Search result for sequence:
TACAGAGGATGCAAGCGTTATCCGGAATGATTGGGCGTAAAGCGTCTGTAGGTGGCTTTTTAAGTCCGCCGTCAAATCCCAGGGCTCAACCCTGGACAGGCGGTGGAAACTACCAAGCTGGAGTACGGTAGGGGCAGAGGGAATTTCCGG
common ontology terms
term enrichment score
TermScore
united states of america0.223350
skin0.181027
citrus0.162406
feces0.157573
homo sapiens0.154168
leaf0.147829
whole body0.130952
rhizosphere0.124814
state of florida0.121177
beetle0.112853
foodon product type0.100418
china0.099408
soil0.098620
belgium0.095847
plant0.090361
cultivated environment0.085227
state of california0.084848
orchard0.081761
digestive system0.074180
air0.070475
poland0.067692
adult0.067488
vitis vinifera0.065147
costa rica0.058920
monkey0.058747
nida basin0.058065
herbivorous beetle0.058065
mucus0.058065
pair of nares0.058065
larval stage0.056022
italy0.055901
merlot0.051948
grapevine0.051948
new york0.051948
solanum lycopersicum0.045752
urban biome0.045752
ivy0.045752
hedera ibernica0.045752
commonwealth of virginia0.045234
zoological garden0.045064
summer0.043512
child0.041339
hunter gatherer0.040000
arm0.039867
building0.039867
state of rhode island0.039474
mediterranean fruit fly0.039474
ceratitis capitata0.039474
water0.039282
bird0.039216
austria0.038710
new york city0.037975
israel0.037618
australia0.037267
ocean0.037037
pacific ocean0.036810
city0.036810
root0.036254
body proper0.035928
research facility0.035778
canada0.033860
capsicum annuum0.033389
dust0.033389
venezuela0.033389
amerindian0.033389
french republic0.033250
greenhouse0.033113
ethiopia0.033113
tomato0.033113
detritivorous beetle0.033113
bulgaria0.033113
balkan mountains0.033113
captive0.032573
rural community0.032310
food (fermented)0.032051
grape0.026846
peru0.026846
nectar0.026846
mongolia0.026846
ant0.026667
size < 10um0.026667
junco hyemalis0.026667
songbird0.026667
chuquisaca department0.026667
forearm0.026667
southern united states0.026667
woodland area0.026549
flower0.026490
age 5-13 years0.026316
wild0.026316
foot0.026316
tibetan plateau0.026316
snake0.026316
LOWER IN winter0.026144
bolivia0.025974
river0.025974
canis lupus familiaris0.025641
stomach0.025316
fresh water0.025316
sea water0.024194
Fraction of dbbact annotations with this term covered by the query
TermScore
canada1.500000
LOWER IN sinusitis1.000000
hunter gatherer0.750000
belgium0.714286
citrus0.666667
vitis vinifera0.666667
grape0.666667
beetle0.666667
peru0.666667
costa rica0.666667
nectar0.666667
bombus terrestris0.666667
capsicum annuum0.666667
mongolia0.666667
apis mellifera0.666667
dust0.666667
arm0.666667
venezuela0.666667
amerindian0.666667
building0.666667
cebus capucinus0.666667
white-faced capuchin0.666667
state of illinois0.666667
newt0.666667
particle bound0.666667
ph>50.666667
monkey0.625000
foodon product type0.600000
french republic0.571429
air0.545455
skin0.520000
red pepper0.500000
malus x domestica0.500000
apple0.500000
greenhouse0.500000
malvaviscus penduliflorus0.500000
vero beach, fl0.500000
merlot0.500000
grapevine0.500000
new york0.500000
immokalee, fl0.500000
gainesville, fl0.500000
cauliflower0.500000
solanum lycopersicum0.500000
ft. pierce, fl0.500000
quincy, fl0.500000
state of rhode island0.500000
orchard0.500000
whole body0.500000
nida basin0.500000
herbivorous beetle0.500000
argoptochus quadrisignatus0.500000
squash0.500000
ants0.500000
neoponera0.500000
endosphere0.500000
eusomus ovulum0.500000
reunion island0.500000
polydrusus inustus0.500000
azteca0.500000
fungus growing ant0.500000
atta colombica0.500000
ant0.500000
pseudomyrmex cubaensis0.500000
nicotiana glauca0.500000
spice0.500000
spice or herb0.500000
chlorocebus djamdjamensis0.500000
bale monkey0.500000
ethiopia0.500000
citrus sinensis0.500000
orange0.500000
mediterranean fruit fly0.500000
ceratitis capitata0.500000
prickly pear0.500000
opuntia ficus indica0.500000
bumble bee0.500000
queen0.500000
no hibernation0.500000
galapagos islands0.500000
finch0.500000
green warbler-finch0.500000
certhidea olivacea0.500000
beach0.500000
aerosol0.500000
santa cruz province0.500000
ficus carica0.500000
fig0.500000
swan goose0.500000
psiguria triphylla0.500000
centris atripes0.500000
urban biome0.500000
train0.500000
boston0.500000
size < 10um0.500000
clear day0.500000
fish sauce0.500000
annona cherimola0.500000
pocillopora damicornis0.500000
mucus0.500000
Fraction of annotations for the query sequences containing the term
TermScore
united states of america0.301370
feces0.167808
homo sapiens0.157534
skin0.109589
leaf0.092466
citrus0.092466
rhizosphere0.082192
whole body0.075342
state of florida0.071918
soil0.071918
china0.071918
beetle0.061644
foodon product type0.054795
plant0.051370
cultivated environment0.051370
belgium0.051370
state of california0.047945
adult0.047945
orchard0.044521
digestive system0.044521
poland0.037671
air0.037671
vitis vinifera0.034247
larval stage0.034247
italy0.030822
nida basin0.030822
herbivorous beetle0.030822
costa rica0.030822
monkey0.030822
mucus0.030822
pair of nares0.030822
merlot0.027397
grapevine0.027397
new york0.027397
research facility0.027397
solanum lycopersicum0.023973
summer0.023973
urban biome0.023973
commonwealth of virginia0.023973
child0.023973
ivy0.023973
hedera ibernica0.023973
water0.023973
zoological garden0.023973
austria0.020548
state of rhode island0.020548
israel0.020548
body proper0.020548
mediterranean fruit fly0.020548
ceratitis capitata0.020548
