Search result for sequence:
TACAGAGGGGGCAAGCGTTGTTCGGAATTACTGGGCGTAAAGGGCGCGTAGGCGGCCTTCTAAGTCGAACGTGAAATCCCCGGGCTCAACCCGGGAACTGCGTCCGATACTGGAAGGCTTGAATCCGGGAGAGGGATGCGGAATTCCAGG
common ontology terms
term enrichment score
TermScore
soil0.592498
rhizosphere0.298332
china0.242967
cultivated environment0.229508
kalamazoo loam0.208955
mesic type hapludalf0.208955
kellogg biological station0.208955
silt loam0.158273
shaanxi province0.152000
zea mays0.152000
depth 0-10cm0.150099
loess plateau0.141264
restored prairie0.138211
reforestation0.138211
robinia pseudoacacia0.138211
state of michigan0.120690
glycine max0.118393
oryza sativa0.110756
agricultural feature0.105263
depth 0-20cm0.104478
united states of america0.102288
agricultural field0.100971
triticum aestivum0.097959
united states0.094017
des moines0.094017
nicollet soil series0.094017
iowa0.089796
ph 60.088106
panicum virgatum0.086207
wheat0.086207
ph 7-80.083799
depth 10-25cm0.082645
citrus0.079823
paddy field soil0.079823
miscanthus0.078261
farm0.076125
corn0.075314
topsoil0.075314
forest ecosystem0.075314
heilongjiang province0.071429
brazil0.070658
state of new york0.070039
tree0.068966
woodland area0.066667
10 years0.061947
greenhouse0.061947
hunan province0.061314
LOWER IN root0.053812
continuous corn0.053571
campinas0.053571
depth 0-40cm0.053571
grazing exclusion0.053571
haplic calcisol0.053571
calci-orthic aridisol0.053571
ningxia province0.053571
yunwushan national natural grassland protection zone0.053571
30 years0.053571
north china plain0.053571
depth 50-100m0.052174
orchard0.052174
depth 25-50cm0.052174
mexico0.051502
root0.051173
state of tennessee0.049587
ph 5.90.045558
clay loam0.045558
taxus0.045045
limestone0.045045
fungicide0.045045
tobacco field0.045045
difenoconazole0.045045
wanning city0.045045
vanilla planifolia0.045045
soil from vanilla field0.045045
fusarium oxysporum f. sp. vanillae0.045045
coarse-loamy soil0.045045
ph 6-70.044709
saccharum0.044053
sugarcane0.044053
depth 0-15cm0.044053
pot expreiment0.043103
depth 0-5cm0.042194
ph 7.60.041322
state of california0.039683
winter0.038217
npk fertilizer0.036810
depth 100-300cm0.036364
mississippi river0.036364
guanajuato0.036364
ames0.036364
kelley0.036364
subsurface drainage0.036364
greenhouse soil0.036364
yellow brown soil0.036364
depth 40-100cm0.036364
merlot0.036364
grapevine0.036364
27-35 years of grazing exclusion0.036364
20 years0.036364
day 820.036364
Fraction of dbbact annotations with this term covered by the query
TermScore
cultivated environment0.875000
agricultural feature0.750000
npk fertilizer0.750000
ph 5.90.666667
citrus0.666667
paddy field soil0.666667
heilongjiang province0.666667
ph 60.666667
soybean0.666667
clay loam0.666667
depth 10-20cm0.666667
depth 5cm0.600000
glycine max0.571429
oryza sativa0.571429
LOWER IN root0.545455
kalamazoo loam0.500000
mesic type hapludalf0.500000
kellogg biological station0.500000
restored prairie0.500000
continuous corn0.500000
miscanthus0.500000
panicum virgatum0.500000
temperate0.500000
taxus0.500000
taxus mairei0.500000
presence of tobacco plants0.500000
LOWER IN absence of tobacco plants0.500000
limestone0.500000
fungicide0.500000
tobacco field0.500000
difenoconazole0.500000
depth 100-300cm0.500000
LOWER IN depth 40-100cm0.500000
reforestation0.500000
shaanxi province0.500000
robinia pseudoacacia0.500000
10 years0.500000
grassland0.500000
steppe0.500000
aquatic biome0.500000
mississippi river0.500000
taxus cuspidata0.500000
LOWER IN taxus media0.500000
arachis hypogaea0.500000
peanut0.500000
maryland county0.500000
greenhouse0.500000
campinas0.500000
LOWER IN upper stem0.500000
LOWER IN stem surface0.500000
exosphere0.500000
bacterial enriched bio-fertilizer0.500000
fungal enriched bio-fertilizer0.500000
LOWER IN organic fertilizer- chicken manure compost0.500000
wanning city0.500000
vanilla planifolia0.500000
soil from vanilla field0.500000
fusarium oxysporum f. sp. vanillae0.500000
manured soil0.500000
red soil0.500000
zea mays0.500000
guanajuato0.500000
agave0.500000
agave salmiana0.500000
LOWER IN non-manured0.500000
southern temperate forest0.500000
temperate broadleaf and mixed forest biome0.500000
LOWER IN depth 60-90cm0.500000
united states0.500000
des moines0.500000
nicollet soil series0.500000
kanawha0.500000
vero beach, fl0.500000
mediterranean forest biome0.500000
montane forest0.500000
savanna0.500000
tobacco plant present0.500000
ames0.500000
depth 60-90cm0.500000
temperate woodland biome0.500000
temperate deciduos forest0.500000
central park0.500000
southeast china0.500000
LOWER IN temperate0.500000
LOWER IN taxus cuspidata0.500000
LOWER IN northeast china0.500000
svalbard archipelago0.500000
reunion island0.500000
silt clay loam0.500000
depth 30-75cm0.500000
day 10.500000
LOWER IN day 120.500000
coarse-loamy soil0.500000
stover ammendment soil0.500000
kelley0.500000
subsurface drainage0.500000
ph>40.500000
LOWER IN ph<40.500000
LOWER IN permafrost transition layer0.500000
shrimp farm0.500000
Fraction of annotations for the query sequences containing the term
TermScore
soil0.792453
china0.448113
united states of america0.292453
rhizosphere0.216981
state of michigan0.132075
kalamazoo loam0.132075
mesic type hapludalf0.132075
kellogg biological station0.132075
cultivated environment0.132075
silt loam0.103774
depth 0-10cm0.089623
shaanxi province0.089623
loess plateau0.089623
zea mays0.089623
restored prairie0.080189
reforestation0.080189
robinia pseudoacacia0.080189
depth 0-20cm0.066038
glycine max0.066038
agricultural field0.061321
oryza sativa0.061321
triticum aestivum0.056604
agricultural feature0.056604
iowa0.051887
united states0.051887
des moines0.051887
nicollet soil series0.051887
farm0.051887
depth 10-25cm0.047170
panicum virgatum0.047170
ph 7-80.047170
ph 60.047170
wheat0.047170
corn0.042453
miscanthus0.042453
topsoil0.042453
forest ecosystem0.042453
brazil0.042453
citrus0.042453
paddy field soil0.042453
state of new york0.042453
tree0.037736
woodland area0.037736
heilongjiang province0.037736
10 years0.033019
greenhouse0.033019
hunan province0.033019
continuous corn0.028302
depth 50-100m0.028302
campinas0.028302
