Search result for sequence:
TACAGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGAGCGTAGGTGGCTTGATAAGTCAGATGTGAAATCCCCGGGCTTAACCTGGGAACTGCATCTGAAACTGTTAGGCTAGAGTAGGTGAGAGGGAAGTAGAATTTCAGG
common ontology terms
term enrichment score
TermScore
pacific ocean0.304850
sea water0.284024
state of california0.235925
canada0.196078
skin0.180723
nan'ao island0.163265
beach0.163265
water0.161435
african lion safari0.127660
red abalone0.127660
haliotis rufescens0.127660
captive0.123077
hokkaido0.120000
surface water0.113208
zoological garden0.109589
ocean0.109589
balaenoptera acutorostrata0.088889
minke whale0.088889
lagenorhynchus acutus0.088889
bactrian camel0.088889
camelus bactrianus0.088889
delphinus delphis0.088889
trichodesmium0.088889
starfish0.088889
patiria pectinifera0.088889
size 1-80um0.088889
philippine sea0.088889
aerosol0.088889
santa cruz province0.088889
bodega bay0.088889
chuquisaca department0.088889
forearm0.088889
coelomic fluid0.085106
particle bound0.085106
age 5-13 years0.085106
arm0.085106
bolivia0.081633
japan0.081081
rural community0.072727
city0.065217
air0.063492
wild0.061538
marine sediment0.057971
child0.049383
phocoena phocoena0.046512
harbor porpoise0.046512
harbor seal0.046512
phoca vitulina0.046512
pearl harbor0.046512
sargasso sea0.046512
reindeer0.046512
rangifer tarandus0.046512
eastern gray squirrel0.046512
sciurus carolinensis0.046512
wild horse0.046512
toronto zoo0.046512
south pacific ocean0.046512
north america0.046512
respiratory airway0.046512
exhaled air condensate0.046512
whale blow0.046512
LOWER IN atlantic ocean0.046512
LOWER IN asterias amurensis0.046512
camel0.046512
camelus dromedarius0.046512
LOWER IN fresh clover diet0.046512
clover hay diet0.046512
kelp forest0.046512
marine biome0.046512
algae0.046512
shell0.046512
LOWER IN size < 1um0.046512
santa cruz county0.046512
sediment0.045977
depth 1-2m0.045455
megaptera novaeangliae0.045455
humpback whale0.045455
monterey bay0.045455
foot0.045455
zostera marina0.045455
marine eelgrass0.045455
LOWER IN mouth mucosa0.045455
hawaii0.044444
equus przewalskii0.044444
early time points0.044444
LOWER IN late time points0.044444
depth 150m0.044444
LOWER IN marine sediment0.044444
LOWER IN free floating0.044444
egypt0.043478
LOWER IN sediment0.043478
sand0.043478
LOWER IN mouth0.041667
atlantic ocean0.040816
united states of america0.040558
rumen0.037736
root0.037037
australia0.035714
winter0.035714
LOWER IN feces0.035714
Fraction of dbbact annotations with this term covered by the query
TermScore
balaenoptera acutorostrata0.500000
minke whale0.500000
nan'ao island0.500000
lagenorhynchus acutus0.500000
bactrian camel0.500000
camelus bactrianus0.500000
african lion safari0.500000
canada0.500000
phocoena phocoena0.500000
harbor porpoise0.500000
delphinus delphis0.500000
harbor seal0.500000
phoca vitulina0.500000
pearl harbor0.500000
trichodesmium0.500000
sargasso sea0.500000
starfish0.500000
patiria pectinifera0.500000
reindeer0.500000
rangifer tarandus0.500000
eastern gray squirrel0.500000
sciurus carolinensis0.500000
wild horse0.500000
toronto zoo0.500000
south pacific ocean0.500000
north america0.500000
respiratory airway0.500000
exhaled air condensate0.500000
whale blow0.500000
LOWER IN atlantic ocean0.500000
size 1-80um0.500000
philippine sea0.500000
red abalone0.500000
haliotis rufescens0.500000
beach0.500000
aerosol0.500000
LOWER IN asterias amurensis0.500000
camel0.500000
camelus dromedarius0.500000
LOWER IN fresh clover diet0.500000
clover hay diet0.500000
kelp forest0.500000
marine biome0.500000
algae0.500000
santa cruz province0.500000
shell0.500000
bodega bay0.500000
chuquisaca department0.500000
forearm0.500000
LOWER IN size < 1um0.500000
santa cruz county0.500000
pacific ocean0.352941
depth 1-2m0.333333
hokkaido0.333333
coelomic fluid0.333333
megaptera novaeangliae0.333333
humpback whale0.333333
particle bound0.333333
monterey bay0.333333
foot0.333333
zostera marina0.333333
