Search result for sequence:
TACAGAGGCCAAGAGCGTTGTTCGGATTTACTGGGCGTAAAGGGCGCGTAGGCGGCAGGGCGTGTCAAGTGTGAAATCTCCGGGCTCAACCCGGAAAGTGCGCTTGAAACTACCTTGCTCGAGTCTGGGAGAGGGAATCGGAATACAGGG
common ontology terms
term enrichment score
TermScore
equus caballus0.600000
horse0.461538
LOWER IN cecal content0.333333
LOWER IN equine grass sickness0.333333
LOWER IN equus przewalskii0.333333
state of texas0.250000
LOWER IN disease0.250000
united kingdom0.181818
LOWER IN caecum0.125000
farm0.066667
feces0.025974
adult0.019608
research facility0.017857
control0.013986
united states of america0.009804
Fraction of dbbact annotations with this term covered by the query
TermScore
LOWER IN cecal content0.500000
LOWER IN equine grass sickness0.500000
LOWER IN equus przewalskii0.500000
equus caballus0.428571
horse0.333333
state of texas0.250000
LOWER IN disease0.250000
united kingdom0.111111
LOWER IN caecum0.083333
farm0.035714
feces0.013158
adult0.010204
research facility0.009259
control0.007092
united states of america0.005000
Fraction of annotations for the query sequences containing the term
TermScore
equus caballus1.000000
feces1.000000
horse0.750000
farm0.500000
control0.500000
united kingdom0.500000
LOWER IN caecum0.250000
LOWER IN cecal content0.250000
adult0.250000
united states of america0.250000
state of texas0.250000
research facility0.250000
LOWER IN equine grass sickness0.250000
LOWER IN disease0.250000
LOWER IN equus przewalskii0.250000

Problems / suggestions? Please email info AT dbbact DOT org