Search result for sequence:
TACAGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCGCGTAGGTGGTTCGTTAAGTTGGATGTGAAATCCCCGGGCTCAACCTGGGAACTGCATTCAAAACTGACGAGCTAGAGTATGGTAGAGGGTGGTGGAATTTCCTG
common ontology terms
term enrichment score
TermScore
soil0.209072
skin0.188795
united states of america0.183332
ant0.180832
china0.143132
pacific ocean0.131972
homo sapiens0.126074
costa rica0.124533
ocean0.118153
larval stage0.106253
stomach0.104928
canada0.095828
rhizosphere0.091646
calvert island0.088531
alga0.088531
province of british columbia0.084778
sweden0.077220
italy0.071006
germany0.068966
child0.067002
research facility0.066621
digestive system0.065005
adult0.060553
feces0.058820
depth 0-20cm0.056566
saliva0.053480
intestine0.052356
agricultural field0.050633
sea water0.049165
whole body0.049080
body proper0.048290
water0.044818
state of texas0.044693
infant0.041044
state of california0.039920
united kingdom0.038986
fungus growing ant0.038217
cambridgeshire0.038217
newt0.037500
depth 0-10cm0.037325
fish0.036364
panama0.036145
triticum aestivum0.033684
state of idaho0.033543
topsoil0.032720
bird0.032454
israel0.030710
wheat0.030281
zea mays0.029106
australia0.028484
cat0.027888
felis catus0.027132
orchard0.025974
forested area0.025974
army ant0.025806
gaster0.025806
ceratitis capitata0.025806
mediterranean fruit fly0.025806
food product type0.025806
ph 7.60.025806
united states0.025806
des moines0.025806
nicollet soil series0.025806
reforestation0.025806
shaanxi province0.025806
robinia pseudoacacia0.025806
low sodicity0.025806
songnen plain0.025806
da'an station0.025806
salic solonetz0.025806
mucosa0.025641
french republic0.025559
iowa0.025478
loess plateau0.025478
plant0.025157
low salinity0.025157
root0.024845
silt loam0.024540
new york city0.024242
winter0.023810
sediment0.023669
LOWER IN control0.022472
paranasal sinus0.021716
sinusoidal space0.021716
pseudomyrmex flavicornis0.021598
pseudomyrmex spinicola0.021598
nile tilapia0.021598
lissotriton vulgaris0.021598
pet0.021598
brassicaceae0.021598
boechera stricta0.021598
lushan mountain0.021598
grazing exclusion0.021598
haplic calcisol0.021598
calci-orthic aridisol0.021598
ningxia province0.021598
yunwushan national natural grassland protection zone0.021598
tree0.021482
frog0.021444
ph 7-80.021444
Fraction of dbbact annotations with this term covered by the query
TermScore
wheat0.750000
bronchus0.666667
paranasal sinus0.666667
sinusoidal space0.666667
orchard0.666667
tursiops truncatus0.666667
delphinus delphis0.666667
hen0.666667
portuguese republic0.666667
LOWER IN subtropical0.666667
heavy metal0.666667
depth 4000m0.666667
forested area0.666667
agricultural field0.571429
ant0.500000
pseudomyrmex flavicornis0.500000
LOWER IN resistant starch type 4 diet0.500000
metabolic syndrome x0.500000
state of rhode island0.500000
ginger0.500000
steno bredanensis0.500000
rough-toothed dolphin0.500000
LOWER IN atopic dermatitis0.500000
LOWER IN allergy0.500000
linepithema humile0.500000
argentine ant0.500000
catfish0.500000
pseudomyrmex spinicola0.500000
pheidole0.500000
pseudomyrmex nigropilosus0.500000
pseudomyrmex cubaensis0.500000
peponocephala electra0.500000
quail0.500000
coturnix coturnix0.500000
eciton burchellii0.500000
army ant0.500000
gaster0.500000
labidus praedator0.500000
neivamyrmex0.500000
ceratitis capitata0.500000
annona cherimola0.500000
mediterranean fruit fly0.500000
pseudomyrmex gracilis0.500000
pseudomyrmex elongatus0.500000
globicephala macrorhynchus0.500000
short finned pilot whale0.500000
freshwater river biome0.500000
yangtze river0.500000
coreius guichenoti0.500000
largemouth bronze gudgeon0.500000