marine eelgrass0.333333
age 5-13 years0.333333
arm0.333333
LOWER IN mouth mucosa0.333333
sea water0.275862
hawaii0.250000
equus przewalskii0.250000
surface water0.250000
early time points0.250000
LOWER IN late time points0.250000
depth 150m0.250000
LOWER IN marine sediment0.250000
bolivia0.250000
LOWER IN free floating0.250000
state of california0.210526
egypt0.200000
LOWER IN sediment0.200000
sand0.200000
captive0.166667
rural community0.142857
LOWER IN mouth0.142857
water0.127660
zoological garden0.125000
ocean0.125000
atlantic ocean0.125000
skin0.120000
japan0.090909
air0.090909
wild0.083333
rumen0.083333
root0.076923
marine sediment0.071429
australia0.066667
winter0.066667
LOWER IN feces0.066667
city0.058824
LOWER IN summer0.058824
child0.050000
sediment0.043478
Fraction of annotations for the query sequences containing the term
TermScore
united states of america0.390244
skin0.365854
sea water0.292683
pacific ocean0.268293
state of california0.268293
water0.219512
canada0.121951
nan'ao island0.097561
china0.097561
zoological garden0.097561
captive0.097561
ocean0.097561
beach0.097561
african lion safari0.073171
city0.073171
hokkaido0.073171
japan0.073171
surface water0.073171
red abalone0.073171
haliotis rufescens0.073171
research facility0.073171
balaenoptera acutorostrata0.048780
minke whale0.048780
sediment0.048780
marine sediment0.048780
lagenorhynchus acutus0.048780
bactrian camel0.048780
camelus bactrianus0.048780
delphinus delphis0.048780
trichodesmium0.048780
starfish0.048780
coelomic fluid0.048780
wild0.048780
patiria pectinifera0.048780
particle bound0.048780
size 1-80um0.048780
philippine sea0.048780
air0.048780
aerosol0.048780
santa cruz province0.048780
bodega bay0.048780
homo sapiens0.048780
child0.048780
age 5-13 years0.048780
bolivia0.048780
rural community0.048780
chuquisaca department0.048780
arm0.048780
forearm0.048780
phocoena phocoena0.024390
harbor porpoise0.024390
harbor seal0.024390
phoca vitulina0.024390
hawaii0.024390
pearl harbor0.024390
depth 1-2m0.024390
sargasso sea0.024390
atlantic ocean0.024390
reindeer0.024390
rangifer tarandus0.024390
eastern gray squirrel0.024390
sciurus carolinensis0.024390
wild horse0.024390
equus przewalskii0.024390
toronto zoo0.024390
south pacific ocean0.024390
north america0.024390
megaptera novaeangliae0.024390
humpback whale0.024390
respiratory airway0.024390
exhaled air condensate0.024390
whale blow0.024390
LOWER IN atlantic ocean0.024390
early time points0.024390
LOWER IN late time points0.024390
feces0.024390
monterey bay0.024390
LOWER IN asterias amurensis0.024390
egypt0.024390
camel0.024390
camelus dromedarius0.024390
rumen0.024390
adult0.024390
diet0.024390
LOWER IN fresh clover diet0.024390
clover hay diet0.024390
kelp forest0.024390
marine biome0.024390
algae0.024390
australia0.024390
winter0.024390
LOWER IN summer0.024390
depth 150m0.024390
shell0.024390
foot0.024390
zostera marina0.024390
marine eelgrass0.024390
LOWER IN sediment0.024390
LOWER IN marine sediment0.024390
root0.024390
Exp. ID User ID Description Date Region Flag Sequences
79amnonhighfreq skin, united states of america, balaenoptera acutorostrata, minke whale2017-03-03v4No1 / 10
504amnonhighfreq nan'ao island, sediment, marine sediment, china2019-03-14v4No1 / 12
504amnonhighfreq nan'ao island, water, sea water, china2019-03-14v4No1 / 18
79amnonhighfreq skin, united states of america, lagenorhynchus acutus2017-03-03v4No1 / 18
565amnonhighfreq bactrian camel, camelus bactrianus, african lion safari, zoological garden, captive, canada, skin2019-11-21v3No1 / 20
79amnoncommon skin, united states of america, balaenoptera acutorostrata, minke whale2017-03-03v4No1 / 23
79amnoncommon skin, united states of america, phocoena phocoena, harbor porpoise2017-03-03v4No1 / 31
79amnonhighfreq skin, united states of america, delphinus delphis2017-03-03v4No1 / 36
79amnoncommon skin, united states of america, lagenorhynchus acutus2017-03-03v4No1 / 40