mexico0.028302
orchard0.028302
root0.028302
state of tennessee0.028302
depth 25-50cm0.028302
depth 0-40cm0.028302
LOWER IN root0.028302
grazing exclusion0.028302
haplic calcisol0.028302
calci-orthic aridisol0.028302
ningxia province0.028302
yunwushan national natural grassland protection zone0.028302
30 years0.028302
winter0.028302
north china plain0.028302
ph 5.90.023585
taxus0.023585
limestone0.023585
fungicide0.023585
tobacco field0.023585
difenoconazole0.023585
saccharum0.023585
sugarcane0.023585
wanning city0.023585
vanilla planifolia0.023585
ph 7.60.023585
pot expreiment0.023585
soil from vanilla field0.023585
fusarium oxysporum f. sp. vanillae0.023585
depth 0-15cm0.023585
ph 6-70.023585
depth 0-5cm0.023585
coarse-loamy soil0.023585
state of california0.023585
clay loam0.023585
depth 100-300cm0.018868
ph 50.018868
river0.018868
mississippi river0.018868
desert0.018868
guanajuato0.018868
state of florida0.018868
ames0.018868
kelley0.018868
subsurface drainage0.018868
greenhouse soil0.018868
nanjing city prefecture0.018868
yellow brown soil0.018868
depth 40-100cm0.018868
npk fertilizer0.018868
Exp. ID User ID Description Date Region Flag Sequences
821sheryoDominant in soil of restored prairie at 0-10cm depth, Michigan USA (dominant united states of america, soil, state of michigan, depth 0-10cm, ph 6.5, kalamazoo loam, mesic type hapludalf, kellogg biological station, restored prairie)2021-07-28v4No1 / 2
821sheryoDominant in soil of continuous corn field at 0-10cm depth, Michigan USA (dominant united states of america, soil, state of michigan, depth 0-10cm, corn, ph 5.9, continuous corn, kalamazoo loam, mesic type hapludalf, kellogg biological station)2021-07-28v4No1 / 3
821sheryoDominant in soil of miscanthus field at 0-10cm depth, Michigan USA (dominant united states of america, soil, state of michigan, depth 0-10cm, miscanthus, kalamazoo loam, mesic type hapludalf, kellogg biological station, restored prairie)2021-08-02v4No1 / 3
821sheryoDominant in soil of continuous corn field at 10-25cm depth, Michigan USA (dominant united states of america, soil, state of michigan, corn, continuous corn, kalamazoo loam, mesic type hapludalf, kellogg biological station, depth 10-25cm)2021-07-28v4No1 / 4
821sheryoDominant in soil of miscanthus field at 10-25cm depth, Michigan USA (dominant united states of america, soil, state of michigan, miscanthus, kalamazoo loam, mesic type hapludalf, kellogg biological station, depth 10-25cm, restored prairie)2021-08-02v4No1 / 4
821sheryoDominant in soil of switchgrass field at 0-10cm depth, Michigan USA (dominant united states of america, soil, state of michigan, depth 0-10cm, depth 50-100m, panicum virgatum, kalamazoo loam, mesic type hapludalf, kellogg biological station, restored prairie)2021-08-02v4No1 / 4
821sheryoDominant in soil of switchgrass field at 10-25cm depth, Michigan USA (dominant united states of america, soil, state of michigan, depth 50-100m, panicum virgatum, kalamazoo loam, mesic type hapludalf, kellogg biological station, depth 10-25cm, restored prairie)2021-08-02v4No1 / 4
821sheryoDominant in soil of restored prairie at 10-25cm depth, Michigan USA (dominant united states of america, soil, state of michigan, kalamazoo loam, mesic type hapludalf, kellogg biological station, depth 10-25cm, restored prairie)2021-07-28v4No1 / 5
134amnondominant rhizosphere, temperate, tree, taxus, taxus mairei, northeast china, china2017-04-16v4No1 / 12
609sheryohigher in soil with tobacco plants and with difenoconazole fungicide ( high in presence of tobacco plants compared to absence of tobacco plants in soil ph 7-8 depth 0-20cm limestone fungicide china tobacco field difenoconazole )2020-04-21v4No1 / 131
837sheryoHigher at 100-300cm depth compared 40-100cm to in soil after 10 years reforestation with Black locust trees, shaanxi, China ( high in depth 100-300cm compared to depth 40-100cm in soil silt loam reforestation china shaanxi province loess plateau robinia pseudoacacia 10 years )2021-09-26v4No1 / 154
316amnoncommon united states of america, soil, topsoil, state of ohio, ph 5, depth 0-10cm, forest ecosystem2018-04-10v4No1 / 199
279amnoncommon grassland, steppe, soil, mongolia, china2018-01-24v4No1 / 235
103amnon high in upstream compared to downstream in united states of america river aquatic biome fresh water mississippi river particles 2017-04-05v4No1 / 256
103amnon high in upstream compared to downstream in united states of america river aquatic biome fresh water mississippi river free floating 2017-04-05v4No1 / 257
134amnon high in taxus cuspidata compared to taxus media in rhizosphere tree taxus china 2017-04-16v4No1 / 279
259amnonhigher in fertilized soil (npk) compared to non-fertilized ( high in fertilized soil compared to non-fertilized soil in soil rhizosphere arachis hypogaea ph 5 peanut china )2017-12-02v4No1 / 280
37amnoncommon in plastic leaf plants (in field next to tomato plants) (common leaf, maryland county)2016-12-09v4No1 / 298
615amnon high in soil compared to rhizosphere in brazil greenhouse campinas saccharum sugarcane 2020-04-27v4No1 / 306
615amnon high in leaf leaf surface compared to stem upper stem stem surface in brazil greenhouse exosphere campinas saccharum sugarcane 2020-04-27v4No1 / 321
686sheryoHigher in vanilla field soil infected with Fusarium oxysporum, fertilized with fungal and bacterial bio-fertilizer and had low Fusarium cumulative disease incidence ( high in bacterial enriched bio-fertilizer low fusarium cumulative disease incidence fungal enriched bio-fertilizer compared to chemical fertilization n,p,k high fusarium cumulative disease incidence organic fertilizer- chicken manure compost in wanning city vanilla planifolia ph 7.6 pot expreiment soil from vanilla field fusarium oxysporum f. sp. vanillae )2028-03-08v4No1 / 371
412amnonhigh in pig manured soil with wheat-maize rotation compared to non-manured soil ( high in manured soil compared to non-manured soil in soil cambisol red soil zea mays triticum aestivum hunan province china )2018-11-26v4No1 / 395
360amnoncommon desert, soil, mexico, guanajuato2018-08-21v4No1 / 437
