Search result for sequence:
TACAGAGGGTGCAAACGTTGCTCGGATTTACTGGGCGTAAAGCGCGTGTAGGCGGACTCGCAAGTCGGTTGTGAAATCCCTGGGCTCAACCTAGGAACTGCATCCGAAACTGCTTGTCTTGAGTAATGGAGAGGGTGGCGGAATTCCCGG
common ontology terms
term enrichment score
TermScore
marine sediment0.470852
sediment0.391791
ocean0.350000
beach0.296296
pacific ocean0.255319
bodega bay0.208333
sea water0.188679
hawaii0.173913
state of california0.167742
zostera marina0.160000
marine eelgrass0.160000
sand0.137931
shore0.136364
brackish water0.136364
caspian sea0.136364
oil seep0.136364
north east pacific ocean0.136364
water0.097561
mangrove biome0.097561
mangrove swamp0.097561
sample depth 12-35cm0.095238
aerosol0.095238
LOWER IN sea water0.095238
santa cruz province0.095238
east china sea0.095238
san francisco bay0.095238
coral reef0.090909
depth 200m0.090909
monterey bay0.090909
lytechinus variegatus0.090909
depth 1000-2000m0.090909
LOWER IN water0.086957
florida0.080000
ocean water0.080000
air0.068966
china0.065217
root0.062500
diploastrea heliopora0.050000
tissue0.050000
delphinus delphis0.050000
sample depth 12-24cm0.050000
LOWER IN sample depth 24-35cm0.050000
portuguese republic0.050000
mangrove0.050000
avicennia germinans0.050000
rhizophora mangle0.050000
LOWER IN ocean water0.050000
yushan islands0.050000
LOWER IN other regions0.050000
clayoquot slope0.050000
depth 2000-3000m0.050000
endeavour0.050000
santa cruz county0.050000
depth 150-600m0.050000
sample depth 0-12cm0.050000
LOWER IN air0.050000
LOWER IN depth 2000-3000m0.050000
LOWER IN mucus0.048780
marine water body0.048780
digesta0.048780
coral0.047619
saline water0.047619
depth 20m0.047619
united states of america0.045762
state of florida0.045455
LOWER IN leaf0.045455
atlantic ocean0.044444
LOWER IN root0.042553
skin0.033898
rhizosphere0.030769
soil0.023529
research facility0.015625
feces0.009569
Fraction of dbbact annotations with this term covered by the query
TermScore
mangrove biome0.666667
mangrove swamp0.666667
marine sediment0.583333
hawaii0.500000
shore0.500000
diploastrea heliopora0.500000
tissue0.500000
delphinus delphis0.500000
brackish water0.500000
caspian sea0.500000
sample depth 12-35cm0.500000
sample depth 12-24cm0.500000
LOWER IN sample depth 24-35cm0.500000
portuguese republic0.500000
mangrove0.500000
avicennia germinans0.500000
rhizophora mangle0.500000
beach0.500000
aerosol0.500000
LOWER IN sea water0.500000
LOWER IN ocean water0.500000
bodega bay0.500000
santa cruz province0.500000
east china sea0.500000
yushan islands0.500000
LOWER IN other regions0.500000
oil seep0.500000
north east pacific ocean0.500000
clayoquot slope0.500000
san francisco bay0.500000
depth 2000-3000m0.500000
endeavour0.500000
santa cruz county0.500000
depth 150-600m0.500000
sample depth 0-12cm0.500000
LOWER IN air0.500000
LOWER IN depth 2000-3000m0.500000
sediment0.388889
ocean0.333333
coral reef0.333333
LOWER IN mucus0.333333
depth 200m0.333333
sea water0.333333
marine water body0.333333
monterey bay0.333333
digesta0.333333
lytechinus variegatus0.333333
zostera marina0.333333
marine eelgrass0.333333
depth 1000-2000m0.333333
coral0.250000
saline water0.250000
depth 20m0.250000
LOWER IN water0.250000
pacific ocean0.214286
sand0.200000
state of florida0.166667
florida0.166667
ocean water0.166667
LOWER IN leaf0.166667
atlantic ocean0.142857
state of california0.111111
LOWER IN root0.111111
air0.100000
water0.090909
root0.076923
skin0.047619
china0.041096
rhizosphere0.037037
united states of america0.024845
soil0.021277
research facility0.011111
feces0.005848
Fraction of annotations for the query sequences containing the term
TermScore
marine sediment0.394737
sediment0.394737
ocean0.368421
state of california0.342105
pacific ocean0.315789
united states of america0.289474
beach0.210526
china0.157895
sea water0.131579
bodega bay0.131579
hawaii0.105263
water0.105263
zostera marina0.105263
marine eelgrass0.105263
sand0.105263
shore0.078947
brackish water0.078947
caspian sea0.078947
nan'ao island0.078947
oil seep0.078947
north east pacific ocean0.078947
coral reef0.052632
depth 200m0.052632
sample depth 12-35cm0.052632
mangrove biome0.052632
mangrove swamp0.052632
air0.052632
aerosol0.052632
monterey bay0.052632
lytechinus variegatus0.052632
florida0.052632
LOWER IN water0.052632
LOWER IN sea water0.052632
ocean water0.052632
root0.052632
santa cruz province0.052632
east china sea0.052632
depth 1000-2000m0.052632
san francisco bay0.052632
coral0.026316
diploastrea heliopora0.026316
tissue0.026316
LOWER IN mucus0.026316
skin0.026316
delphinus delphis0.026316
sample depth 12-24cm0.026316
LOWER IN sample depth 24-35cm0.026316
atlantic ocean0.026316
saline water0.026316
marine water body0.026316
depth 20m0.026316
portuguese republic0.026316
soil0.026316
mangrove0.026316
state of florida0.026316
avicennia germinans0.026316
rhizophora mangle0.026316
digesta0.026316
feces0.026316
LOWER IN ocean water0.026316
yushan islands0.026316
LOWER IN other regions0.026316
pearl harbor0.026316
research facility0.026316
hydroides elegans0.026316
