnoncommon in clouds in puy de dome mountain in france (common cloud, french republic, air, autumn)2017-11-22v4No1 / 267
559amnoncommon feces, united states of america, captive, zoological garden, dicerorhinus sumatrensis, sumatran rhinoceros2019-11-03v4No1 / 267
602sheryohigher in rhizoshere of tomato plant roots planted in potting mix amended with biochar ( high in amended with biochar compared to unamended in potting mix rhizosphere israel solanum lycopersicum )2020-04-05v4No1 / 270
558amnon high in summer compared to winter in bird centrocercus urophasianus greater sage-grouse united states of america state of wyoming 2019-09-20v4No1 / 274
438amnon high in age 3-6 age 8-12 child compared to adult age 30-50 age 60-79 in homo sapiens feces china 2018-12-30v4No1 / 279
128amnonhigher in ivy leaves from city compared to moor and forest ( high in city dense settlement biome compared to moor forest ecosystem in belgium ivy hedera ibernica leaf )2017-04-14v4No1 / 287
423amnoncommon bank vole, myodes glareolus, ukraine, skin2018-12-05v4No1 / 291
561amnon high in grass growth diet summer compared to withered grass diet winter in ruminal fluid rumen alpine meadow tibetan plateau china yak bos grunniens 2019-11-05v3No1 / 294
331amnoncommon feces, monkey, theropithecus gelada, ethiopia2018-05-13v4No1 / 298
515amnoncommon carnivorous beetle, river, poland, raba river, whole body, beetle, bembidion punctulatum2019-04-18v4No1 / 305
80amnoncommon feces, central america, alouatta palliata, mantled howler monkey, state of florida2017-03-03v4No1 / 309
625amnoncommon feces, guanacaste conservation area, costa rica, wild, alouatta palliata, mantled howler monkey2020-05-16v4No1 / 309
80amnon high in dry forest compared to tropical moist broadleaf forest biome in feces central america alouatta palliata mantled howler monkey state of florida 2017-03-03v4No1 / 314
618amnoncommon pre-vegetative stage, canada, farm, root, root endosphere, cannabis sativa2020-05-04v4No1 / 318
163amnon high in ochotona curzoniae tibet plateau compared to ochotona dauurica mongolia grassland in ochotonidae pika stomach china 2017-07-13v4No1 / 331
351amnoncommon in artificial sea water where sea urchins were grown (common sea urchin, lytechinus variegatus, research facility, state of florida, united states of america, artificial seawater, sea water)2018-07-30v4No1 / 338
190amnon high in wet season compared to dry season in homo sapiens tanzania hadza hunter gatherer feces 2017-09-04v4No1 / 341
620amnon high in nouabale-ndoki national park wild republic of congo pan troglodytes troglodytes compared to united states of america zoological garden pan troglodytes in chimpanzee feces 2020-05-06v4No1 / 351
618amnoncommon late flowering stage, canada, farm, root, root endosphere, cannabis sativa2020-05-04v4No1 / 352
537amnonlower in feces of deer mice grown in captivity compared to wild caught ( high in wild compared to captive research facility in feces canada peromyscus maniculatus deer mice age 3-5 weeks province of ontario algonquin provincial park )2019-07-28v3No1 / 358
209amnonhigher in whale blow condensate compared to ocean water ( high in whale blow exhaled air condensate respiratory airway megaptera novaeangliae humpback whale compared to sea water ocean depth 25cm in north america )2017-10-15v4No1 / 359
341amnonhigher in fresh drinking water compared to week old water ( high in fresh water compared to stagnant water in water drinking water united states of america tap water state of illinois )2018-05-28v4No1 / 365
565amnoncommon skin, canada, papio anubis, olive baboon, zoological garden, captive, toronto zoo2019-11-21v3No1 / 368
620amnon high in nouabale-ndoki national park wild republic of congo compared to zoological garden united states of america in gorilla gorilla gorilla feces 2020-05-06v4No1 / 368
625amnoncommon son tra nature reserve, viet nam, pygathrix nemaeus, red-shanked douc, wild, feces2020-05-16v4No1 / 369
582amnon high in ear canal external acoustic meatus compared to perianal skin rectum in wild united states of america santa catalina island urocyon littoralis santa catalina island fox urocyon littoralis catalinae 2020-01-22v4No1 / 374
256amnoncommon sus scrofa, pig, duodenum, jejunum, ileum, united kingdom2017-11-26v4No1 / 380
559amnoncommon feces, united states of america, black rhinoceros, diceros bicornis, captive, zoological garden2019-11-03v4No1 / 382
256amnonhigher in small intestine compared to colon in pigs ( high in duodenum jejunum ileum compared to caecum right colon left colon in sus scrofa pig united kingdom )2017-11-26v4No1 / 387
425amnon high in feces compared to duodenum in homo sapiens africa child 2018-12-08v4No1 / 416