360amnoncommon desert, soil, rhizosphere, mexico, guanajuato, agave, agave salmiana2018-08-21v4No1 / 484
415amnoncommon united states of america, orchard, soil, rhizosphere, citrus, cultivated environment2018-11-27v4No1 / 494
259amnonhigher in manured soil compared to non-manured ( high in manured soil compared to non-manured in soil fertilized soil rhizosphere arachis hypogaea ph 5 peanut china )2017-12-02v4No1 / 497
357amnoncommon soil, topsoil, depth 0-10cm, southern temperate forest, temperate broadleaf and mixed forest biome, woodland area, forest ecosystem2018-08-19v4No1 / 499
360amnoncommon desert, soil, mexico, guanajuato, cultivated environment2018-08-21v4No1 / 500
801sheryoHigher at depth 0-15cm compared to depth 60-90cm in corn agriculture fields, Iowa USA ( high in depth 0-15cm compared to depth 60-90cm in soil zea mays iowa agricultural field united states des moines nicollet soil series kanawha )2021-06-15v4No1 / 501
98amnoncommon rhizosphere, state of florida, citrus, vero beach, fl, root2017-04-01v4No1 / 544
357amnoncommon soil, mediterranean forest biome, topsoil, depth 0-10cm, woodland area, forest ecosystem2018-08-19v4No1 / 564
357amnoncommon soil, topsoil, depth 0-10cm, montane forest, woodland area, forest ecosystem2018-08-19v4No1 / 592
801sheryoCommon at depth 15-30cm in corn agriculture fields, Iowa USA (common soil, zea mays, iowa, agricultural field, united states, des moines, ph 7.7, nicollet soil series, depth 15-30cm, kanawha)2021-06-15v4No1 / 598
415amnoncommon orchard, soil, rhizosphere, south africa, citrus, cultivated environment2018-11-27v4No1 / 600
357amnoncommon savanna, soil, topsoil, depth 0-10cm, woodland area, forest ecosystem2018-08-19v4No1 / 614
609sheryoCommon in soil with tobacco plants amended with difenoconazole fungicide and biochar (common soil, ph 7-8, depth 0-20cm, limestone, biochar, fungicide, china, tobacco field, difenoconazole, tobacco plant present)2020-04-21v4No1 / 634
801sheryoCommon in soybean and corn agriculture fields at depth 60-90cm, Iowa USA (common soil, zea mays, glycine max, iowa, agricultural field, united states, ames, des moines, ph 7.7, nicollet soil series, depth 60-90cm)2021-06-15v4No1 / 650
609sheryocommon in soil with tobacco plants amended with difenoconazole fungicide (common soil, ph 7-8, depth 0-20cm, limestone, fungicide, china, tobacco field, difenoconazole, tobacco plant present)2020-04-21v4No1 / 671
357amnoncommon in temperate deciduous forests around the world (common soil, temperate woodland biome, topsoil, depth 0-10cm, temperate deciduos forest, woodland area, forest ecosystem)2018-08-18v4No1 / 681
422amnoncommon soil, paddy field soil, oryza sativa, heilongjiang province, ph 6-7, cultivated environment, china2018-12-04v4No1 / 682
100amnoncommon park, soil, urban biome, new york city, central park2017-04-03v4No1 / 685
134amnon high in subtropical taxus mairei southeast china compared to temperate taxus media taxus cuspidata northeast china in rhizosphere tree taxus china 2017-04-16v4No1 / 694
347amnoncommon permafrost, soil, kingdom of norway, svalbard archipelago, depth (soil) 20-30cm2018-07-15v4No1 / 698
232amnonlower in diabetec patient foot skin compared to healthy controls ( high in control compared to diabetes mellitus in homo sapiens skin foot australia )2017-11-05v4No1 / 708
415amnoncommon orchard, soil, rhizosphere, reunion island, citrus, cultivated environment2018-11-27v4No1 / 721
422amnoncommon soil, paddy field soil, oryza sativa, heilongjiang province, ph 5-6, cultivated environment, china2018-12-04v4No1 / 726
821sheryoComoon in soil of miscanthus field at 50-100cm depth, Michigan USA (common united states of america, soil, state of michigan, depth 50-100m, miscanthus, kalamazoo loam, mesic type hapludalf, kellogg biological station, restored prairie)2021-08-02v4No1 / 726
462amnoncommon united states of america, state of tennessee, soil, silt clay loam, depth 30-75cm, cultivated environment2019-01-13v4No1 / 728
415amnoncommon orchard, soil, rhizosphere, australia, citrus, cultivated environment2018-11-27v4No1 / 743
821sheryoCommon in soil of restored prairie at 50-100cm depth, Michigan USA (common united states of america, soil, state of michigan, depth 50-100m, kalamazoo loam, mesic type hapludalf, kellogg biological station, restored prairie)2021-07-28v4No1 / 744
600sheryoDecreases after 12 days of stover ammendment in soil ( high in day 1 compared to day 12 in united states of america soil state of new york depth 0-5cm ph 6 coarse-loamy soil stover ammendment soil )2020-03-27v4No1 / 747
801sheryoCommon at depth 30-60cm in corn and soybean agriculture fields, Iowa USA (common soil, zea mays, glycine max, iowa, agricultural field, united states, des moines, ph 6.7, depth (soil) 30-60cm, nicollet soil series, kelley, subsurface drainage)2021-06-15v4No1 / 760
357amnon high in ph>4 compared to ph<4 in soil topsoil depth 0-10cm southern temperate forest temperate broadleaf and mixed forest biome woodland area forest ecosystem 2018-08-19v4No1 / 761
821sheryoCommon in soil of continuous corn field at 50-100cm depth, Michigan USA (common united states of america, soil, state of michigan, corn, depth 50-100m, continuous corn, kalamazoo loam, mesic type hapludalf, kellogg biological station)2021-07-28v4No1 / 769
615amnoncommon brazil, endosphere, greenhouse, root, campinas, saccharum, sugarcane2020-04-27v4No1 / 776
615amnoncommon in control soil with no sugarcane (common soil, brazil, greenhouse, campinas)2020-04-27v4No1 / 780
821sheryoHigher at 25-50cm depth compared to 50-100cm depth in soil in Michigan USA ( high in depth 25-50cm compared to depth 50-100m in united states of america soil state of michigan corn panicum virgatum miscanthus kalamazoo loam mesic type hapludalf kellogg biological station restored prairie )2021-08-05v4No1 / 784
347amnon high in depth (soil) 20-30cm compared to depth 0-20cm permafrost transition layer in permafrost soil kingdom of norway svalbard archipelago 2018-07-15v4No1 / 788
478amnoncommon farm, intestine, litopenaeus vannamei, pacific white shrimp, china2019-02-19v4No1 / 795