bird0.020548
new york city0.020548
pacific ocean0.020548
city0.020548
ocean0.020548
arm0.020548
hunter gatherer0.020548
building0.020548
australia0.020548
root0.020548
greenhouse0.017123
ethiopia0.017123
capsicum annuum0.017123
dust0.017123
food (fermented)0.017123
venezuela0.017123
amerindian0.017123
tomato0.017123
rural community0.017123
french republic0.017123
control0.017123
captive0.017123
canada0.017123
detritivorous beetle0.017123
bulgaria0.017123
balkan mountains0.017123
grape0.013699
peru0.013699
ant0.013699
flower0.013699
nectar0.013699
mongolia0.013699
size < 10um0.013699
junco hyemalis0.013699
songbird0.013699
age 5-13 years0.013699
bolivia0.013699
chuquisaca department0.013699
forearm0.013699
woodland area0.013699
wild0.013699
canis lupus familiaris0.013699
foot0.013699
stomach0.013699
tibetan plateau0.013699
fresh water0.013699
snake0.013699
southern united states0.013699
LOWER IN winter0.013699
river0.013699
Exp. ID User ID Description Date Region Flag Sequences
311amnonred pepper chloroplast (other red pepper, chloroplast)2018-04-09v4No1 / 1
343amnonapple chloroplast (other chloroplast, malus x domestica, apple)2018-05-28v4No1 / 1
361amnonhighfreq leaf, austria, greenhouse, plant, malvaviscus penduliflorus2018-08-21v4No1 / 1
98amnonhighfreq citrus, leaf, vero beach, fl, state of florida2017-04-01v4No1 / 2
101amnonhighfreq merlot, vitis vinifera, grapevine, new york, united states of america, leaf2017-04-03v4No1 / 2
101amnonhighfreq vitis vinifera, united states of america, merlot, grapevine, new york, grape, botanical fruit food product2017-04-03v4No1 / 2
98amnonhighfreq citrus, leaf, immokalee, fl, state of florida2017-04-01v4No1 / 3
98amnonhighfreq citrus, leaf, gainesville, fl, state of florida2017-04-01v4No1 / 3
74amnonhighfreq united states of america, cauliflower, foodon product type2017-02-27v4No1 / 4
74amnonhighfreq solanum lycopersicum, united states of america, foodon product type2017-02-27v4No1 / 4
98amnonhighfreq citrus, leaf, ft. pierce, fl, state of florida2017-04-01v4No1 / 4
98amnonhighfreq citrus, leaf, quincy, fl, state of florida2017-04-01v4No1 / 4
311amnonhighfreq united states of america, state of rhode island, red pepper, foodon product type2018-04-09v4No1 / 4
415amnonhighfreq rhizosphere, soil, citrus, orchard, italy, cultivated environment2018-11-27v4No1 / 4
515amnonhighfreq poland, whole body, beetle, plant, nida basin, herbivorous beetle, argoptochus quadrisignatus2019-04-18v4No1 / 4
74amnonhighfreq united states of america, squash, foodon product type2017-02-27v4No1 / 5
74amnoncommon usa, cauliflower, foodon product type2017-02-27v4No1 / 5
184amnoncommon peru, digestive system, ants, neoponera2017-08-15v4No1 / 5
189amnonhighfreq united states of america, state of california, grape, vitis vinifera, stem, endosphere2017-08-30v4No1 / 5
515amnonhighfreq poland, whole body, beetle, plant, nida basin, herbivorous beetle, eusomus ovulum2019-04-18v4No1 / 5
415amnonhighfreq rhizosphere, soil, citrus, orchard, reunion island, cultivated environment2018-11-27v4No1 / 6
415amnonhighfreq rhizosphere, soil, citrus, orchard, united states of america, cultivated environment2018-11-27v4No1 / 6
515amnonhighfreq poland, whole body, beetle, plant, nida basin, herbivorous beetle, polydrusus inustus2019-04-18v4No1 / 6
184amnoncommon peru, digestive system, azteca, ants2017-08-15v4No1 / 7
397amnoncommon panama, digestive system, intestine, fungus growing ant, atta colombica2018-11-14v4No1 / 7
408amnonhighfreq ant, costa rica, united states of america, pseudomyrmex cubaensis, larval stage2018-11-22v4No1 / 7
415amnonhighfreq rhizosphere, soil, citrus, orchard, china, cultivated environment2018-11-27v4No1 / 7
56amnonhighfreq nicotiana glauca, israel, flower, nectar2017-01-30v4No1 / 8
74amnonhighfreq spice, united states of america, foodon product type, spice or herb2017-02-27v4No1 / 8
274amnonhighfreq monkey, chlorocebus djamdjamensis, bale monkey, ethiopia, feces2018-01-16v4No1 / 8
346amnonhigh freq. in fruitfly larva grown on orange (highfreq larval stage, body proper, citrus sinensis, italy, whole body, orange, mediterranean fruit fly, ceratitis capitata)2018-06-11v4No1 / 8
346amnonhigh freq. in fruitfly larva grown on prickly pear (highfreq larval stage, body proper, italy, whole body, prickly pear, opuntia ficus indica, mediterranean fruit fly, ceratitis capitata)2018-06-11v4No1 / 8
415amnonhighfreq rhizosphere, soil, citrus, orchard, brazil, cultivated environment2018-11-27v4No1 / 8
431amnoncommon in midgut of non-hibernating bumble bees (common bombus terrestris, bumble bee, midgut, research facility, queen, no hibernation, belgium)2018-12-16v4No1 / 8
440amnonhighfreq galapagos islands, feces, bird, finch, green warbler-finch, certhidea olivacea2019-01-06v4No1 / 8
101amnoncommon merlot, vitis vinifera, grapevine, new york, united states of america, leaf2017-04-03v4No1 / 9
58amnonhighfreq homo sapiens, new york city, conjunctiva2017-02-02v4No1 / 10
74amnonhighfreq capsicum annuum, united states of america, foodon product type2017-02-27v4No1 / 10
74amnoncommon solanum lycopersicum, united states of america, foodon product type2017-02-27v4No1 / 10
152amnonhigh in blanks compares to dust/nose samples (contamination)2017-05-04v4No1 / 10
304amnonhighfreq united states of america, state of california, beach, pacific ocean, air, aerosol, santa cruz province2018-03-12v4No1 / 10