515amnoncommon whole body, beetle, detritivorous beetle, feces, bulgaria, balkan mountains, aphodius pusillus2019-04-18v4No1 / 421
99amnoncommon commonwealth of virginia, united states of america, skin, mucus, pseudacris crucifer, peeper2017-04-02v4No1 / 438
274amnoncommon monkey, ethiopia, feces, chlorocebus aethiops, grivet monkey2018-01-16v4No1 / 440
128amnoncommon belgium, ivy, hedera ibernica, leaf, city, dense settlement biome2017-04-14v4No1 / 461
276amnon high in peru small village tunapuco rural community compared to united states of america city state of oklahoma in feces homo sapiens adult 2018-01-22v4No1 / 469
620amnon high in chimpanzee pan troglodytes troglodytes compared to gorilla gorilla in nouabale-ndoki national park republic of congo wild feces 2020-05-06v4No1 / 478
274amnoncommon monkey, chlorocebus djamdjamensis, bale monkey, ethiopia, feces2018-01-16v4No1 / 489
415amnoncommon rhizosphere, soil, citrus, orchard, united states of america, cultivated environment2018-11-27v4No1 / 494
618amnon high in root endosphere root compared to rhizosphere in canada farm cannabis sativa 2020-05-04v4No1 / 510
304amnoncommon united states of america, state of california, beach, pacific ocean, air, aerosol, santa cruz province2018-03-12v4No1 / 518
618amnoncommon pre-vegetative stage, rhizosphere, canada, farm, cannabis sativa2020-05-04v4No1 / 530
27amnoncommon bos grunniens, rumen, china2016-12-05v4No1 / 532
98amnoncommon citrus, rhizosphere, immokalee, fl, root, state of florida2017-04-01v4No1 / 543
98amnoncommon citrus, rhizosphere, vero beach, fl, root, state of florida2017-04-01v4No1 / 544
240amnonlower in infants age<1 year compared to 1-3 years in baby feces ( high in age age > 1 year compared to age <1 year in homo sapiens feces infant finland )2017-11-12v4No1 / 567
559amnoncommon feces, united states of america, captive, zoological garden, rhinoceros unicornis, greater one-horned rhinoceros2019-11-03v4No1 / 582
146amnon high in rhizosphere compared to soil in united states of america solanum lycopersicum tomato slit loam ph 6 2017-04-20v4No1 / 590
536amnon high in terrestrial snake compared to aquatic snake in snake skin united states of america southern united states 2019-07-28v4No1 / 590
415amnoncommon rhizosphere, soil, citrus, orchard, south africa, cultivated environment2018-11-27v4No1 / 600
223amnon high in yushan islands compared to other regions in sediment marine sediment ocean east china sea china 2017-10-26v4No1 / 619
128amnoncommon belgium, ivy, hedera ibernica, leaf, moor, scrubland2017-04-14v4No1 / 623
609sheryoCommon in soil with tobacco plants amended with difenoconazole fungicide and biochar (common biochar, tobacco plant present, difenoconazole, fungicide, ph 7-8, china, tobacco field, limestone, depth 0-20cm, soil)2020-04-21v4No1 / 634
200amnoncommon in river downstream of wastewater treatment plant (common river, fresh water, water, united states of america, wastewater treatment plant, effluent)2017-10-01v4No1 / 655
612amnoncommon state of florida, united states of america, spring water, water, fresh water, location 42020-04-22v4No1 / 655
175amnonhigher in summer compared to winter in heavy metal contaminated soils in china ( high in summer compared to winter in soil heavy metal china )2017-07-29v4No1 / 658
609sheryocommon in soil with tobacco plants amended with difenoconazole fungicide (common tobacco plant present, difenoconazole, fungicide, ph 7-8, china, tobacco field, limestone, depth 0-20cm, soil)2020-04-21v4No1 / 671
128amnoncommon belgium, ivy, hedera ibernica, leaf, forest ecosystem2017-04-14v4No1 / 693
232amnonlower in diabetec patient foot skin compared to healthy controls ( high in control compared to diabetes mellitus in homo sapiens skin australia foot )2017-11-05v4No1 / 708
415amnoncommon rhizosphere, soil, citrus, orchard, reunion island, cultivated environment2018-11-27v4No1 / 721
415amnoncommon rhizosphere, soil, citrus, australia, orchard, cultivated environment2018-11-27v4No1 / 743
206amnoncommon in air from israel particles <10um size (common air, dust, israel, size < 10um, clear day)2017-10-04v4No1 / 765
157amnoncommon in naers of weened calves (common nasal cavity, bos taurus, calve, united states of america, juvenile organism, pair of nares)2017-07-04v4No1 / 766
78amnon high in female compared to male in nanger granti kenya feces tropical grassland biome gazelle 2017-03-01v4No1 / 814
331amnon high in wet season compared to dry season in feces monkey theropithecus gelada ethiopia 2018-05-13v4No1 / 818
618amnoncommon late flowering stage, rhizosphere, canada, farm, cannabis sativa2020-05-04v4No1 / 819
415amnoncommon rhizosphere, soil, citrus, orchard, china, cultivated environment2018-11-27v4No1 / 830