478amnoncommon farm, water, saline water, shrimp farm, china2019-02-19v4No1 / 799
422amnoncommon soil, paddy field soil, oryza sativa, yunnan province, cultivated environment, china2018-12-02v4No1 / 821
415amnoncommon orchard, soil, rhizosphere, citrus, cultivated environment, china2018-11-27v4No1 / 830
837sheryoHigher at 0-40cm depth compared to 40-100cm in soil after 10 years reforestation with Black locust trees, shaanxi, China ( high in depth 0-40cm compared to depth 40-100cm in soil silt loam reforestation china shaanxi province loess plateau robinia pseudoacacia 10 years )2021-09-26v4No1 / 831
444amnoncommon farm, greenhouse soil, rhizosphere, fragaria x ananassa, nanjing city prefecture, strawberry, yellow brown soil, age 5 years, age 10 years, continuous cropping, cultivated environment, china2019-01-07v4No1 / 833
356amnoncommon in deciduous broad leaved forest top soil in japan (common soil, topsoil, hokkaido, depth 0-10cm, ph 5.4, forest ecosystem, japan)2018-08-15v4No1 / 834
801sheryoCommon in soybean and corn agriculture fields at depth 30-60cm, Iowa USA (common soil, zea mays, glycine max, iowa, agricultural field, united states, ames, des moines, depth (soil) 30-60cm, nicollet soil series, ph 7.4)2021-06-15v4No1 / 839
801sheryoCommon at depth 15-30cm in corn and soybean agriculture fields, Iowa USA (common soil, zea mays, glycine max, iowa, ph 6, agricultural field, united states, des moines, nicollet soil series, depth 15-30cm, kelley, subsurface drainage)2021-06-15v4No1 / 841
412amnoncommon soil, cambisol, red soil, zea mays, triticum aestivum, hunan province, ph>5, china2018-11-26v4No1 / 856
801sheryoCommon at depth 0-15cm in corn agriculture fields, Iowa USA (common soil, zea mays, iowa, agricultural field, united states, des moines, depth 0-15cm, nicollet soil series, ph 7.1, kanawha)2021-06-15v4No1 / 862
837sheryoHigher at 0-40cm depth compared 100-300cm to in soil after 10 years reforestation with Black locust trees, shaanxi, China ( high in depth 0-40cm compared to depth 100-300cm in soil silt loam reforestation china shaanxi province loess plateau robinia pseudoacacia 10 years )2021-09-26v4No1 / 863
767sheryoCommon in soil planted with Chrysanthemum, fertilized with bio-organic fertilizer in Nanjing China (common soil, compost biofilter, compost, pig manure, paenibacillus, china, nanjing county, chrysanthemum, bio-organic fertilizer, chrysanthemum morifolium ramat., ph 6.9, paenibacillus polymyxa)2021-04-14v4No1 / 866
821sheryoCommon in soil of switchgrass field at 50-100cm depth, Michigan USA (common united states of america, soil, state of michigan, depth 50-100m, panicum virgatum, kalamazoo loam, mesic type hapludalf, kellogg biological station)2021-08-03v4No1 / 872
129amnoncommon soil, mexico, myrtillocactus geometrizans, opuntia robusta, cactus, semi-arid, ph 6-6.52017-04-15v4No1 / 884
171amnoncommon in soil with rice growth irrigation protocol (common united states of america, soil, state of california, depth 5cm)2017-07-25v4No1 / 890
146amnoncommon united states of america, rhizosphere, solanum lycopersicum, tomato, slit loam soil, ph 62017-04-20v4No1 / 894
479amnoncommon united states of america, rhizosphere, state of california, ph 6-7, ceanothus jepsonii2019-02-05v4No1 / 900
821sheryoCommon in soil of miscanthus field at 25-50cm depth, Michigan USA (common united states of america, soil, state of michigan, miscanthus, kalamazoo loam, mesic type hapludalf, kellogg biological station, depth 25-50cm, restored prairie)2021-08-02v4No1 / 901
801sheryoCommon in soybean and corn agriculture fields at depth 15-30cm, Iowa USA (common soil, zea mays, glycine max, iowa, agricultural field, united states, ames, des moines, nicollet soil series, depth 15-30cm, ph 7.4)2021-06-15v4No1 / 905
462amnoncommon united states of america, state of tennessee, rhizosphere, populus, tree, silt clay loam, depth 30-75cm, cultivated environment2019-01-13v4No1 / 908
609sheryoCommon in soil without tobacco plants amended with difenoconazole fungicide and biochar (common soil, ph 7-8, depth 0-20cm, limestone, biochar, fungicide, china, tobacco field, difenoconazole, without plants)2020-07-05v4No1 / 910
615amnon high in rhizosphere compared to endosphere root in brazil greenhouse campinas saccharum sugarcane 2020-04-27v4No1 / 913
609sheryoCommon in soil without tobacco plants amended with difenoconazole fungicide (common soil, ph 7-8, depth 0-20cm, limestone, fungicide, china, tobacco field, difenoconazole, without plants)2020-07-05v4No1 / 915
548amnoncommon rock, brazil, minas gerais state, campos rupestres2019-08-17v4No1 / 924
821sheryoHigher at 10-25cm depth compared to 0-10cm depth in soil in Michigan USA ( high in depth 10-25cm compared to depth 0-10cm in united states of america soil state of michigan corn panicum virgatum miscanthus kalamazoo loam mesic type hapludalf kellogg biological station restored prairie )2021-08-05v4No1 / 930
462amnoncommon united states of america, state of tennessee, soil, depth 0-30cm, silt loam, cultivated environment2019-01-13v4No1 / 938
444amnoncommon in uncultivated soil plot (common soil, nanjing city prefecture, yellow brown soil, china)2019-01-07v4No1 / 946
767sheryoCommon in soil planted with Chrysanthemum, amended with soil fumigant 'Dazomet' in Nanjing China (common soil, china, nanjing county, chrysanthemum, chrysanthemum morifolium ramat., ph 6.9, soil fumigation, dazomet)2021-04-14v4No1 / 946
37amnonlower in tomato plant leaves compared to plastic control ( high in control compared to solanum lycopersicum in leaf maryland county )2016-12-09v4No1 / 950
98amnoncommon rhizosphere, state of florida, citrus, quincy, fl, root2017-04-01v4No1 / 950
422amnoncommon soil, paddy field soil, oryza sativa, jiangsu province, cultivated environment, china2018-12-02v4No1 / 957
821sheryoCommon in soil of continuous corn field at 25-50cm depth, Michigan USA (common united states of america, soil, state of michigan, corn, continuous corn, kalamazoo loam, mesic type hapludalf, kellogg biological station, depth 25-50cm)2021-07-28v4No1 / 963
129amnoncommon soil, mexico, myrtillocactus geometrizans, opuntia robusta, cactus, semi-arid, root zone soil, ph 6-6.52017-04-15v4No1 / 968
