Search result for sequence:
TACAGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGAGCGTAGGTGGCTTGATAAGTCAGATGTGAAATCCCCGGGCTTAACCTGGGAACTGCATCTGAAACTGTTAGGCTAGAGTAGGTGAGAGGGAAGTAGAATTTCAGG
common ontology terms
term enrichment score
TermScore
pacific ocean0.300683
sea water0.280702
state of california0.233422
canada0.175439
skin0.169492
nan'ao island0.160000
beach0.160000
water0.153846
african lion safari0.125000
red abalone0.125000
haliotis rufescens0.125000
hokkaido0.117647
surface water0.111111
captive0.108108
ocean0.108108
zoological garden0.097561
balaenoptera acutorostrata0.086957
minke whale0.086957
lagenorhynchus acutus0.086957
camelus bactrianus0.086957
bactrian camel0.086957
delphinus delphis0.086957
trichodesmium0.086957
starfish0.086957
patiria pectinifera0.086957
size 1-80um0.086957
philippine sea0.086957
aerosol0.086957
santa cruz province0.086957
bodega bay0.086957
chuquisaca department0.086957
forearm0.086957
coelomic fluid0.083333
particle bound0.083333
age 5-13 years0.083333
arm0.083333
japan0.080000
bolivia0.080000
rural community0.066667
city0.062500
air0.062500
marine sediment0.057143
wild0.052632
united states of america0.047091
sediment0.045455
carcharhinus plumbeus0.045455
snadbar shark0.045455
phocoena phocoena0.045455
harbor porpoise0.045455
harbor seal0.045455
phoca vitulina0.045455
pearl harbor0.045455
sargasso sea0.045455
rangifer tarandus0.045455
reindeer0.045455
sciurus carolinensis0.045455
eastern gray squirrel0.045455
toronto zoo0.045455
wild horse0.045455
south pacific ocean0.045455
north america0.045455
respiratory airway0.045455
exhaled air condensate0.045455
whale blow0.045455
LOWER IN atlantic ocean0.045455
LOWER IN asterias amurensis0.045455
camel0.045455
camelus dromedarius0.045455
LOWER IN fresh clover diet0.045455
clover hay diet0.045455
kelp forest0.045455
marine biome0.045455
algae0.045455
shell0.045455
child0.045455
LOWER IN size < 1um0.045455
santa cruz county0.045455
depth 1-2m0.044444
megaptera novaeangliae0.044444
humpback whale0.044444
monterey bay0.044444
foot0.044444
zostera marina0.044444
marine eelgrass0.044444
LOWER IN mouth mucosa0.044444
hawaii0.043478
equus przewalskii0.043478
depth 150m0.043478
LOWER IN marine sediment0.043478
LOWER IN free floating0.043478
early time points0.042553
LOWER IN late time points0.042553
egypt0.042553
LOWER IN sediment0.042553
sand0.042553
LOWER IN mouth0.040816
atlantic ocean0.040000
rumen0.037037
state of florida0.035088
winter0.035088
Fraction of dbbact annotations with this term covered by the query
TermScore
balaenoptera acutorostrata0.500000
minke whale0.500000
nan'ao island0.500000
lagenorhynchus acutus0.500000
african lion safari0.500000
camelus bactrianus0.500000
bactrian camel0.500000
carcharhinus plumbeus0.500000
snadbar shark0.500000
phocoena phocoena0.500000
harbor porpoise0.500000
delphinus delphis0.500000
harbor seal0.500000
phoca vitulina0.500000
pearl harbor0.500000
trichodesmium0.500000
sargasso sea0.500000
starfish0.500000
patiria pectinifera0.500000
rangifer tarandus0.500000
reindeer0.500000
sciurus carolinensis0.500000
eastern gray squirrel0.500000
toronto zoo0.500000
wild horse0.500000
south pacific ocean0.500000
north america0.500000
respiratory airway0.500000
exhaled air condensate0.500000
whale blow0.500000
LOWER IN atlantic ocean0.500000
size 1-80um0.500000
philippine sea0.500000
red abalone0.500000
haliotis rufescens0.500000
beach0.500000
aerosol0.500000
LOWER IN asterias amurensis0.500000
camel0.500000
camelus dromedarius0.500000
LOWER IN fresh clover diet0.500000
clover hay diet0.500000
kelp forest0.500000
marine biome0.500000
algae0.500000
santa cruz province0.500000
shell0.500000
bodega bay0.500000
chuquisaca department0.500000
forearm0.500000
LOWER IN size < 1um0.500000
santa cruz county0.500000
pacific ocean0.352941
canada0.333333
depth 1-2m0.333333
hokkaido0.333333
coelomic fluid0.333333
megaptera novaeangliae0.333333
humpback whale0.333333
particle bound0.333333
monterey bay0.333333
foot0.333333
zostera marina0.333333