sinusitis0.500000
fungus growing ant0.500000
atta sexdens0.500000
nile tilapia0.500000
sericomyrmex amabilis0.500000
apterostigma dentigerum0.500000
myrmicocrypta ednaella0.500000
citrus sinensis0.500000
orange0.500000
cambridgeshire0.500000
lissotriton vulgaris0.500000
triturus cristatus0.500000
cyphomyrmex costatus0.500000
harbor seal0.500000
phoca vitulina0.500000
bottlenosed dolphin0.500000
boston0.500000
train0.500000
pet0.500000
serinus canaria0.500000
canary0.500000
atta cephalotes0.500000
pseudomyrmex nigrocinctus0.500000
pseudomyrmex pallidus0.500000
clay soil0.500000
neve yaar0.500000
atta colombica0.500000
outdoor0.500000
food product type0.500000
medicago sativa0.500000
alfalfa sprouts0.500000
producer c10.500000
commune of paris0.500000
la rioja province0.500000
lower back0.500000
indoor0.500000
office0.500000
carnivorous beetle0.500000
raba river0.500000
bembidion punctulatum0.500000
skin of face0.500000
skin under eyes0.500000
small size0.500000
LOWER IN large size0.500000
LOWER IN medium size0.500000
stratovolcano0.500000
snow0.500000
mycocepurus smithii0.500000
stenella longirostris0.500000
spinner dolphin0.500000
Fraction of annotations for the query sequences containing the term
TermScore
united states of america0.322296
soil0.163355
homo sapiens0.145695
china0.139073
skin0.121413
costa rica0.110375
ant0.110375
pacific ocean0.079470
stomach0.072848
ocean0.072848
larval stage0.070640
research facility0.064018
canada0.064018
feces0.061810
rhizosphere0.057395
adult0.055188
province of british columbia0.048565
calvert island0.048565
alga0.048565
child0.044150
sweden0.044150
digestive system0.039735
italy0.039735
germany0.039735
saliva0.037528
intestine0.033113
depth 0-20cm0.030905
sea water0.028698
body proper0.026490
state of texas0.026490
whole body0.026490
water0.026490
agricultural field0.026490
state of california0.022075
united kingdom0.022075
infant0.022075
fish0.019868
panama0.019868
fungus growing ant0.019868
cambridgeshire0.019868
newt0.019868
depth 0-10cm0.019868
bird0.017660
israel0.017660
state of idaho0.017660
triticum aestivum0.017660
topsoil0.017660
felis catus0.015453
cat0.015453
LOWER IN control0.015453
caecum0.015453
australia0.015453
zea mays0.015453
wheat0.015453
control0.013245
army ant0.013245
gaster0.013245
ceratitis capitata0.013245
mediterranean fruit fly0.013245
mucosa0.013245
orchard0.013245
new york city0.013245
food product type0.013245
french republic0.013245
plant0.013245
winter0.013245
sediment0.013245
root0.013245
ph 7.60.013245
forested area0.013245
iowa0.013245
united states0.013245
des moines0.013245
nicollet soil series0.013245
silt loam0.013245
reforestation0.013245
shaanxi province0.013245
loess plateau0.013245
robinia pseudoacacia0.013245
low salinity0.013245
low sodicity0.013245
songnen plain0.013245
da'an station0.013245
salic solonetz0.013245
pseudomyrmex flavicornis0.011038
contamination0.011038
pseudomyrmex spinicola0.011038
colon0.011038
paranasal sinus0.011038
sinusoidal space0.011038
oreochromis niloticus0.011038
nile tilapia0.011038
kingdom of spain0.011038
cultivated environment0.011038
lissotriton vulgaris0.011038
mexico0.011038
pet0.011038
drinking water0.011038
frog0.011038
nasal cavity0.011038
Exp. ID User ID Description Date Region Flag Sequences
408amnon high in stomach compared to larval stage in united states of america costa rica ant pseudomyrmex flavicornis 2018-11-22v4No1 / 1
408amnoncommon united states of america, stomach, costa rica, camponotus, ant2018-11-22v4No1 / 2
408amnoncommon united states of america, larval stage, costa rica, camponotus, ant2018-11-22v4No1 / 3