821sheryoCommon in soil of restored prairie at 25-50cm depth, Michigan USA (common united states of america, soil, state of michigan, kalamazoo loam, mesic type hapludalf, kellogg biological station, depth 25-50cm, restored prairie)2021-07-28v4No1 / 968
480amnoncommon farm, pasture, soil, new zealand2019-02-05v4No1 / 970
134amnoncommon rhizosphere, temperate, tree, taxus, taxus mairei, northeast china, china2017-04-16v4No1 / 973
474amnoncommon farm, soil, glycine max, brazil, soybean, ph 4-6, cultivated environment2019-01-16v4No1 / 974
615amnoncommon rhizosphere, brazil, greenhouse, campinas, saccharum, sugarcane2020-04-27v4No1 / 974
821sheryoCommon in soil of switchgrass field at 25-50cm depth, Michigan USA (common united states of america, soil, state of michigan, panicum virgatum, kalamazoo loam, mesic type hapludalf, kellogg biological station, depth 25-50cm)2021-08-03v4No1 / 974
821sheryoCommon in soil of switchgrass field at 25-50cm depth, Michigan USA (common united states of america, soil, state of michigan, panicum virgatum, kalamazoo loam, mesic type hapludalf, kellogg biological station, depth 25-50cm)2021-08-03v4No1 / 974
675sheryoCommon in watermelon rhizosphere soil (common rhizosphere, ph 7, citrullus lanatus, china, co culture with wheat (triticum aestivum l.), un-inoculated)2028-02-22v4No1 / 980
462amnoncommon united states of america, state of tennessee, rhizosphere, populus, tree, depth 0-30cm, silt loam, cultivated environment2019-01-13v4No1 / 997
412amnon high in ph>5 compared to ph<5 in soil cambisol red soil zea mays triticum aestivum hunan province china 2018-11-26v4No1 / 1005
479amnoncommon united states of america, rhizosphere, state of california, ph 6-7, heteromeles arbutifolia2019-02-05v4No1 / 1006
801sheryoHigher at depth 0-15cm compared to depth 60-90cm in corn and soybean agriculture fields, Iowa USA ( high in depth 0-15cm compared to depth 60-90cm in soil zea mays glycine max iowa agricultural field united states des moines nicollet soil series kelley subsurface drainage )2021-06-16v4No1 / 1036
422amnoncommon soil, paddy field soil, oryza sativa, heilongjiang province, cultivated environment, china2018-12-02v4No1 / 1049
837sheryoCommon in soil after 10 years reforestation with Black locust trees at 100-300cm depth, shaanxi, China (common soil, silt loam, reforestation, china, shaanxi province, loess plateau, robinia pseudoacacia, depth 100-300cm, 10 years)2021-09-26v4No1 / 1061
837sheryoCommon in soil after 10 years reforestation with Black locust trees at 40-100cm depth, shaanxi, China (common soil, silt loam, reforestation, china, shaanxi province, loess plateau, robinia pseudoacacia, depth 40-100cm, 10 years)2021-09-26v4No1 / 1065
828sheryoCommon in gleysol soil of poplar plantation at 0-10cm depth, sihong, china (common soil, jiangsu province, depth 0-10cm, clay loam, ph 6-7, gleysol, china, sihong county, poplar, poplar plantation, chenwei forest)2021-08-25v4No1 / 1069
347amnon high in depth (soil) 20-30cm compared to depth 100-150cm depth 150-200cm in permafrost soil kingdom of norway svalbard archipelago 2018-07-15v4No1 / 1080
478amnoncommon farm, sediment, shrimp farm, china2019-02-19v4No1 / 1085
415amnoncommon orchard, soil, rhizosphere, brazil, citrus, cultivated environment2018-11-27v4No1 / 1091
414amnoncommon agricultural feature, soil, zea mays, glycine max, triticum aestivum, heilongjiang province, ph<6, black soil, mollisol, npk fertilizer, china2018-11-26v4No1 / 1105
101amnoncommon united states of america, vitis vinifera, state of new york, merlot, grapevine, root2017-04-03v4No1 / 1106
360amnonlower in leaf surface compared to soil in agave plants ( high in soil compared to leaf leaf surface in desert state of california mexico guanajuato agave )2018-08-21v4No1 / 1108
767sheryocommon in soil planted with Chrysanthemum, fertilized with bio-organic fertilizer, amended with soil fumigant 'Dazomet' and deep plough in Nanjing China (common soil, compost biofilter, pig manure, compost soil, paenibacillus, china, nanjing county, chrysanthemum, bio-organic fertilizer, conventional tillage, chrysanthemum morifolium ramat., ph 6.9, paenibacillus polymyxa, soil fumigation, dazomet, deep plough)2021-04-18v4No1 / 1109
824sheryocommon in soil after 0-9 years of grazing exclusion at 40-60cm depth, Ningxia china (common soil, china, depth 40-60cm, grazing exclusion, haplic calcisol, calci-orthic aridisol, ningxia province, yunwushan national natural grassland protection zone, 0-9 years of grazing exclusion)2021-08-08v4No1 / 1113
828sheryoCommon in gleysol soil of poplar plantation at 10-20cm depth, sihong, china (common soil, jiangsu province, clay loam, ph 6-7, gleysol, china, sihong county, poplar, depth 10-20cm, poplar plantation, chenwei forest)2021-08-25v4No1 / 1123
146amnon high in soil compared to rhizosphere in united states of america solanum lycopersicum tomato ph 6 slit loam 2017-04-20v4No1 / 1135
134amnoncommon rhizosphere, temperate, tree, taxus, taxus cuspidata, northeast china, china2017-04-16v4No1 / 1141
146amnoncommon united states of america, soil, solanum lycopersicum, tomato, slit loam soil, ph 62017-04-20v4No1 / 1144
422amnoncommon soil, paddy field soil, oryza sativa, heilongjiang province, ph 7-8, cultivated environment, china2018-12-04v4No1 / 1169
421amnoncommon soil, paddy field soil, zhejiang province, china2018-12-04v4No1 / 1194
801sheryoCommon at depth 0-15cm in corn and soybean agriculture fields, Iowa USA (common soil, zea mays, glycine max, iowa, agricultural field, united states, des moines, depth 0-15cm, nicollet soil series, kelley, ph 6.2, subsurface drainage)2021-06-15v4No1 / 1202
444amnonlower in continuously cropped strawberry soil ( high in age 1 year compared to age 5 years age 10 years continuous cropping in farm greenhouse soil rhizosphere fragaria x ananassa nanjing city prefecture strawberry yellow brown soil cultivated environment china )2019-01-07v4No1 / 1221
801sheryoCommon in soybean and corn agriculture fields at depth 0-15cm, Iowa USA (common soil, zea mays, glycine max, iowa, agricultural field, united states, ames, des moines, ph 7.5, depth 0-15cm, nicollet soil series)2021-06-15v4No1 / 1226