marine eelgrass0.333333
age 5-13 years0.333333
arm0.333333
LOWER IN mouth mucosa0.333333
sea water0.275862
hawaii0.250000
equus przewalskii0.250000
surface water0.250000
depth 150m0.250000
LOWER IN marine sediment0.250000
bolivia0.250000
LOWER IN free floating0.250000
state of california0.210526
early time points0.200000
LOWER IN late time points0.200000
egypt0.200000
LOWER IN sediment0.200000
sand0.200000
LOWER IN mouth0.142857
captive0.125000
ocean0.125000
atlantic ocean0.125000
water0.120000
skin0.111111
rural community0.111111
zoological garden0.100000
japan0.090909
air0.090909
rumen0.083333
marine sediment0.071429
state of florida0.066667
winter0.066667
root0.066667
LOWER IN feces0.062500
wild0.058824
australia0.058824
LOWER IN summer0.058824
Fraction of annotations for the query sequences containing the term
TermScore
united states of america0.404762
skin0.357143
sea water0.285714
pacific ocean0.261905
state of california0.261905
water0.214286
canada0.119048
nan'ao island0.095238
china0.095238
captive0.095238
zoological garden0.095238
ocean0.095238
beach0.095238
african lion safari0.071429
city0.071429
hokkaido0.071429
japan0.071429
surface water0.071429
red abalone0.071429
haliotis rufescens0.071429
research facility0.071429
balaenoptera acutorostrata0.047619
minke whale0.047619
sediment0.047619
marine sediment0.047619
lagenorhynchus acutus0.047619
camelus bactrianus0.047619
bactrian camel0.047619
delphinus delphis0.047619
trichodesmium0.047619
starfish0.047619
coelomic fluid0.047619
wild0.047619
patiria pectinifera0.047619
particle bound0.047619
size 1-80um0.047619
philippine sea0.047619
air0.047619
aerosol0.047619
santa cruz province0.047619
bodega bay0.047619
homo sapiens0.047619
child0.047619
age 5-13 years0.047619
bolivia0.047619
rural community0.047619
chuquisaca department0.047619
arm0.047619
forearm0.047619
digestive system0.023810
state of florida0.023810
carcharhinus plumbeus0.023810
snadbar shark0.023810
phocoena phocoena0.023810
harbor porpoise0.023810
harbor seal0.023810
phoca vitulina0.023810
hawaii0.023810
pearl harbor0.023810
depth 1-2m0.023810
sargasso sea0.023810
atlantic ocean0.023810
rangifer tarandus0.023810
reindeer0.023810
sciurus carolinensis0.023810
eastern gray squirrel0.023810
toronto zoo0.023810
equus przewalskii0.023810
wild horse0.023810
south pacific ocean0.023810
north america0.023810
megaptera novaeangliae0.023810
humpback whale0.023810
respiratory airway0.023810
exhaled air condensate0.023810
whale blow0.023810
LOWER IN atlantic ocean0.023810
early time points0.023810
LOWER IN late time points0.023810
feces0.023810
monterey bay0.023810
LOWER IN asterias amurensis0.023810
egypt0.023810
camel0.023810
camelus dromedarius0.023810
rumen0.023810
adult0.023810
diet0.023810
LOWER IN fresh clover diet0.023810
clover hay diet0.023810
kelp forest0.023810
marine biome0.023810
algae0.023810
australia0.023810
winter0.023810
LOWER IN summer0.023810
depth 150m0.023810
shell0.023810
foot0.023810
zostera marina0.023810
Exp. ID User ID Description Date Region Flag Sequences
79amnondominant skin, united states of america, balaenoptera acutorostrata, minke whale2017-03-03v4No1 / 10
504amnondominant nan'ao island, sediment, marine sediment, china2019-03-14v4No1 / 12
504amnondominant nan'ao island, water, sea water, china2019-03-14v4No1 / 18
79amnondominant skin, united states of america, lagenorhynchus acutus2017-03-03v4No1 / 18
565amnondominant skin, canada, captive, zoological garden, african lion safari, camelus bactrianus, bactrian camel2019-11-21v3No1 / 20
592amnoncommon united states of america, digestive system, state of florida, carcharhinus plumbeus, snadbar shark2020-02-18v1No1 / 20
79amnoncommon skin, united states of america, balaenoptera acutorostrata, minke whale2017-03-03v4No1 / 23
79amnoncommon skin, united states of america, phocoena phocoena, harbor porpoise2017-03-03v4No1 / 31
79amnondominant skin, united states of america, delphinus delphis2017-03-03v4No1 / 36