487amnonlower in metabolic syndrome patients following resistant starch diet compared to control flour diet ( high in control diet compared to starch diet resistant starch type 4 diet in feces homo sapiens united states of america metabolic syndrome x metabolic syndrome )2019-02-24v4No1 / 3
311amnondominant united states of america, state of rhode island, ginger, foodon product type2018-04-09v4No1 / 4
79amnondominant united states of america, skin, steno bredanensis, rough-toothed dolphin2017-03-03v4No1 / 4
87amnonhigher in controls compared to lung and oral (contamination)2017-03-07v4No1 / 5
158amnonhigh in skin of healthy cats compared to cats with skin allergy ( high in control compared to atopic dermatitis allergy in united states of america skin felis catus cat )2017-07-05v4No1 / 5
182amnondominant body proper, argentina, linepithema humile, argentine ant2017-08-15v4No1 / 5
255amnondominant digestive system, united states of america, research facility, ictalurus punctatus, state of minnesota, catfish, channel catfish2017-11-24v4No1 / 5
408amnondominant united states of america, stomach, costa rica, ant, pseudomyrmex spinicola2018-11-22v4No1 / 5
408amnon high in stomach compared to larval stage in united states of america costa rica ant pseudomyrmex spinicola 2018-11-22v4No1 / 5
408amnoncommon united states of america, stomach, costa rica, ant, pheidole2018-11-22v4No1 / 5
408amnondominant united states of america, stomach, costa rica, ant, pseudomyrmex nigropilosus2018-11-22v4No1 / 5
408amnondominant united states of america, stomach, costa rica, ant, pseudomyrmex cubaensis2018-11-22v4No1 / 5
79amnondominant united states of america, skin, peponocephala electra2017-03-03v4No1 / 5
52amnondominant homo sapiens, nipple, skin, state of california2017-01-19v4No1 / 6
108amnondominant united states of america, research facility, colon, state of texas, quail, coturnix coturnix2017-04-07v4No1 / 6
183amnoncommon stomach, eciton burchellii, army ant, gaster2017-08-15v4No1 / 6
183amnoncommon stomach, army ant, gaster, labidus praedator2017-08-15v4No1 / 6
408amnondominant united states of america, stomach, costa rica, eciton, ant2018-11-22v4No1 / 6
52amnoncommon homo sapiens, nipple, skin, state of california2017-01-19v4No1 / 7
182amnoncommon body proper, argentina, linepithema humile, argentine ant2017-08-15v4No1 / 7
182amnondominant united states of america, body proper, linepithema humile, argentine ant2017-08-15v4No1 / 7
183amnoncommon stomach, army ant, gaster, neivamyrmex2017-08-15v4No1 / 7
346amnonhigh freq. in fruitfly larva grown on annona (dominant larval stage, body proper, ceratitis capitata, italy, whole body, annona cherimola, mediterranean fruit fly)2018-06-11v4No1 / 7
408amnoncommon united states of america, larval stage, costa rica, ant, pseudomyrmex gracilis2018-11-22v4No1 / 7
408amnoncommon united states of america, stomach, costa rica, ant, pseudomyrmex flavicornis2018-11-22v4No1 / 7
408amnondominant united states of america, stomach, costa rica, ant, pseudomyrmex flavicornis2018-11-22v4No1 / 7
408amnondominant united states of america, stomach, costa rica, ant, pseudomyrmex elongatus2018-11-22v4No1 / 7
408amnondominant united states of america, larval stage, costa rica, ant, pseudomyrmex elongatus2018-11-22v4No1 / 7
408amnondominant united states of america, larval stage, costa rica, ant, pseudomyrmex cubaensis2018-11-22v4No1 / 7
79amnondominant united states of america, skin, globicephala macrorhynchus, short finned pilot whale2017-03-03v4No1 / 7
115amnondominant freshwater river biome, intestine, yangtze river, coreius guichenoti, largemouth bronze gudgeon, fish, china2017-04-10v4No1 / 8