346amnoncommon in fruitfly larva grown on orange (common larval stage, body proper, citrus sinensis, italy, whole body, orange, ceratitis capitata, mediterranean fruit fly)2018-06-11v4No1 / 10
346amnonhigh freq. in fruitfly larva grown on figs (highfreq larval stage, body proper, italy, whole body, ficus carica, fig, ceratitis capitata, mediterranean fruit fly)2018-06-11v4No1 / 10
417amnonhighfreq anser cygnoides, swan goose, bird, feces, mongolia, summer2018-12-01v4No1 / 10
501amnonhighfreq costa rica, psiguria triphylla, flower, nectar2019-03-08v4No1 / 10
57amnonhighfreq apis mellifera, digestive system, forager, state of california2017-01-31v4No1 / 11
59amnonhighfreq centris atripes, digestive system2017-02-03v4No1 / 11
195amnonhigh freq. in boston subway surfaces (highfreq city, urban biome, train, boston)2017-09-07v4No1 / 11
206amnonhigh freq. in air from israel particles <10um size (highfreq air, dust, israel, size < 10um, clear day)2017-10-04v4No1 / 11
311amnonhighfreq united states of america, state of rhode island, fish sauce, foodon product type2018-04-09v4No1 / 11
346amnoncommon in fruitfly larva grown on annona (common larval stage, body proper, italy, whole body, annona cherimola, ceratitis capitata, mediterranean fruit fly)2018-06-11v4No1 / 11
418amnonhighfreq coral, ocean, pocillopora damicornis, mucus2018-12-02v4No1 / 11
547amnonhighfreq red pepper sauce, capsicum annuum, sichuan province, china, food (fermented)2019-08-15v4No1 / 11
75amnonhighfreq homo sapiens, skin, arm, venezuela, amerindian, hunter gatherer2017-02-27v4No1 / 12
89amnonhighfreq junco hyemalis, commonwealth of virginia, songbird, cloaca2017-03-08v4No1 / 12
146amnonhighfreq united states of america, solanum lycopersicum, tomato, blossom, flower structure2017-04-20v4No1 / 12
206amnonhigh freq. in dust storm air from israel particles <10um size (highfreq israel, air, size < 10um, dust, dust storm)2017-10-04v4No1 / 12
279amnonhighfreq grassland, leaf, stem, steppe, mongolia, china2018-01-24v4No1 / 12
515amnonhighfreq poland, whole body, beetle, plant, nida basin, herbivorous beetle, crioceris duodecimpunctata2019-04-18v4No1 / 12
63amnonhigh freq. in skin in american gut (highfreq skin, homo sapiens)2017-02-15v4No1 / 13
97amnoncommon calophya, adult, brazil, state of florida2017-04-01v4No1 / 13
199amnonhigh freq. on shower wall tile (highfreq bathroom, shower, building, tile, urban biome, united states of america, building wall)2017-10-01v4No1 / 13
243amnonhighfreq beetle, anoplophora glabripennis, digestive system, united states of america2017-11-15v4No1 / 13
515amnoncommon poland, whole body, beetle, plant, nida basin, herbivorous beetle, polydrusus inustus2019-04-18v4No1 / 13
517amnonhighfreq homo sapiens, child, age 5-13 years, bolivia, rural community, chuquisaca department, skin, arm, forearm2019-05-29v4No1 / 13
58amnonhighfreq homo sapiens, new york city, skin of face, skin under eyes2017-02-02v4No1 / 14
89amnonhighfreq junco hyemalis, uropygial gland, commonwealth of virginia, songbird2017-03-08v4No1 / 14
304amnoncandidate contaminants - higher in blanks (contamination)2018-03-12v4No1 / 14
371amnonhighfreq homo sapiens, skin, amerindian, hunter gatherer, venezuela2018-09-06v4No1 / 14
58amnonhighfreq homo sapiens, new york city, contact lens2017-02-02v4No1 / 15
397amnonhighfreq panama, digestive system, intestine, fungus growing ant, atta sexdens2018-11-14v4No1 / 16
108amnonincreases during fasting in nile tilapia caecum ( high in fasting late timepoints compared to early timepoints in research facility texas united states of america caecum oreochromis niloticus nile tilapia )2017-04-07v4No1 / 17
199amnonhigh freq. in kitchen sink (highfreq building, urban biome, united states of america, kitchen, sink)2017-10-01v4No1 / 17
311amnoncommon united states of america, state of rhode island, kimchi, food (fermented)2018-04-09v4No1 / 17
128amnonhighfreq belgium, ivy, hedera ibernica, leaf, city, dense settlement biome2017-04-14v4No1 / 18
408amnonhighfreq ant, costa rica, united states of america, larval stage, pseudomyrmex simplex2018-11-22v4No1 / 18
515amnoncommon poland, whole body, beetle, plant, nida basin, herbivorous beetle, eusomus ovulum2019-04-18v4No1 / 18
101amnoncommon united states of america, vitis vinifera, merlot, grapevine, new york, grape, botanical fruit food product2017-04-03v4No1 / 19
59amnoncommon centris atripes, digestive system2017-02-03v4No1 / 20
184amnoncommon peru, digestive system, ants, odontomachus2017-08-15v4No1 / 20
277amnoncommon homo sapiens, belgium, adult, nasopharynx2018-01-23v4No1 / 20
58amnoncommon homo sapiens, new york city, skin of face, skin under eyes2017-02-02v4No1 / 21
350amnonhigh freq. in feces of white faced capuchin from costa rica rain forest (highfreq monkey, cebus capucinus, feces, costa rica, white-faced capuchin, woodland area)2018-07-30v4No1 / 21
501amnoncommon costa rica, psiguria triphylla, flower, nectar2019-03-08v4No1 / 21
515amnoncommon poland, whole body, beetle, plant, nida basin, herbivorous beetle, argoptochus quadrisignatus2019-04-18v4No1 / 22
58amnoncommon homo sapiens, new york city, contact lens2017-02-02v4No1 / 23
74amnoncommon capsicum annuum, united states of america, foodon product type2017-02-27v4No1 / 23
74amnoncommon prosciutto, united states of america, foodon product type2017-02-27v4No1 / 23
