Search result for sequence:
TACAGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCGCGTAGGCGGTTTGGTCAGTCGGATGTGAAAGCCCCGGGCTTAACCTGGGAATTGCATTCGATACTGCCAGACTAGAGTGTAGTAGAGGGAAGCGGAATTCCAGG
common ontology terms
Fraction of dbbact annotations with this term covered by the query
TermScore
spartina alterniflora0.666667
saline marsh0.500000
mangrove swamp0.500000
danzhou xinyinggang nature reserve0.500000
rhizophora stylosa0.500000
dongzhaigang national nature reserve0.500000
mudflat0.500000
futian national nature reserve0.500000
kandelia candel0.500000
leizhou nature reserve0.500000
low salinity0.333333
LOWER IN high salinity0.333333
hainan autonomous prefecture0.333333
mangrove0.333333
guangdong province0.333333
zhejiang province0.166667
depth 0-20cm0.142857
atlantic ocean0.125000
marine sediment0.071429
rhizosphere0.060606
sediment0.043478
china0.018868
soil0.015873
united states of america0.005000
Fraction of annotations for the query sequences containing the term
TermScore
china0.857143
mangrove swamp0.857143
soil0.714286
marine sediment0.714286
depth 0-20cm0.714286
mangrove0.428571
rhizosphere0.285714
spartina alterniflora0.285714
hainan autonomous prefecture0.285714
kandelia candel0.285714
guangdong province0.285714
leizhou nature reserve0.285714
saline marsh0.142857
united states of america0.142857
atlantic ocean0.142857
sediment0.142857
low salinity0.142857
LOWER IN high salinity0.142857
danzhou xinyinggang nature reserve0.142857
rhizophora stylosa0.142857
dongzhaigang national nature reserve0.142857
mudflat0.142857
zhejiang province0.142857
futian national nature reserve0.142857

Problems / suggestions? Please email info AT dbbact DOT org