182amnoncommon united states of america, body proper, linepithema humile, argentine ant2017-08-15v4No1 / 8
228amnonhigher in chronic sinositis compared to healthy controls in sinus brushing ( high in sinusitis compared to control in homo sapiens united states of america mucosa paranasal sinus sinusoidal space )2017-10-31v4No1 / 8
235amnoncommon in ocean water above eelgrass from various northern hemisphere sites (common water, sea water)2017-11-07v4No1 / 8
397amnoncommon digestive system, intestine, panama, fungus growing ant, atta sexdens2018-11-14v4No1 / 8
408amnoncommon united states of america, stomach, costa rica, ant, pseudomyrmex gracilis2018-11-22v4No1 / 8
408amnoncommon united states of america, stomach, costa rica, crematogaster, ant2018-11-22v4No1 / 8
408amnondominant united states of america, larval stage, costa rica, crematogaster, ant2018-11-22v4No1 / 8
408amnoncommon united states of america, larval stage, costa rica, ant, pseudomyrmex cubaensis2018-11-22v4No1 / 8
108amnondominant united states of america, research facility, caecum, oreochromis niloticus, state of texas, nile tilapia2017-04-07v4No1 / 9
235amnonhigh freq. in ocean water above eelgrass from various northern hemisphere sites (dominant water, sea water)2017-11-07v4No1 / 9
397amnondominant digestive system, intestine, panama, fungus growing ant, sericomyrmex amabilis2018-11-14v4No1 / 9
397amnoncommon digestive system, intestine, panama, fungus growing ant, apterostigma dentigerum2018-11-14v4No1 / 9
397amnondominant digestive system, intestine, panama, fungus growing ant, myrmicocrypta ednaella2018-11-14v4No1 / 9
408amnondominant united states of america, stomach, costa rica, ant, pheidole2018-11-22v4No1 / 9
408amnoncommon united states of america, stomach, costa rica, eciton, ant2018-11-22v4No1 / 9
415amnondominant orchard, soil, rhizosphere, kingdom of spain, citrus, cultivated environment2018-11-27v4No1 / 9
58amnondominant homo sapiens, conjunctiva, new york city2017-02-02v4No1 / 10
177amnonblooming bacteria (grows in storage at room temp.) (contamination)2017-07-30v4No1 / 10
346amnoncommon in fruitfly larva grown on orange (common larval stage, body proper, citrus sinensis, ceratitis capitata, italy, whole body, orange, mediterranean fruit fly)2018-06-11v4No1 / 10
353amnonhigh freq. in wild Lissotriton vulgaris newts skin (dominant skin, adult, cambridgeshire, newt, lissotriton vulgaris, united kingdom)2018-07-30v4No1 / 10
353amnonhigh freq. in wild Triturus cristatus newts skin (dominant skin, adult, cambridgeshire, newt, triturus cristatus, united kingdom)2018-07-30v4No1 / 10
397amnoncommon digestive system, intestine, panama, fungus growing ant, cyphomyrmex costatus2018-11-14v4No1 / 10
408amnoncommon united states of america, stomach, costa rica, ant, pseudomyrmex elongatus2018-11-22v4No1 / 10
408amnoncommon united states of america, larval stage, costa rica, ant, pseudomyrmex elongatus2018-11-22v4No1 / 10
408amnoncommon united states of america, stomach, costa rica, ant, pseudomyrmex cubaensis2018-11-22v4No1 / 10
79amnondominant united states of america, skin, harbor seal, phoca vitulina2017-03-03v4No1 / 10
79amnondominant united states of america, skin, tursiops truncatus, bottlenosed dolphin2017-03-03v4No1 / 10
183amnondominant stomach, eciton burchellii, army ant, gaster2017-08-15v4No1 / 11
195amnonhigh freq. in boston subway surfaces (dominant city, urban biome, boston, train)2017-09-07v4No1 / 11
228amnonhigh freq. in sinus brush of healthy participants (dominant homo sapiens, united states of america, mucosa, paranasal sinus, sinusoidal space)2017-10-31v4No1 / 11