128amnonhighfreq belgium, ivy, hedera ibernica, leaf, moor, scrubland2017-04-14v4No1 / 23
346amnoncommon in fruitfly larva grown on prickly pear (common larval stage, body proper, italy, whole body, prickly pear, opuntia ficus indica, ceratitis capitata, mediterranean fruit fly)2018-06-11v4No1 / 23
418amnonhighfreq coral, ocean, acropora hyacinthus, mucus2018-12-02v4No1 / 23
489amnoncommon feces, anal swab, myotis myotis, bat, greater mouse eared bat, french republic2019-02-25v4No1 / 24
59amnon high in austin united states of america compared to australia malaysia seoul china in apis mellifera digestive system 2017-02-02v4No1 / 25
181amnoncommon bombus terrestris, bumblebee, belgium, research facility, digestive system2017-08-15v4No1 / 25
146amnoncommon united states of america, solanum lycopersicum, tomato, blossom, flower structure2017-04-20v4No1 / 26
158amnonhigher in skin sites compared to mouth in cats ( high in skin compared to saliva mouth in felis catus cat united states of america )2017-07-06v4No1 / 26
74amnoncommon squash, united states of america, foodon product type2017-02-27v4No1 / 27
58amnoncommon homo sapiens, new york city, conjunctiva2017-02-02v4No1 / 28
246amnon high in high bmi body mass index obesity compared to control in homo sapiens saliva italy 2017-11-21v4No1 / 30
490amnonobserved in amniotic fluid and buffer and water controls (contamination)2019-02-25v4No1 / 32
57amnoncommon apis mellifera, digestive system, state of california, forager2017-01-31v4No1 / 33
407amnoncommon costa rica, feces, monkey, cebus capucinus, white-faced capuchin, wild2018-11-21v4No1 / 34
146amnoncommon united states of america, solanum lycopersicum, tomato, botanical fruit food product2017-04-20v4No1 / 35
350amnoncommon in feces of white faced capuchin from costa rica rain forest (common monkey, cebus capucinus, feces, costa rica, white-faced capuchin, woodland area)2018-07-30v4No1 / 35
180amnoncommon dermanyssus gallinae, red poulty mite, czech republic, poulty farm, adult2017-08-14v4No1 / 36
231amnonhigher in urine compared to genitalia in dogs ( high in urine compared to reproductive organ reproductive system genitalia in dog canis lupus familiaris united states of america )2017-11-02v4No1 / 36
232amnoncommon in foot of diabetic patients (common homo sapiens, skin, australia, foot, diabetes mellitus)2017-11-05v4No1 / 37
277amnoncommon homo sapiens, belgium, adult, nasal cavity, pair of nares2018-01-23v4No1 / 37
243amnoncommon beetle, anoplophora glabripennis, digestive system, united states of america2017-11-15v4No1 / 38
541amnonhigher in koalas eating Eucalyptus obliqua leaves comapred to Eucalyptus viminalis ( high in eucalyptus obliqua diet eucalyptus obliqua compared to eucalyptus viminalis eucalyptus viminalis diet in phascolarctos cinereus koala feces australia wild cape otway )2019-08-01v4No1 / 38
74amnoncommon spices, united states of america, foodon product type, spice or herb2017-02-27v4No1 / 39
28amnoncommon in various trees in hawaii (common hawaii, organic material, forest biome, whole plant, leaf, forest ecosystem)2016-12-05v4No1 / 41
89amnoncommon junco hyemalis, uropygial gland, commonwealth of virginia, songbird2017-03-08v4No1 / 43
189amnoncommon united states of america, state of california, grape, vitis vinifera, stem, endosphere2017-08-30v4No1 / 43
547amnon high in high salt concentration compared to low salt concentration in red pepper sauce capsicum annuum sichuan province china food (fermented) 2019-08-15v4No1 / 43
69amnoncommon canis lupus familiaris, beagle dog, united states of america, research facility, bronchoalveolar lavage2017-02-21v4No1 / 44
408amnon high in larval stage compared to stomach in ant costa rica united states of america pseudomyrmex flavicornis 2018-11-22v4No1 / 47
89amnoncommon junco hyemalis, commonwealth of virginia, songbird, cloaca2017-03-08v4No1 / 48
547amnoncommon red pepper sauce, capsicum annuum, sichuan province, china, food (fermented)2019-08-15v4No1 / 49
515amnoncommon poland, whole body, beetle, aphthona venustula, plant, nida basin, herbivorous beetle2019-04-18v4No1 / 54
354amnon high in bronchus bronchial epithelium bronchial brush compared to sputum induced sputum in homo sapiens united states of america adult 2018-07-30v4No1 / 55
63amnoncommon in skin in american gut (common homo sapiens, skin)2017-02-15v4No1 / 56
423amnon high in male compared to female in bank vole myodes glareolus ukraine skin 2018-12-05v4No1 / 56
56amnoncommon nicotiana galuca, flower, nectar, israel2017-01-30v4No1 / 57
308amnoncommon in neonatal intensive care unit floor (common united states of america, state of california, hospital, floor, dust)2018-03-31v4No1 / 57
431amnoncommon in midgut of hibernating bumble bees (common research facility, midgut, belgium, bombus terrestris, bumble bee, queen, hibernation)2018-12-16v4No1 / 57
523amnoncommon air, building, bedroom, united states of america, chicago, state of illinois2019-07-03v4No1 / 58
228amnonlower in chronic sinositis compared to healthy controls in sinus brushing ( high in control compared to sinusitis in homo sapiens mucosa sinusoidal space paranasal sinus united states of america )2017-10-31v4No1 / 60
199amnonlower in bathroom shower compared to kitchen sink ( high in kitchen sink compared to bathroom shower tile building wall in building urban biome united states of america )2017-10-01v4No1 / 61