824sheryoCommon in soil after 27-35 years of grazing exclusion at 40-60cm depth, Ningxia china (common soil, china, depth 40-60cm, grazing exclusion, 27-35 years of grazing exclusion, haplic calcisol, calci-orthic aridisol, ningxia province, yunwushan national natural grassland protection zone)2021-08-08v4No1 / 1232
420amnoncommon in soil of vegetables in organic field (common agricultural feature, farm, soil, shanghai proper, ph>7, ph 7-8, clay loam, organic farming, cultivated environment, china)2018-12-02v4No1 / 1240
821sheryoCommon in soil of restored prairie at 10-25cm depth, Michigan USA (common united states of america, soil, state of michigan, kalamazoo loam, mesic type hapludalf, kellogg biological station, depth 10-25cm, restored prairie)2021-07-28v4No1 / 1241
837sheryoCommon in agricultural field at depths 40-100cm, shaanxi, China (common soil, zea mays, triticum aestivum, silt loam, agricultural field, china, shaanxi province, loess plateau, depth 40-100cm)2021-09-26v4No1 / 1263
675sheryoCommon in watermelon rhizosphere soil inoculated with Fusarium oxysporum f. sp. niveum (common rhizosphere, ph 7, citrullus lanatus, china, co culture with wheat (triticum aestivum l.), inoculated with fusarium oxysporum f. sp. niveum)2028-02-22v4No1 / 1271
824sheryoCommoon in soil after 0-9 years of grazing exclusion at 20-40cm depth, Ningxia china (common soil, china, grazing exclusion, haplic calcisol, calci-orthic aridisol, ningxia province, yunwushan national natural grassland protection zone, 0-9 years of grazing exclusion, depth 20-40cm)2021-08-08v4No1 / 1274
414amnoncommon agricultural feature, soil, zea mays, glycine max, triticum aestivum, heilongjiang province, ph>6, black soil, mollisol, china2018-11-26v4No1 / 1282
821sheryoCommon in soil of restored prairie at 0-10cm depth, Michigan USA (common united states of america, soil, state of michigan, depth 0-10cm, ph 6.5, kalamazoo loam, mesic type hapludalf, kellogg biological station, restored prairie)2021-07-28v4No1 / 1291
837sheryoCommon in soil at 0-40-100cm depth after 20 years reforestation with Black locust trees, shaanxi, China (common soil, silt loam, reforestation, china, shaanxi province, loess plateau, robinia pseudoacacia, depth 40-100cm, 20 years)2021-09-26v4No1 / 1294
266amnonCommon in soil from MAH garden (common united states of america, soil, state of idaho, ph 6)2017-12-18v4No1 / 1299
837sheryoCommon in soil at 40-100cm depth after 30 years reforestation with Black locust trees, shaanxi, China (common soil, silt loam, reforestation, china, shaanxi province, loess plateau, robinia pseudoacacia, depth 40-100cm, 30 years)2021-09-26v4No1 / 1311
101amnon high in rhizosphere compared to root in united states of america vitis vinifera state of new york merlot grapevine 2017-04-03v4No1 / 1315
837sheryoCommon in soil after 10 years reforestation with Black locust trees at 0-40cm depth, shaanxi, China (common soil, silt loam, reforestation, china, shaanxi province, loess plateau, robinia pseudoacacia, depth 0-40cm, 10 years)2021-09-26v4No1 / 1317
837sheryoCommon in soil at 100-300cm depth after 20 years reforestation with Black locust trees, shaanxi, China (common soil, silt loam, reforestation, china, shaanxi province, loess plateau, robinia pseudoacacia, depth 100-300cm, 20 years)2021-09-26v4No1 / 1317
837sheryoבCommon in soil at 0-40cm depth after 20 years reforestation with Black locust trees, shaanxi, China (common soil, silt loam, reforestation, china, shaanxi province, loess plateau, robinia pseudoacacia, depth 0-40cm, 20 years)2021-09-26v4No1 / 1323
600sheryoCommon in biochar ammended soil after 82 days (common united states of america, soil, state of new york, depth 0-5cm, ph 6, biochar, coarse-loamy soil, day 82)2020-03-27v4No1 / 1326
600sheryoCommon in stover ammended soil after 82 days (common united states of america, soil, state of new york, depth 0-5cm, ph 6, coarse-loamy soil, day 82, stover ammendment )2020-03-27v4No1 / 1327
259amnoncommon in soil and rhizpsphere of peanut plants (common soil, rhizosphere, arachis hypogaea, ph 5, peanut, china)2017-12-02v4No1 / 1334
98amnoncommon rhizosphere, state of florida, citrus, ft. pierce, fl, root2017-04-01v4No1 / 1340
837sheryoCommon in soil at 0-40 cm depth after 30 years reforestation with Black locust trees, shaanxi, China (common soil, silt loam, reforestation, china, shaanxi province, loess plateau, robinia pseudoacacia, depth 0-40cm, 30 years)2021-09-26v4No1 / 1346
837sheryoCommon in soil at 100-300cm depth after 30 years reforestation with Black locust trees, shaanxi, China (common soil, silt loam, reforestation, china, shaanxi province, loess plateau, robinia pseudoacacia, depth 100-300cm, 30 years)2021-09-26v4No1 / 1354
809amnoncommon research facility, rhizosphere, greenhouse, china, lu'an city prefecture, dendrobium huoshanense, flowerpot2021-06-20v4No1 / 1356
824sheryoCommon in soil after 27-35 years of grazing exclusion at 20-40cm depth, Ningxia china (common soil, china, grazing exclusion, 27-35 years of grazing exclusion, haplic calcisol, calci-orthic aridisol, ningxia province, yunwushan national natural grassland protection zone, depth 20-40cm)2021-08-08v4No1 / 1369
420amnoncommon in soil of vegetable open field (common agricultural feature, farm, soil, shanghai proper, ph>7, ph 7-8, npk fertilizer, clay loam, cultivated environment, china)2018-12-02v4No1 / 1376
821sheryoCommon in soil of miscanthus field at 10-25cm depth, Michigan USA (common united states of america, soil, state of michigan, miscanthus, kalamazoo loam, mesic type hapludalf, kellogg biological station, depth 10-25cm, restored prairie)2021-08-02v4No1 / 1377
821sheryoCommon in soil of continuous corn field at 0-10cm depth, Michigan USA (common united states of america, soil, state of michigan, depth 0-10cm, corn, ph 5.9, continuous corn, kalamazoo loam, mesic type hapludalf, kellogg biological station)2021-07-28v4No1 / 1380