302amnonhigh freq. in feces of canary pet birds (dominant feces, mexico, bird, pet, serinus canaria, canary)2018-03-05v4No1 / 11
346amnoncommon in fruitfly larva grown on annona (common larval stage, body proper, ceratitis capitata, italy, whole body, annona cherimola, mediterranean fruit fly)2018-06-11v4No1 / 11
397amnondominant digestive system, intestine, panama, fungus growing ant, atta cephalotes2018-11-14v4No1 / 11
408amnondominant united states of america, stomach, costa rica, ant, pseudomyrmex nigrocinctus2018-11-22v4No1 / 11
408amnoncommon united states of america, larval stage, costa rica, ant, pseudomyrmex nigrocinctus2018-11-22v4No1 / 11
408amnoncommon united states of america, stomach, costa rica, ant, pseudomyrmex spinicola2018-11-22v4No1 / 11
408amnoncommon united states of america, stomach, costa rica, ant, pseudomyrmex nigropilosus2018-11-22v4No1 / 11
408amnoncommon united states of america, larval stage, costa rica, ant, pseudomyrmex pallidus2018-11-22v4No1 / 11
408amnondominant united states of america, larval stage, costa rica, ant, pseudomyrmex pallidus2018-11-22v4No1 / 11
662amnondominant soil, israel, depth 0-10cm, irrigated, agricultural field, clay soil, neve yaar2020-09-21v3No1 / 11
108amnoncommon united states of america, research facility, caecum, oreochromis niloticus, state of texas, nile tilapia2017-04-07v4No1 / 12
397amnondominant digestive system, intestine, panama, fungus growing ant, atta colombica2018-11-14v4No1 / 12
408amnondominant united states of america, larval stage, costa rica, cephalotes, ant2018-11-22v4No1 / 12
408amnondominant united states of america, stomach, costa rica, ant, pseudomyrmex gracilis2018-11-22v4No1 / 12
408amnoncommon united states of america, stomach, costa rica, ant, pseudomyrmex nigrocinctus2018-11-22v4No1 / 12
408amnondominant united states of america, larval stage, costa rica, ant, pseudomyrmex flavicornis2018-11-22v4No1 / 12
408amnondominant united states of america, larval stage, costa rica, ant, pseudomyrmex nigropilosus2018-11-22v4No1 / 12
460amnonhigh freq. in outdoor air (dominant united states of america, air, state of california, outdoor)2019-01-12v4No1 / 12
587amnondominant israel, food product type, medicago sativa, alfalfa sprouts, producer c12020-02-10v3No1 / 12
596amnondominant homo sapiens, saliva, child, sweden, 12-month-old human stage2020-03-17v3No1 / 12
691amnondominant water, drinking water, french republic, commune of paris2028-03-11v3No1 / 12
727amnondominant body proper, kingdom of spain, whole body, tick, la rioja province, ixodes ricinus2021-01-03v3No1 / 12
35amnondominant homo sapiens, hospital, dense settlement biome, breast milk, tanzania2016-12-06v4No1 / 13
158amnondominant united states of america, lower back, felis catus, cat2017-07-06v4No1 / 13
408amnondominant united states of america, stomach, costa rica, crematogaster, ant2018-11-22v4No1 / 13
460amnonhigh freq. in occupied office air (dominant united states of america, air, state of california, indoor, office)2019-01-12v4No1 / 13
515amnondominant river, poland, whole body, beetle, carnivorous beetle, raba river, bembidion punctulatum2019-04-18v4No1 / 13
58amnondominant homo sapiens, skin of face, new york city, skin under eyes2017-02-02v4No1 / 14
115amnonlower in medium and large size fish compared to small size ( high in small size compared to large size medium size in freshwater river biome intestine yangtze river coreius guichenoti largemouth bronze gudgeon fish china )2017-04-10v4No1 / 14
183amnondominant stomach, army ant, gaster, labidus praedator2017-08-15v4No1 / 14
183amnondominant stomach, army ant, gaster, neivamyrmex2017-08-15v4No1 / 14