444amnoncommon rhizosphere, fragaria x ananassa, strawberry, greenhouse soil, farm, yellow brown soil, nanjing city prefecture, continuous cropping, age 5 years, age 10 years, china, cultivated environment2019-01-07v4No1 / 833
232amnonlower in diabetec foot ulcers compared to non-ulcer skin in diabetic patients ( high in control compared to wound ulcer in homo sapiens skin australia foot diabetes mellitus )2017-11-05v4No1 / 836
517amnon high in skin arm forearm compared to feces in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 836
371amnonhigher in skin of amerindians compared to western visitors ( high in venezuela hunter gatherer amerindian compared to city united states of america in homo sapiens skin )2018-09-06v4No1 / 854
618amnoncommon early flowering stage, rhizosphere, canada, farm, cannabis sativa2020-05-04v4No1 / 873
146amnoncommon united states of america, solanum lycopersicum, tomato, slit loam soil, ph 6, rhizosphere2017-04-20v4No1 / 894
206amnoncommon in dust storm air from israel particles <10um size (common israel, air, size < 10um, dust, dust storm)2017-10-04v4No1 / 902
98amnoncommon citrus, rhizosphere, quincy, fl, root, state of florida2017-04-01v4No1 / 950
412amnon high in ph>5 compared to ph<5 in soil hunan province red soil cambisol zea mays triticum aestivum china 2018-11-26v4No1 / 1005
517amnon high in skin arm forearm compared to mouth mucosa mouth in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 1014
618amnon high in early flowering stage compared to late flowering stage in rhizosphere canada farm cannabis sativa 2020-05-04v4No1 / 1040
406amnoncommon feces, zoological garden, hippotragus niger, sable antelope, french republic2018-11-21v4No1 / 1075
415amnoncommon rhizosphere, soil, citrus, orchard, brazil, cultivated environment2018-11-27v4No1 / 1091
415amnoncommon rhizosphere, soil, citrus, orchard, kingdom of spain, cultivated environment2018-11-27v4No1 / 1099
101amnoncommon merlot, vitis vinifera, grapevine, new york, united states of america, root2017-04-03v4No1 / 1106
236amnoncommon ocean, state of california, pacific ocean, bodega bay, water, sea water2017-11-07v4No1 / 1156
357amnon high in ph>5 compared to ph<5 in soil topsoil depth 0-10cm temperate woodland biome temperate deciduos forest woodland area forest ecosystem 2018-08-18v4No1 / 1171
505amnon high in particle bound size 1-80um compared to free floating size < 1um in water pacific ocean state of california surface water sea water 2019-03-14v4No1 / 1218
415amnoncommon rhizosphere, soil, citrus, orchard, italy, cultivated environment2018-11-27v4No1 / 1279
454amnon high in winter compared to summer in elaphurus davidianus pere deer deer feces china 2019-01-10v4No1 / 1304
571amnoncommon china, soil, mangrove swamp, marine sediment, depth 0-20cm, mangrove, kandelia candel, hainan autonomous prefecture, dongzhaigang national nature reserve2019-12-16v4No1 / 1351
98amnoncommon citrus, rhizosphere, gainesville, fl, root, state of florida2017-04-01v4No1 / 1371
40amnoncommon soil, field soil, nicotiana tabacum, rhizosphere, china2016-12-09v4No1 / 1420
444amnoncommon rhizosphere, fragaria x ananassa, strawberry, greenhouse soil, farm, yellow brown soil, nanjing city prefecture, age 1 year, china, cultivated environment2019-01-07v4No1 / 1439
353amnonlower in captive compared to wild caught Lissotriton vulgaris newts skin ( high in wild compared to research facility in newt adult skin cambridgeshire triturus cristatus united kingdom )2018-07-30v4No1 / 1834
236amnoncommon state of california, bodega bay, ocean, zostera marina, marine eelgrass, sediment, marine sediment2017-11-07v4No1 / 1904
101amnoncommon vitis vinifera, united states of america, merlot, grapevine, new york, rhizosphere2017-04-03v4No1 / 1980
101amnon high in root compared to rhizosphere in vitis vinifera united states of america merlot grapevine new york 2017-04-03v4No1 / 2075
175amnoncommon in heavy metal contaminated soils in china (common soil, heavy metal, ph 7-9, china)2017-07-29v4No1 / 2133
101amnoncommon vitis vinifera, united states of america, merlot, grapevine, new york, soil2017-04-03v4No1 / 2537
265amnon high in soil compared to soilwater water in canada province of quebec 2017-12-11v4No1 / 2715
236amnon high in sediment marine sediment compared to root in state of california bodega bay ocean zostera marina marine eelgrass 2017-11-07v4No1 / 2745
171amnonlower in roots compared to rhizosphere soil in rice ( high in rhizosphere soil compared to root in united states of america state of california oryza sativa rice )2017-07-25v4No1 / 7628

Problems / suggestions? Please email info AT dbbact DOT org