821sheryoCommon in soil of switchgrass field at 10-25cm depth, Michigan USA (common united states of america, soil, state of michigan, panicum virgatum, kalamazoo loam, mesic type hapludalf, kellogg biological station, depth 10-25cm)2021-08-02v4No1 / 1387
600sheryoCommon in unammended soil after 82 days (common united states of america, soil, state of new york, depth 0-5cm, ph 6, coarse-loamy soil, day 82)2020-03-27v4No1 / 1395
788amnon high in soil compared to feces cherokia georgiana georgiana millipede in united states of america state of georgia mesocosm 2021-05-31v4No1 / 1395
420amnonhigh freq. in soil of vegetable in plastic tunnel (common agricultural feature, farm, soil, greenhouse soil, shanghai proper, ph>7, ph 7-8, npk fertilizer, clay loam, cultivated environment, china)2018-12-02v4No1 / 1396
422amnoncommon soil, paddy field soil, oryza sativa, hubei province, hunan province, cultivated environment, china2018-12-02v4No1 / 1399
76amnoncommon in non-seleniferous soil (common united states of america, soil, rhizosphere, state of florida, non-seleniferous)2017-02-28v4No1 / 1414
40amnoncommon soil, field soil, rhizosphere, nicotiana tabacum, china2016-12-09v4No1 / 1420
444amnoncommon farm, greenhouse soil, rhizosphere, fragaria x ananassa, nanjing city prefecture, age 1 year, strawberry, yellow brown soil, cultivated environment, china2019-01-07v4No1 / 1439
821sheryoCommon in soil of miscanthus field at 0-10cm depth, Michigan USA (common united states of america, soil, state of michigan, depth 0-10cm, miscanthus, kalamazoo loam, mesic type hapludalf, kellogg biological station, restored prairie)2021-07-28v4No1 / 1447
414amnon high in ph>6 compared to ph<6 npk fertilizer in agricultural feature soil zea mays glycine max triticum aestivum heilongjiang province black soil mollisol china 2018-11-26v4No1 / 1451
266amnoncommon in soil from JAM garden (common united states of america, soil, state of idaho, ph 5.5)2017-12-18v4No1 / 1456
686sheryoCommon in vanilla field soil infected with Fusarium oxysporum, fertilized with chemical fertilizer and had high Fusarium cumulative disease incidence (common wanning city, vanilla planifolia, ph 7.6, pot expreiment, soil from vanilla field, fusarium oxysporum f. sp. vanillae, chemical fertilization n,p,k, high fusarium cumulative disease incidence )2028-03-08v4No1 / 1456
271amnoncommon rhizosphere, glycine max, soybean, depth 0-20cm, china2018-01-09v4No1 / 1459
837sheryoCommon in agricultural field at depths 0-40cm, shaanxi, China (common soil, zea mays, triticum aestivum, silt loam, agricultural field, china, shaanxi province, loess plateau, depth 0-40cm)2021-09-26v4No1 / 1470
824sheryoCommon in soil after 27-35 years of grazing exclusion at 10-20cm depth, Ningxia china (common soil, china, grazing exclusion, 27-35 years of grazing exclusion, haplic calcisol, calci-orthic aridisol, ningxia province, yunwushan national natural grassland protection zone, depth 10-20cm)2021-08-08v4No1 / 1477
760sheryoCommon in rhizosphere soil of rice plants with NPK fertilization in a long term fertilization experiment (common soil, rhizosphere, oryza sativa, hunan province, npk fertilizer, china, qiyang county, quaternary red clay, ph 5.9, npk fertilization)2021-04-06v4No1 / 1491
760sheryoCommon in rhizosphere soil of rice plants without fertilization in a long term fertilization experiment (common soil, rhizosphere, oryza sativa, hunan province, china, qiyang county, quaternary red clay, no fertilization, ph 5.9)2021-04-06v4No1 / 1506
145amnoncommon united states of america, soil, rhizosphere, oryza sativa, rice, ph 5.62017-04-19v4No1 / 1515
600sheryolower in stover ammendment soil ( high in unamended soil compared to stover amended in united states of america soil state of new york depth 0-5cm ph 6 coarse-loamy soil day 82 )2020-03-27v4No1 / 1612
76amnonhigher in non-seleniferous soil compared to seleniferous soil ( high in non-seleniferous compared to selenium seleniferous in united states of america soil rhizosphere woodland area )2017-02-28v4No1 / 1621
608sheryoCommon in wheat field in China, amended and unamended biochar, unamended with nitrogen fertilizer (common soil, china, silty clay, triticum aestivum l. cv., xiaoyan no. 22)2020-04-20v4No1 / 1643
462amnon high in depth 0-30cm silt loam compared to silt clay loam detph 30-75cm in united states of america state of tennessee soil cultivated environment 2019-01-12v4No1 / 1648
821sheryoCommon in soil of continuous corn field at 10-25cm depth, Michigan USA (common united states of america, soil, state of michigan, corn, continuous corn, kalamazoo loam, mesic type hapludalf, kellogg biological station, depth 10-25cm)2021-07-28v4No1 / 1649
824sheryoCommon in soil after 27-35 years of grazing exclusion at 0-10cm depth, Ningxia china (common soil, depth 0-10cm, china, grazing exclusion, 27-35 years of grazing exclusion, haplic calcisol, calci-orthic aridisol, ningxia province, yunwushan national natural grassland protection zone)2021-08-08v4No1 / 1659
686sheryoCommon in vanilla field soil infected with Fusarium oxysporum, fertilized with fungal bio-fertilizer and had low Fusarium cumulative disease incidence (common wanning city, vanilla planifolia, ph 7.6, pot expreiment, soil from vanilla field, fusarium oxysporum f. sp. vanillae, low fusarium cumulative disease incidence , fungal enriched bio-fertilizer, trichoderma guizhouense njau 4742)2028-03-08v4No1 / 1661
760sheryoCommon in rhizosphere soil of rice plants with manure fertilization in a long term fertilization experiment (common soil, manured soil, rhizosphere, oryza sativa, hunan province, china, qiyang county, quaternary red clay, ph 5.9, manure fertilization)2021-04-06v4No1 / 1670
608sheryoCommon in wheat field in China, amended and unamended biochar, amended with nitrogen fertilizer (common soil, urea enriched soil, china, silty clay, triticum aestivum l. cv., xiaoyan no. 22)2020-04-20v4No1 / 1682
821sheryoHigher at 10-25cm depth compared to 25-50cm depth in soil in Michigan USA ( high in depth 10-25cm compared to depth 25-50cm in united states of america soil state of michigan corn panicum virgatum miscanthus kalamazoo loam mesic type hapludalf kellogg biological station restored prairie )2021-08-05v4No1 / 1704