224amnondominant united states of america, glacier, snow field, stratovolcano, state of oregon, snow2017-10-26v4No1 / 14
229amnoncommon in sinuses from chronic rhinosinositis patients (common homo sapiens, paranasal sinus, sinusoidal space, australia, sinusitis)2017-10-31v4No1 / 14
397amnoncommon digestive system, intestine, panama, fungus growing ant, mycocepurus smithii2018-11-14v4No1 / 14
408amnondominant united states of america, larval stage, costa rica, ant, pseudomyrmex spinicola2018-11-22v4No1 / 14
79amnondominant united states of america, skin, stenella longirostris, spinner dolphin2017-03-03v4No1 / 14
596amnondominant homo sapiens, saliva, infant, child, sweden, 6-month-old human stage2020-03-17v3No1 / 14
596amnondominant homo sapiens, saliva, child, sweden, 2-year-old human stage2020-03-17v3No1 / 14
596amnondominant homo sapiens, saliva, child, sweden, 3-month-old human stage2020-03-17v3No1 / 14
58amnondominant homo sapiens, new york city, contact lens2017-02-02v4No1 / 15
228amnonhigh freq. in sinus brush of sinusitis patients (dominant homo sapiens, united states of america, mucosa, paranasal sinus, sinusoidal space, sinusitis)2017-10-31v4No1 / 15
346amnoncommon in fruitfly larva grown on figs (common larval stage, body proper, ceratitis capitata, italy, whole body, ficus carica, fig, mediterranean fruit fly)2018-06-11v4No1 / 15
346amnoncommon in fruitfly larva grown on peach (common larval stage, body proper, prunus persica, ceratitis capitata, italy, whole body, peach, mediterranean fruit fly)2018-06-11v4No1 / 15
408amnoncommon united states of america, larval stage, costa rica, ant, pseudomyrmex flavicornis2018-11-22v4No1 / 15
408amnondominant united states of america, larval stage, costa rica, ant, pseudomyrmex viduus2018-11-22v4No1 / 15
79amnondominant united states of america, skin, balaenoptera physalus, fin whale2017-03-03v4No1 / 15
79amnoncommon united states of america, skin, tursiops truncatus, bottlenosed dolphin2017-03-03v4No1 / 15
133amnoncommon in infants 0-1 years (common homo sapiens, nasopharynx, infant, australia)2017-04-16v4No1 / 16
408amnoncommon united states of america, larval stage, costa rica, cephalotes, ant2018-11-22v4No1 / 16
79amnondominant united states of america, skin, stenella attenuata2017-03-03v4No1 / 16
108amnonincreases during fasting in nile tilapia caecum ( high in fasting late timepoints compared to early timepoints in united states of america research facility caecum oreochromis niloticus state of texas nile tilapia )2017-04-07v4No1 / 17
158amnondominant united states of america, axilla, felis catus, cat2017-07-06v4No1 / 17
408amnondominant united states of america, larval stage, costa rica, ant, pseudomyrmex gracilis2018-11-22v4No1 / 17
408amnondominant united states of america, larval stage, costa rica, ant, pseudomyrmex nigrocinctus2018-11-22v4No1 / 17
460amnoncommon in occupied office air (common united states of america, air, state of california, indoor, office)2019-01-12v4No1 / 17
158amnondominant united states of america, external acoustic meatus, felis catus, cat, ear canal2017-07-06v4No1 / 18
235amnoncommon in eelgrass leaf (common ocean, leaf, zostera marina, eelgrass)2017-11-07v4No1 / 18
302amnonhigh freq. in feces of parakeet pet birds (dominant feces, melopsittacus undulatus, mexico, bird, parakeet, pet)2018-03-05v4No1 / 18
408amnoncommon united states of america, stomach, costa rica, cephalotes, ant2018-11-22v4No1 / 18
408amnoncommon united states of america, larval stage, costa rica, ant, pseudomyrmex nigropilosus2018-11-22v4No1 / 18
408amnondominant united states of america, larval stage, costa rica, ant, pseudomyrmex simplex2018-11-22v4No1 / 18