311amnonlower in fermneted kimchi days>1 compared to day 0 ( high in day 0 early timepoints compared to days 1-9 in united states of america state of rhode island kimchi food (fermented) )2018-04-09v4No1 / 62
311amnoncommon united states of america, state of rhode island, red pepper, foodon product type2018-04-09v4No1 / 63
558amnon high in duodenum compared to caecum in bird centrocercus urophasianus greater sage-grouse united states of america state of wyoming 2019-09-20v4No1 / 64
17amnon high in high altitude compared to low altitude in ochotona feces stomach tibetan plateau 2016-11-09v4No1 / 65
341amnoncommon water, drinking water, united states of america, tap water, state of illinois, fresh water2018-05-28v4No1 / 66
311amnoncommon united states of america, state of rhode island, fish sauce, foodon product type2018-04-09v4No1 / 68
417amnoncommon anser cygnoides, swan goose, bird, feces, mongolia, summer2018-12-01v4No1 / 68
231amnoncommon in dog urine (common dog, canis lupus familiaris, united states of america, urine)2017-11-02v4No1 / 69
28amnoncommon hawaii, feces, terrestrial biome, achatinella mustelina, environmental system determined by an organism2016-12-05v4No1 / 71
26amnoncommon united states of america, homo sapiens, pair of nares, mucus2016-12-05v4No1 / 73
99amnoncommon commonwealth of virginia, united states of america, skin, mucus, notophthalmus viridescens, newt2017-04-02v4No1 / 74
26amnoncommon united states of america, felis catus, mucus, pair of nares2016-12-05v4No1 / 80
565amnoncommon captive, toronto zoo, zoological garden, fruit bat, eidolon helvum, canada, skin2019-11-21v3No1 / 83
26amnon high in pair of nares mucus compared to saliva mouth in united states of america felis catus 2016-12-05v4No1 / 86
199amnoncommon on shower wall tile (common bathroom, shower, building, tile, urban biome, united states of america, building wall)2017-10-01v4No1 / 90
26amnon high in pair of nares mucus compared to inguinal region axilla sebum in united states of america homo sapiens 2016-12-05v4No1 / 92
354amnon high in bronchus bronchial brush bronchial epithelium compared to saliva oral wash in homo sapiens united states of america adult 2018-07-30v4No1 / 94
238amnoncommon homo sapiens, feces, colombia2017-11-07v4No1 / 96
361amnoncommon leaf, austria, greenhouse, plant, dracaena fragrans2018-08-21v4No1 / 100
536amnoncommon crotalus horridus, snake, skin, united states of america, southern united states, timber rattlesnake2019-07-28v4No1 / 101
361amnoncommon leaf, austria, greenhouse, plant, malvaviscus penduliflorus2018-08-21v4No1 / 102
515amnoncommon whole body, beetle, detritivorous beetle, feces, bulgaria, balkan mountains, onthophagus similis2019-04-18v4No1 / 104
565amnoncommon eastern gray squirrel, sciurus carolinensis, canada, skin2019-11-21v3No1 / 104
323amnonhigher in sharks compared to sea water ( high in shark compared to water surface water depth 0m sea water in atlantic ocean south florida state of florida united states of america )2018-04-24v4No1 / 107
269amnoncommon in fresh yao meat food (common china, foodon product type)2018-01-09v4No1 / 113
128amnonhigher in ivy leaves from moor compared to forest ( high in scrubland moor compared to forest ecosystem in belgium ivy hedera ibernica leaf )2017-04-14v4No1 / 114
417amnon high in mongolia summer compared to winter china in anser cygnoides swan goose bird feces 2018-12-01v4No1 / 114
567amnon high in control compared to sinusitis chronic rhinosinusitis in nasopharynx belgium adult homo sapiens 2019-12-05v4No1 / 114
98amnoncommon citrus, leaf, vero beach, fl, state of florida2017-04-01v4No1 / 115
492amnoncommon skin, adult, germany, bufo bufo, toad, common toad2019-02-27v4No1 / 115
195amnoncommon in boston subway surfaces (common city, urban biome, train, boston)2017-09-07v4No1 / 116
515amnoncommon whole body, beetle, aphodius depressus, detritivorous beetle, feces, bulgaria, balkan mountains2019-04-18v4No1 / 121
517amnoncommon homo sapiens, child, age 5-13 years, bolivia, rural community, chuquisaca department, skin, arm, forearm2019-05-29v4No1 / 121
98amnoncommon citrus, leaf, ft. pierce, fl, state of florida2017-04-01v4No1 / 126
199amnoncommon in kitchen sink (common building, urban biome, united states of america, kitchen, sink)2017-10-01v4No1 / 130
515amnoncommon carnivorous beetle, river, poland, raba river, whole body, beetle, bembidion modestum2019-04-18v4No1 / 131
291amnoncommon canis lupus familiaris, dog, pair of nares, nasal cavity, germany2018-02-01v4No1 / 144
132amnoncommon homo sapiens, feces, united states of america2017-04-16v4No1 / 145
475amnoncommon in air next to subway stations in hong kong (common air, hong kong, city)2019-01-20v4No1 / 147
515amnoncommon whole body, beetle, detritivorous beetle, feces, bulgaria, balkan mountains, aphodius haemorrhoidalis2019-04-18v4No1 / 147
361amnoncommon leaf, austria, greenhouse, plant, howea forsteriana2018-08-21v4No1 / 154
361amnoncommon leaf, austria, greenhouse, plant, dracaena draco2018-08-21v4No1 / 155
108amnon high in colon compared to caecum in research facility texas united states of america coturnix coturnix common quail 2017-04-07v4No1 / 157
515amnoncommon poland, whole body, beetle, plant, nida basin, herbivorous beetle, crioceris duodecimpunctata2019-04-18v4No1 / 157
98amnoncommon citrus, leaf, immokalee, fl, state of florida2017-04-01v4No1 / 160