tubeworm0.026316
tubeworm tube0.026316
clayoquot slope0.026316
LOWER IN leaf0.026316
depth 2000-3000m0.026316
endeavour0.026316
santa cruz county0.026316
rhizosphere0.026316
depth 150-600m0.026316
sample depth 0-12cm0.026316
LOWER IN air0.026316
LOWER IN depth 2000-3000m0.026316
LOWER IN root0.026316
Exp. ID User ID Description Date Sequences
93amnonhigh freq. in marine sediment near the shore in hawaii (highfreq hawaii, shore, marine sediment)2017-03-121 / 7
418amnonhighfreq ocean, sediment, coral reef2018-12-021 / 10
418amnon high in tissue compared to mucus in ocean coral diploastrea heliopora 2018-12-021 / 44
79amnoncommon skin, united states of america, delphinus delphis2017-03-031 / 113
141amnonnegatively correlated with sample depth ( high in sample depth 12-24cm compared to sample depth 24-35cm in marine sediment brackish water sediment caspian sea depth 200m sample depth 12-35cm )2017-04-181 / 187
418amnoncommon ocean, sediment, coral reef2018-12-021 / 216
235amnoncommon in sediment near eelgrass in northern hemisphere (common sediment, marine sediment, ocean)2017-11-071 / 258
280amnoncommon atlantic ocean, saline water, sea water, marine water body, depth 20m, portuguese republic2018-01-251 / 259
282amnoncommon soil, mangrove biome, mangrove swamp, mangrove, united states of america, state of florida, avicennia germinans, rhizophora mangle2018-01-251 / 259
304amnoncommon united states of america, state of california, beach, pacific ocean, air, aerosol, monterey bay2018-03-121 / 263
65amnoncommon digesta, lytechinus variegatus, florida2017-02-171 / 298
93amnoncommon in seawater near the shore in hawaii (common hawaii, sea water, shore)2017-03-121 / 345
65amnoncommon feces, lytechinus variegatus, florida2017-02-171 / 376
504amnon high in sediment marine sediment compared to water sea water ocean water in china nan'ao island 2019-03-141 / 395
504amnoncommon china, nan'ao island, sediment, marine sediment2019-03-141 / 437
504amnoncommon china, nan'ao island, water, ocean water, sea water2019-03-141 / 452
236amnoncommon state of california, bodega bay, ocean, zostera marina, marine eelgrass, root2017-11-071 / 483
304amnoncommon united states of america, state of california, beach, pacific ocean, air, aerosol, santa cruz province2018-03-121 / 518
223amnon high in yushan islands compared to other regions in sediment marine sediment china ocean east china sea 2017-10-261 / 619
483amnoncommon hawaii, pearl harbor, research facility, hydroides elegans, tubeworm, united states of america, tubeworm tube2019-02-131 / 683
472amnoncommon ocean, sediment, oil seep, marine sediment, north east pacific ocean, pacific ocean, depth 1000-2000m, clayoquot slope2019-01-161 / 725
236amnon high in root compared to leaf in state of california bodega bay ocean zostera marina marine eelgrass 2017-11-071 / 819
304amnoncommon united states of america, state of california, beach, pacific ocean, sand, monterey bay2018-03-121 / 1038
93amnoncommon in marine sediment near the shore in hawaii (common hawaii, shore, marine sediment)2017-03-121 / 1151
236amnoncommon ocean, ocean water, state of california, pacific ocean, bodega bay, water2017-11-071 / 1156
304amnoncommon united states of america, state of california, beach, pacific ocean, water, sea water, san francisco bay2018-03-121 / 1166
472amnoncommon ocean, sediment, oil seep, marine sediment, north east pacific ocean, pacific ocean, depth 2000-3000m, endeavour2019-01-161 / 1205
223amnoncommon china, ocean, sediment, east china sea, marine sediment2017-10-261 / 1311
304amnoncommon united states of america, state of california, beach, pacific ocean, water, sea water, santa cruz county2018-03-121 / 1425
34amnoncommon in mangrove rhizosphere (common mangrove biome, mangrove swamp, rhizosphere, china)2016-12-061 / 1473
141amnoncommon marine sediment, brackish water, sediment, caspian sea, depth 150-600m, sample depth 0-12cm2017-04-181 / 1549
141amnoncommon marine sediment, brackish water, sediment, caspian sea, depth 200m, sample depth 12-35cm2017-04-181 / 1659
304amnoncommon united states of america, state of california, beach, pacific ocean, sand, san francisco bay2018-03-121 / 1799
304amnoncommon united states of america, state of california, beach, pacific ocean, sand, santa cruz province2018-03-121 / 1838
236amnoncommon state of california, bodega bay, ocean, zostera marina, marine eelgrass, sediment, marine sediment2017-11-071 / 1904
304amnonhigher in beach sand compared to sea water and sea spray ( high in sand compared to air water sea water in united states of america beach state of california pacific ocean )2018-03-121 / 2070
472amnon high in depth 1000-2000m compared to depth 2000-3000m in ocean sediment oil seep marine sediment north east pacific ocean pacific ocean 2019-01-161 / 2593
236amnon high in sediment marine sediment compared to root in state of california bodega bay ocean zostera marina marine eelgrass 2017-11-071 / 2745

Problems / suggestions? Please email info AT dbbact DOT org