515amnoncommon poland, whole body, plant, beetle, nida basin, herbivorous beetle, eusomus ovulum2019-04-18v4No1 / 18
115amnoncommon freshwater river biome, intestine, yangtze river, coreius guichenoti, largemouth bronze gudgeon, fish, china2017-04-10v4No1 / 19
232amnonhigher in diabetec patient foot skin compared to healthy controls ( high in diabetes mellitus compared to control in homo sapiens skin foot australia )2017-11-05v4No1 / 19
408amnoncommon united states of america, larval stage, costa rica, crematogaster, ant2018-11-22v4No1 / 19
489amnondominant feces, french republic, anal swab, myotis myotis, bat, greater mouse eared bat2019-02-25v4No1 / 19
588amnonreagent contaminant (contamination)2020-02-10v3No1 / 19
162amnonhigh freq. in periodontal pocket in humans (dominant homo sapiens, united states of america, dentition, san diego, subgingival plaque, periodontal pocket, mouth)2017-07-13v4No1 / 20
353amnonhigh freq. in captive Lissotriton vulgaris newts skin (dominant research facility, skin, adult, cambridgeshire, newt, lissotriton vulgaris, united kingdom)2018-07-30v4No1 / 20
408amnondominant united states of america, stomach, costa rica, cephalotes, ant2018-11-22v4No1 / 20
492amnondominant skin, adult, chile, frog, eupsophus vertebralis2019-02-27v4No1 / 20
79amnondominant united states of america, skin, balaenoptera borealis, sei whale2017-03-03v4No1 / 20
697amnondominant female, research facility, oral cavity, sprague dawley, sichuan province, female organism, china2028-03-29v3No1 / 20
33amnondominant homo sapiens, sputum, lung, bronchial epithelium, vancouver2016-12-06v4No1 / 21
58amnoncommon homo sapiens, skin of face, new york city, skin under eyes2017-02-02v4No1 / 21
392amnon high in fishmeal diet compared to defatted larvae insect diet in digestive system research facility oncorhynchus mykiss sweden fish rainbow trout 2018-11-05v4No1 / 21
460amnoncommon in outdoor air (common united states of america, air, state of california, outdoor)2019-01-12v4No1 / 21
596amnoncommon homo sapiens, saliva, child, sweden, 3-month-old human stage2020-03-17v3No1 / 21
408amnoncommon united states of america, larval stage, costa rica, ant, pseudomyrmex spinicola2018-11-22v4No1 / 22
58amnoncommon homo sapiens, new york city, contact lens2017-02-02v4No1 / 23
346amnoncommon in fruitfly larva grown on prickly pear (common larval stage, body proper, ceratitis capitata, italy, whole body, prickly pear, opuntia ficus indica, mediterranean fruit fly)2018-06-11v4No1 / 23
392amnon high in fishmeal diet compared to larvae insect diet in digestive system research facility oncorhynchus mykiss sweden fish rainbow trout 2018-11-05v4No1 / 23
408amnoncommon united states of america, larval stage, costa rica, ant, pseudomyrmex simplex2018-11-22v4No1 / 23
79amnoncommon united states of america, skin, balaenoptera acutorostrata, minke whale2017-03-03v4No1 / 23
587amnondominant israel, food product type, medicago sativa, alfalfa sprouts, producer c22020-02-10v3No1 / 23
338amnon high in adult compared to larval stage tadpole amphibian larval stage in skin andrias japonicus japanese giant salamander japan 2018-05-21v4No1 / 24
392amnon high in fishmeal diet compared to pre pupae insect diet in digestive system research facility oncorhynchus mykiss sweden fish rainbow trout 2018-11-05v4No1 / 24
489amnoncommon feces, french republic, anal swab, myotis myotis, bat, greater mouse eared bat2019-02-25v4No1 / 24
617amnondominant farm, milk, italy, cow milk (fluid), cow milk (raw), alpine, alpine pasture2020-05-03v3No1 / 24
35amnoncommon homo sapiens, hospital, dense settlement biome, breast milk, tanzania2016-12-06v4No1 / 25