209amnoncommon in whale blow condensate (common north america, megaptera novaeangliae, humpback whale, respiratory airway, exhaled air condensate, whale blow)2017-10-15v4No1 / 161
408amnon high in larval stage compared to stomach in ant costa rica united states of america pseudomyrmex spinicola 2018-11-22v4No1 / 165
232amnoncoomon in foot of healthy controls (common homo sapiens, skin, australia, foot)2017-11-05v4No1 / 166
197amnoncommon feces, homo sapiens, obsolete_juvenile stage, age 13, juvenile organism, india2017-09-12v4No1 / 170
241amnonlower in babies age <1 year compared to age 1-3 years ( high in age age 1-3 years compared to age < 1 year in homo sapiens feces infant )2017-11-13v4No1 / 173
163amnoncommon stomach, ochotonidae, pika, ochotona curzoniae, mongolia grassland, china2017-07-13v4No1 / 174
99amnoncommon commonwealth of virginia, united states of america, skin, mucus, anaxyrus americanus, american toad2017-04-02v4No1 / 176
403amnon high in winter compared to summer in air kingdom of spain pyrenees autumn 2018-11-18v4No1 / 176
515amnoncommon whole body, beetle, detritivorous beetle, feces, bulgaria, balkan mountains, onthophagus ruficapillus2019-04-18v4No1 / 178
536amnoncommon snake, skin, united states of america, southern united states, pantherophis obsoletus, black rat snake, arboreal snake2019-07-28v4No1 / 184
567amnon high in pair of nares anterior naris compared to nasopharynx in belgium adult homo sapiens 2019-12-05v4No1 / 186
98amnoncommon citrus, leaf, quincy, fl, state of florida2017-04-01v4No1 / 188
197amnon high in india compared to finland in feces homo sapiens obsolete_juvenile stage age 13 juvenile organism 2017-09-12v4No1 / 189
75amnoncommon homo sapiens, skin, arm, venezuela, amerindian, hunter gatherer2017-02-27v4No1 / 191
567amnon high in control compared to chronic rhinosinusitis sinusitis in pair of nares anterior naris belgium adult homo sapiens 2019-12-05v4No1 / 191
534amnoncommon river, water, fresh water, depth 10 cm, koshi river, tributary, nepal, particle bound, filtered 2.7um2019-07-22v4No1 / 193
88amnondifferent between herds in cape buffalo feces ( high in herd lower sabie herd compared to croc bridge herd in syncerus caffer caffer cape buffalo feces south africa )2017-03-08v4No1 / 194
371amnoncommon homo sapiens, skin, amerindian, hunter gatherer, venezuela2018-09-06v4No1 / 195
312amnoncommon feces, homo sapiens, french republic, adult, spondyloarthritis, spondylitis2018-04-09v4No1 / 197
80amnoncommon feces, alouatta pigra, howler monkey, tropical broadleaf forest biome, central america, woodland area2017-03-03v4No1 / 198
6amnoncommon urine, female, homo sapiens, pregnancy, state of tennessee2016-10-13v4No1 / 201
323amnoncommon in shark skin (common atlantic ocean, south florida, state of florida, united states of america, shark, skin)2018-04-24v4No1 / 213
17amnoncommon ochotona, feces, stomach, tibetan plateau2016-11-09v4No1 / 214
98amnoncommon citrus, leaf, gainesville, fl, state of florida2017-04-01v4No1 / 215
201amnonhigher in cactus fly compared to decaying cactus ( high in drosophila fly drosophila nigrospiracula compared to cactus decaying in mexico desert )2017-10-01v4No1 / 215
130amnon high in sphagnum compared to vaccinium in peatland leaf plant austria alpine bog plant surface sphagnum bog 2017-04-15v4No1 / 222
505amnon high in early time points compared to late time points in water pacific ocean state of california surface water particle bound size 1-80um sea water 2019-03-16v4No1 / 223
78amnoncommon nanger granti, kenya, feces, tropical grassland biome, gazelle2017-03-01v4No1 / 236
492amnoncommon skin, adult, rana catesbeiana, bullfrog, lithobates catesbeianus, frog, japan2019-02-27v4No1 / 236
536amnoncommon snake, skin, united states of america, southern united states, agkistrodon contortrix, copperhead snake2019-07-28v4No1 / 236
406amnoncommon feces, zoological garden, french republic, gorilla gorilla, monkey, gorilla2018-11-21v4No1 / 239
161amnoncommon in barn swallows in colorado (common hirundo rustica, feces, united states of america, colorado, barn swallow)2017-07-12v4No1 / 245
425amnon high in antananarivo madagascar compared to bangui central african republic in homo sapiens feces africa child 2018-12-08v4No1 / 248
351amnoncommon sea urchin, lytechinus variegatus, coelomic fluid, research facility, eagle harbor, state of florida, united states of america2018-07-30v4No1 / 249
45amnonlower in young babies compared to 2 year olds in india ( high in age age 1-2 compared to age 0-1 in homo sapiens feces infant india )2016-12-19v4No1 / 253
561amnon high in summer grass growth diet compared to spring green stage diet in ruminal fluid rumen alpine meadow tibetan plateau china yak bos grunniens 2019-11-05v3No1 / 256
304amnoncommon united states of america, state of california, beach, pacific ocean, air, aerosol, monterey bay2018-03-12v4No1 / 263
253amnoncommon in clouds in puy de dome mountain in france (common cloud, french republic, air, autumn)2017-11-22v4No1 / 267
559amnoncommon sumatran rhinoceros, dicerorhinus sumatrensis, zoological garden, captive, united states of america, feces2019-11-03v4No1 / 267
558amnon high in summer compared to winter in bird centrocercus urophasianus greater sage-grouse united states of america state of wyoming 2019-09-20v4No1 / 274
438amnon high in age 3-6 age 8-12 child compared to adult age 30-50 age 60-79 in homo sapiens feces china 2018-12-30v4No1 / 279