686sheryoCommon in vanilla field soil infected with Fusarium oxysporum, fertilized with bacterial bio-fertilizer and had low Fusarium cumulative disease incidence (common wanning city, vanilla planifolia, ph 7.6, pot expreiment, soil from vanilla field, fusarium oxysporum f. sp. vanillae, bacterial enriched bio-fertilizer, bacillus amyloliquefaciens w19, low fusarium cumulative disease incidence )2028-03-08v4No1 / 1726
686sheryoCommon in vanilla field soil infected with Fusarium oxysporum, fertilized with organic fertilizer and had high Fusarium cumulative disease incidence (common wanning city, vanilla planifolia, ph 7.6, pot expreiment, soil from vanilla field, fusarium oxysporum f. sp. vanillae, high fusarium cumulative disease incidence , organic fertilizer- chicken manure compost)2028-03-08v4No1 / 1765
156amnoncommon soil, rhizosphere, brassica oleracea, brassica, china2017-07-27v4No1 / 1885
296amnoncommon agricultural feature, soil, winter, wheat, depth 0-20cm, north china plain, ph>4, ph<5, china2018-02-11v4No1 / 1886
155amnoncommon in soil tightly bound to wheat root (common soil, triticum aestivum, wheat, root, china)2017-07-02v4No1 / 1977
101amnoncommon united states of america, rhizosphere, vitis vinifera, state of new york, merlot, grapevine2017-04-03v4No1 / 1980
821sheryoCommon in soil of switchgrass field at 0-10cm depth, Michigan USA (common united states of america, soil, state of michigan, depth 0-10cm, panicum virgatum, kalamazoo loam, mesic type hapludalf, kellogg biological station)2021-08-02v4No1 / 2067
175amnoncommon in heavy metal contaminated soils in china (common soil, heavy metal, ph 7-9, china)2017-07-29v4No1 / 2133
296amnoncommon agricultural feature, soil, winter, wheat, depth 0-20cm, north china plain, ph>7, ph<8, china2018-02-11v4No1 / 2160
296amnoncommon agricultural feature, soil, winter, wheat, depth 0-20cm, north china plain, ph>6, ph<7, china2018-02-11v4No1 / 2223
296amnoncommon in wheat field soil (common agricultural feature, soil, winter, depth 5cm, wheat, north china plain, china)2018-02-11v4No1 / 2341
155amnoncommon in soil loosely bound to wheat root (common soil, rhizosphere, triticum aestivum, wheat, china)2017-07-02v4No1 / 2425
101amnoncommon united states of america, soil, vitis vinifera, state of new york, merlot, grapevine2017-04-03v4No1 / 2537
155amnoncommon in bulk soil in wheat field (common soil, bulk soil, triticum aestivum, wheat, china)2017-07-02v4No1 / 2594
296amnoncommon agricultural feature, soil, winter, wheat, depth 0-20cm, north china plain, ph>8, china2018-02-11v4No1 / 2646
357amnon high in ph>4.5 compared to ph<4.5 in soil topsoil depth 0-10cm moist tropical forest woodland area forest ecosystem 2018-08-18v4No1 / 2773
271amnoncommon soil, depth 0-20cm, china2018-01-09v4No1 / 2856
84amnoncommon fen, soil, peat soil, temperate grassland biome, flooded grassland biome, depth 20 cm, united kingdom2017-03-06v4No1 / 2866
166amnoncommon in river sediment (5cm) without mussels (common united states of america, river, sediment, freshwater biome, mississippi river, depth 5cm, upper mississippi river)2017-07-18v4No1 / 2877
155amnonlower in tightly bound root soil compared to loose soil and bulk soil ( high in bulk soil compared to root in soil triticum aestivum wheat china )2017-07-02v4No1 / 2933
422amnon high in ph 7-8 compared to ph 5-6 in soil paddy field soil oryza sativa heilongjiang province cultivated environment china 2018-12-04v4No1 / 3267
84amnoncommon fen, soil, peat soil, temperate grassland biome, flooded grassland biome, depth 5 cm, united kingdom2017-03-07v4No1 / 3434
296amnoncommon agricultural feature, soil, winter, wheat, depth 0-20cm, north china plain, ph>5, ph<6, china2018-02-11v4No1 / 3508
103amnonhigher in particle bound fraction compared to free floating bacteria in mississippi river ( high in particles compared to free floating in united states of america river aquatic biome fresh water mississippi river )2017-04-05v4No1 / 3559
837sheryoHigher in soil after 10 years reforestation with Black locust trees compared to agricultural feild, shaanxi, China ( high in reforestation robinia pseudoacacia 10 years compared to zea mays wheat agricultural field in soil silt loam china shaanxi province loess plateau )2021-09-26v4No1 / 3932
837sheryoHigher in soil after 30 years compared to 20 years of reforestation with Black locust trees, shaanxi, China ( high in 30 years compared to 20 years in soil silt loam reforestation china shaanxi province loess plateau robinia pseudoacacia )2021-09-27v4No1 / 3936
462amnon high in rhizosphere compared to root in united states of america state of tennessee populus tree cultivated environment 2019-01-13v4No1 / 4630
271amnon high in soil compared to rhizosphere glycine max soybean in depth 0-20cm china 2018-01-09v4No1 / 4853
837sheryoHigher in soil after 30 years compared to 10 years of reforestation with Black locust trees, shaanxi, China ( high in 30 years compared to 10 years in soil silt loam reforestation china shaanxi province loess plateau robinia pseudoacacia )2021-09-27v4No1 / 5245
837sheryoHigher in soil after 30 years reforestation with Black locust trees compared to agricultural feild, shaanxi, China ( high in reforestation robinia pseudoacacia 30 years compared to zea mays triticum aestivum agricultural field in soil silt loam china shaanxi province loess plateau )2021-09-27v4No1 / 5596
837sheryoHigher in soil after 20 years reforestation with Black locust trees compared agricultural feild, shaanxi, China ( high in reforestation robinia pseudoacacia 20 years compared to zea mays triticum aestivum agricultural field in soil silt loam china shaanxi province loess plateau )2021-09-26v4No1 / 5661
171amnonlower in roots compared to rhizosphere soil in rice ( high in soil rhizosphere compared to root in united states of america oryza sativa state of california rice )2017-07-25v4No1 / 7628
271amnon high in soil rhizosphere compared to root structure root in glycine max soybean depth 0-20cm china 2018-01-09v4No1 / 7954

Problems / suggestions? Please email info AT dbbact DOT org