79amnoncommon skin, united states of america, harbor seal, phoca vitulina2017-03-03v4No1 / 49
483amnoncommon hawaii, pearl harbor, united states of america, water, sea water, depth 1-2m2019-02-13v4No1 / 72
136amnoncommon sea water, trichodesmium, ocean, sargasso sea, atlantic ocean2017-04-17v4No1 / 81
550amnoncommon city, hokkaido, starfish, coelomic fluid, wild, patiria pectinifera, japan2019-08-18v4No1 / 85
565amnoncommon african lion safari, reindeer, rangifer tarandus, zoological garden, captive, canada, skin2019-11-21v3No1 / 96
565amnoncommon eastern gray squirrel, sciurus carolinensis, canada, skin2019-11-21v3No1 / 104
565amnoncommon wild horse, equus przewalskii, toronto zoo, captive, zoological garden, canada, skin2019-11-21v3No1 / 112
79amnoncommon skin, united states of america, delphinus delphis2017-03-03v4No1 / 113
565amnoncommon bactrian camel, camelus bactrianus, african lion safari, zoological garden, captive, canada, skin2019-11-21v3No1 / 122
136amnoncommon sea water, trichodesmium, ocean, pacific ocean, south pacific ocean2017-04-17v4No1 / 125
209amnon high in pacific ocean compared to atlantic ocean in north america megaptera novaeangliae humpback whale respiratory airway exhaled air condensate whale blow 2017-10-15v4No1 / 219
505amnon high in early time points compared to late time points in water pacific ocean state of california surface water particle bound size 1-80um sea water 2019-03-16v4No1 / 223
342amnoncommon water, pacific ocean, philippine sea, surface water, sea water2018-05-28v4No1 / 236
308amnoncommon red abalone, haliotis rufescens, feces, united states of america, state of california, research facility2018-03-30v4No1 / 258
304amnoncommon united states of america, state of california, beach, pacific ocean, air, aerosol, monterey bay2018-03-12v4No1 / 263
550amnon high in patiria pectinifera compared to asterias amurensis in city hokkaido starfish coelomic fluid wild japan 2019-08-18v4No1 / 278
550amnoncommon city, hokkaido, sea water, japan2019-08-18v4No1 / 291
551amnon high in diet clover hay diet compared to fresh clover diet in egypt camel camelus dromedarius rumen adult 2019-08-27v3No1 / 291
77amnon high in winter compared to summer in kelp forest marine biome algae australia 2017-02-28v4No1 / 303
342amnoncommon water, pacific ocean, philippine sea, depth 150m, sea water2018-05-28v4No1 / 397
504amnoncommon nan'ao island, sediment, marine sediment, china2019-03-14v4No1 / 437
504amnoncommon nan'ao island, water, sea water, china2019-03-14v4No1 / 452
304amnoncommon united states of america, state of california, beach, pacific ocean, air, aerosol, santa cruz province2018-03-12v4No1 / 518
308amnoncommon red abalone, haliotis rufescens, united states of america, state of california, research facility, shell2018-03-30v4No1 / 579
308amnoncommon red abalone, haliotis rufescens, united states of america, state of california, research facility, foot2018-03-30v4No1 / 592
236amnon high in root compared to sediment marine sediment in state of california bodega bay ocean zostera marina marine eelgrass 2017-11-07v4No1 / 674
517amnon high in skin arm forearm compared to feces in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 836
517amnon high in skin arm forearm compared to mouth mucosa mouth in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 1014
236amnoncommon ocean, state of california, pacific ocean, bodega bay, water, sea water2017-11-07v4No1 / 1156
505amnon high in particle bound size 1-80um compared to free floating size < 1um in water pacific ocean state of california surface water sea water 2019-03-14v4No1 / 1218
304amnoncommon united states of america, state of california, beach, pacific ocean, water, sea water, santa cruz county2018-03-12v4No1 / 1425
304amnoncommon united states of america, state of california, beach, pacific ocean, sand, santa cruz province2018-03-12v4No1 / 1838

Problems / suggestions? Please email info AT dbbact DOT org