128amnonhigher in ivy leaves from city compared to moor and forest ( high in city dense settlement biome compared to moor forest ecosystem in belgium ivy hedera ibernica leaf )2017-04-14v4No1 / 287
423amnoncommon bank vole, myodes glareolus, ukraine, skin2018-12-05v4No1 / 291
561amnon high in summer grass growth diet compared to winter withered grass diet in bos grunniens yak china tibetan plateau alpine meadow rumen ruminal fluid 2019-11-05v3No1 / 294
331amnoncommon feces, monkey, theropithecus gelada, ethiopia2018-05-13v4No1 / 298
515amnoncommon carnivorous beetle, river, poland, raba river, whole body, beetle, bembidion punctulatum2019-04-18v4No1 / 305
80amnoncommon feces, central america, alouatta palliata, mantled howler monkey, state of florida2017-03-03v4No1 / 309
80amnon high in dry forest compared to tropical moist broadleaf forest biome in feces central america alouatta palliata mantled howler monkey state of florida 2017-03-03v4No1 / 314
163amnon high in ochotona curzoniae tibet plateau compared to ochotona dauurica mongolia grassland in ochotonidae pika stomach china 2017-07-13v4No1 / 331
351amnoncommon in artificial sea water where sea urchins were grown (common sea urchin, lytechinus variegatus, research facility, state of florida, united states of america, artificial seawater, sea water)2018-07-30v4No1 / 338
190amnon high in wet season compared to dry season in homo sapiens tanzania hadza hunter gatherer feces 2017-09-04v4No1 / 341
537amnonlower in feces of deer mice grown in captivity compared to wild caught ( high in wild compared to captive research facility in feces canada peromyscus maniculatus deer mice age 3-5 weeks province of ontario algonquin provincial park )2019-07-28v3No1 / 358
209amnonhigher in whale blow condensate compared to ocean water ( high in whale blow exhaled air condensate respiratory airway megaptera novaeangliae humpback whale compared to sea water ocean depth 25cm in north america )2017-10-15v4No1 / 359
341amnonhigher in fresh drinking water compared to week old water ( high in fresh water compared to stagnant water in water drinking water united states of america tap water state of illinois )2018-05-28v4No1 / 365
565amnoncommon toronto zoo, captive, zoological garden, olive baboon, papio anubis, canada, skin2019-11-21v3No1 / 368
256amnoncommon sus scrofa, pig, duodenum, jejunum, ileum, united kingdom2017-11-26v4No1 / 380
559amnoncommon zoological garden, captive, diceros bicornis, black rhinoceros, united states of america, feces2019-11-03v4No1 / 382
256amnonhigher in small intestine compared to colon in pigs ( high in duodenum jejunum ileum compared to caecum right colon left colon in sus scrofa pig united kingdom )2017-11-26v4No1 / 387
425amnon high in feces compared to duodenum in homo sapiens africa child 2018-12-08v4No1 / 416
515amnoncommon whole body, beetle, detritivorous beetle, feces, bulgaria, balkan mountains, aphodius pusillus2019-04-18v4No1 / 421
99amnoncommon commonwealth of virginia, united states of america, skin, mucus, pseudacris crucifer, peeper2017-04-02v4No1 / 438
274amnoncommon monkey, ethiopia, feces, chlorocebus aethiops, grivet monkey2018-01-16v4No1 / 440
128amnoncommon belgium, ivy, hedera ibernica, leaf, city, dense settlement biome2017-04-14v4No1 / 461
276amnon high in peru small village tunapuco rural community compared to united states of america city state of oklahoma in feces homo sapiens adult 2018-01-22v4No1 / 469
274amnoncommon monkey, chlorocebus djamdjamensis, bale monkey, ethiopia, feces2018-01-16v4No1 / 489
415amnoncommon rhizosphere, soil, citrus, orchard, united states of america, cultivated environment2018-11-27v4No1 / 494
304amnoncommon united states of america, state of california, beach, pacific ocean, air, aerosol, santa cruz province2018-03-12v4No1 / 518
27amnoncommon bos grunniens, rumen, china2016-12-05v4No1 / 532
98amnoncommon citrus, rhizosphere, immokalee, fl, root, state of florida2017-04-01v4No1 / 543
98amnoncommon citrus, rhizosphere, vero beach, fl, root, state of florida2017-04-01v4No1 / 544
240amnonlower in infants age<1 year compared to 1-3 years in baby feces ( high in age age > 1 year compared to age <1 year in homo sapiens feces infant finland )2017-11-12v4No1 / 567
559amnoncommon greater one-horned rhinoceros, rhinoceros unicornis, zoological garden, captive, united states of america, feces2019-11-03v4No1 / 582
146amnon high in rhizosphere compared to soil in united states of america solanum lycopersicum tomato slit loam ph 6 2017-04-20v4No1 / 590
536amnon high in terrestrial snake compared to aquatic snake in snake skin united states of america southern united states 2019-07-28v4No1 / 590
415amnoncommon rhizosphere, soil, citrus, orchard, south africa, cultivated environment2018-11-27v4No1 / 600
223amnon high in yushan islands compared to other regions in sediment marine sediment ocean east china sea china 2017-10-26v4No1 / 619
128amnoncommon belgium, ivy, hedera ibernica, leaf, moor, scrubland2017-04-14v4No1 / 623
200amnoncommon in river downstream of wastewater treatment plant (common river, fresh water, water, united states of america, wastewater treatment plant, effluent)2017-10-01v4No1 / 655
175amnonhigher in summer compared to winter in heavy metal contaminated soils in china ( high in summer compared to winter in soil heavy metal china )2017-07-29v4No1 / 658