79amnoncommon skin, united states of america, lagenorhynchus acutus2017-03-03v4No1 / 40
79amnoncommon skin, united states of america, harbor seal, phoca vitulina2017-03-03v4No1 / 49
483amnoncommon hawaii, pearl harbor, united states of america, water, sea water, depth 1-2m2019-02-13v4No1 / 72
136amnoncommon sea water, trichodesmium, ocean, sargasso sea, atlantic ocean2017-04-17v4No1 / 81
550amnoncommon city, hokkaido, starfish, coelomic fluid, wild, patiria pectinifera, japan2019-08-18v4No1 / 85
565amnoncommon skin, canada, captive, zoological garden, rangifer tarandus, reindeer, african lion safari2019-11-21v3No1 / 96
565amnoncommon skin, canada, sciurus carolinensis, eastern gray squirrel2019-11-21v3No1 / 104
565amnoncommon skin, canada, zoological garden, captive, toronto zoo, equus przewalskii, wild horse2019-11-21v3No1 / 112
79amnoncommon skin, united states of america, delphinus delphis2017-03-03v4No1 / 113
565amnoncommon skin, canada, captive, zoological garden, african lion safari, camelus bactrianus, bactrian camel2019-11-21v3No1 / 122
136amnoncommon sea water, trichodesmium, ocean, pacific ocean, south pacific ocean2017-04-17v4No1 / 125
209amnon high in pacific ocean compared to atlantic ocean in north america megaptera novaeangliae humpback whale respiratory airway exhaled air condensate whale blow 2017-10-15v4No1 / 219
505amnon high in early time points compared to late time points in water pacific ocean state of california surface water particle bound size 1-80um sea water 2019-03-16v4No1 / 223
342amnoncommon water, pacific ocean, philippine sea, surface water, sea water2018-05-28v4No1 / 236
308amnoncommon red abalone, haliotis rufescens, feces, united states of america, state of california, research facility2018-03-30v4No1 / 258
304amnoncommon united states of america, state of california, beach, pacific ocean, air, aerosol, monterey bay2018-03-12v4No1 / 263
550amnon high in patiria pectinifera compared to asterias amurensis in city hokkaido starfish coelomic fluid wild japan 2019-08-18v4No1 / 278
550amnoncommon city, hokkaido, sea water, japan2019-08-18v4No1 / 291
551amnon high in diet clover hay diet compared to fresh clover diet in egypt camel camelus dromedarius rumen adult 2019-08-27v3No1 / 291
77amnon high in winter compared to summer in kelp forest marine biome algae australia 2017-02-28v4No1 / 303
342amnoncommon water, pacific ocean, philippine sea, depth 150m, sea water2018-05-28v4No1 / 397
504amnoncommon nan'ao island, sediment, marine sediment, china2019-03-14v4No1 / 437
504amnoncommon nan'ao island, water, sea water, china2019-03-14v4No1 / 452
304amnoncommon united states of america, state of california, beach, pacific ocean, air, aerosol, santa cruz province2018-03-12v4No1 / 518
308amnoncommon red abalone, haliotis rufescens, united states of america, state of california, research facility, shell2018-03-30v4No1 / 579
308amnoncommon red abalone, haliotis rufescens, united states of america, state of california, research facility, foot2018-03-30v4No1 / 592
236amnon high in root compared to sediment marine sediment in state of california bodega bay ocean zostera marina marine eelgrass 2017-11-07v4No1 / 674
517amnon high in skin arm forearm compared to feces in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 836
517amnon high in skin arm forearm compared to mouth mucosa mouth in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 1014
236amnoncommon ocean, state of california, pacific ocean, bodega bay, water, sea water2017-11-07v4No1 / 1156
505amnon high in particle bound size 1-80um compared to free floating size < 1um in water pacific ocean state of california surface water sea water 2019-03-14v4No1 / 1218
304amnoncommon united states of america, state of california, beach, pacific ocean, water, sea water, santa cruz county2018-03-12v4No1 / 1425
304amnoncommon united states of america, state of california, beach, pacific ocean, sand, santa cruz province2018-03-12v4No1 / 1838

Problems / suggestions? Please email info AT dbbact DOT org