128amnoncommon belgium, ivy, hedera ibernica, leaf, forest ecosystem2017-04-14v4No1 / 693
232amnonlower in diabetec patient foot skin compared to healthy controls ( high in control compared to diabetes mellitus in homo sapiens skin australia foot )2017-11-05v4No1 / 708
415amnoncommon rhizosphere, soil, citrus, orchard, reunion island, cultivated environment2018-11-27v4No1 / 721
415amnoncommon rhizosphere, soil, citrus, australia, orchard, cultivated environment2018-11-27v4No1 / 743
206amnoncommon in air from israel particles <10um size (common air, dust, israel, size < 10um, clear day)2017-10-04v4No1 / 765
157amnoncommon in naers of weened calves (common nasal cavity, bos taurus, calve, united states of america, juvenile organism, pair of nares)2017-07-04v4No1 / 766
78amnon high in female compared to male in nanger granti kenya feces tropical grassland biome gazelle 2017-03-01v4No1 / 814
331amnon high in wet season compared to dry season in feces monkey theropithecus gelada ethiopia 2018-05-13v4No1 / 818
415amnoncommon rhizosphere, soil, citrus, orchard, china, cultivated environment2018-11-27v4No1 / 830
444amnoncommon rhizosphere, fragaria x ananassa, strawberry, greenhouse soil, farm, yellow brown soil, nanjing city prefecture, continuous cropping, age 5 years, age 10 years, china, cultivated environment2019-01-07v4No1 / 833
232amnonlower in diabetec foot ulcers compared to non-ulcer skin in diabetic patients ( high in control compared to wound ulcer in homo sapiens skin australia foot diabetes mellitus )2017-11-05v4No1 / 836
517amnon high in skin arm forearm compared to feces in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 836
371amnonhigher in skin of amerindians compared to western visitors ( high in venezuela hunter gatherer amerindian compared to city united states of america in homo sapiens skin )2018-09-06v4No1 / 854
146amnoncommon united states of america, solanum lycopersicum, tomato, slit loam soil, ph 6, rhizosphere2017-04-20v4No1 / 894
206amnoncommon in dust storm air from israel particles <10um size (common israel, air, size < 10um, dust, dust storm)2017-10-04v4No1 / 902
98amnoncommon citrus, rhizosphere, quincy, fl, root, state of florida2017-04-01v4No1 / 950
412amnon high in ph>5 compared to ph<5 in soil hunan province red soil cambisol zea mays triticum aestivum china 2018-11-26v4No1 / 1005
517amnon high in skin arm forearm compared to mouth mucosa mouth in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 1014
406amnoncommon feces, zoological garden, hippotragus niger, sable antelope, french republic2018-11-21v4No1 / 1075
415amnoncommon rhizosphere, soil, citrus, orchard, brazil, cultivated environment2018-11-27v4No1 / 1091
415amnoncommon rhizosphere, soil, citrus, orchard, kingdom of spain, cultivated environment2018-11-27v4No1 / 1099
101amnoncommon merlot, vitis vinifera, grapevine, new york, united states of america, root2017-04-03v4No1 / 1106
236amnoncommon ocean, state of california, pacific ocean, bodega bay, water, sea water2017-11-07v4No1 / 1156
357amnon high in ph>5 compared to ph<5 in soil topsoil depth 0-10cm temperate woodland biome temperate deciduos forest woodland area forest ecosystem 2018-08-18v4No1 / 1171
505amnon high in particle bound size 1-80um compared to free floating size < 1um in water pacific ocean state of california surface water sea water 2019-03-14v4No1 / 1218
415amnoncommon rhizosphere, soil, citrus, orchard, italy, cultivated environment2018-11-27v4No1 / 1279
454amnon high in winter compared to summer in elaphurus davidianus pere deer deer feces china 2019-01-10v4No1 / 1304
98amnoncommon citrus, rhizosphere, gainesville, fl, root, state of florida2017-04-01v4No1 / 1371
40amnoncommon soil, field soil, nicotiana tabacum, rhizosphere, china2016-12-09v4No1 / 1420
444amnoncommon rhizosphere, fragaria x ananassa, strawberry, greenhouse soil, farm, yellow brown soil, nanjing city prefecture, age 1 year, china, cultivated environment2019-01-07v4No1 / 1439
353amnonlower in captive compared to wild caught Lissotriton vulgaris newts skin ( high in wild compared to research facility in newt adult skin cambridgeshire triturus cristatus united kingdom )2018-07-30v4No1 / 1834
236amnoncommon state of california, bodega bay, ocean, zostera marina, marine eelgrass, sediment, marine sediment2017-11-07v4No1 / 1904
101amnoncommon vitis vinifera, united states of america, merlot, grapevine, new york, rhizosphere2017-04-03v4No1 / 1980
101amnon high in root compared to rhizosphere in vitis vinifera united states of america merlot grapevine new york 2017-04-03v4No1 / 2075
175amnoncommon in heavy metal contaminated soils in china (common soil, heavy metal, ph 7-9, china)2017-07-29v4No1 / 2133
101amnoncommon vitis vinifera, united states of america, merlot, grapevine, new york, soil2017-04-03v4No1 / 2537
265amnon high in soil compared to soilwater water in canada province of quebec 2017-12-11v4No1 / 2715
236amnon high in sediment marine sediment compared to root in state of california bodega bay ocean zostera marina marine eelgrass 2017-11-07v4No1 / 2745
171amnonlower in roots compared to rhizosphere soil in rice ( high in rhizosphere soil compared to root in united states of america state of california oryza sativa rice )2017-07-25v4No1 / 7628

Problems / suggestions? Please email info AT dbbact DOT org