157amnonlow in nares of calves fed alfalfa not fortified with selenium compared to slenium fortified alfalfa ( high in selenium compared to control low selenium in united states of america nasal cavity pair of nares juvenile organism bos taurus calve )2017-07-04v4No1 / 26
158amnonhigher in skin sites compared to mouth in cats ( high in skin compared to saliva mouth in united states of america felis catus cat )2017-07-06v4No1 / 26
354amnoncommon homo sapiens, united states of america, nasal cavity, pair of nares, adult, nasal brush2018-07-30v4No1 / 26
158amnoncommon united states of america, inguinal region, felis catus, cat, groin2017-07-06v4No1 / 27
228amnoncommon in sinus brush of sinusitis patients (common homo sapiens, united states of america, mucosa, paranasal sinus, sinusoidal space, sinusitis)2017-10-31v4No1 / 27
58amnoncommon homo sapiens, conjunctiva, new york city2017-02-02v4No1 / 28
397amnoncommon digestive system, intestine, panama, fungus growing ant, myrmicocrypta ednaella2018-11-14v4No1 / 28
710amnonsuspected contaminant (common in blanks) (contamination)2028-05-20v4No1 / 28
596amnon high in 2-year-old human stage compared to 7-year-old human stage in homo sapiens saliva child sweden 2020-03-18v3No1 / 28
193amnonlower in nares of people working in dairy farms ( high in control compared to farm bos taurus in homo sapiens united states of america pair of nares )2017-09-05v4No1 / 29
666amnoncommon feces, italy, ursus arctos, brown bear2020-09-25v3No1 / 29
81amnoncommon cloaca, anas platyrhynchos, state of california, mallard2017-03-05v4No1 / 30
79amnoncommon united states of america, skin, physeter catodon2017-03-03v4No1 / 30
233amnon high in age age < 3 months compared to age > 3 months infant stage in feces homo sapiens united states of america infant 2017-11-05v4No1 / 31
79amnoncommon united states of america, skin, phocoena phocoena, harbor porpoise2017-03-03v4No1 / 31
490amnonobserved in amniotic fluid and buffer and water controls (contamination)2019-02-25v4No1 / 32
392amnoncommon digestive system, research facility, oncorhynchus mykiss, sweden, fish, rainbow trout, fishmeal diet2018-11-05v4No1 / 34
79amnoncommon united states of america, skin, stenella longirostris, spinner dolphin2017-03-03v4No1 / 34
108amnoncommon united states of america, research facility, colon, state of texas, quail, coturnix coturnix2017-04-07v4No1 / 35
79amnoncommon united states of america, skin, steno bredanensis, rough-toothed dolphin2017-03-03v4No1 / 35
596amnoncommon homo sapiens, saliva, infant, child, sweden, 6-month-old human stage2020-03-17v3No1 / 35
79amnondominant united states of america, skin, delphinus delphis2017-03-03v4No1 / 36
596amnoncommon homo sapiens, saliva, child, sweden, 12-month-old human stage2020-03-17v3No1 / 36
81amnonhigh in influenza A positive mallards compared to healthy mallards ( high in influenza compared to control in cloaca anas platyrhynchos state of california mallard )2017-03-05v4No1 / 37
158amnoncommon united states of america, axilla, felis catus, cat2017-07-06v4No1 / 37
345amnoncommon homo sapiens, nasal cavity, nasal cavity mucosa, adult, austria, graz city district2018-06-11v4No1 / 37
362amnon high in active vent compared to inactive vent in hydrothermal vent volcanic crater water volcanic rock marine sediment sea water marine hydrothermal vent mediterranean sea greece 2018-08-29v4No1 / 37
355amnoncommon ocean, pacific ocean, canada, province of british columbia, calvert island, alga, saccharina groenlandica, saccharina2018-08-01v4No1 / 39
33amnoncommon homo sapiens, sputum, lung, bronchial epithelium, vancouver2016-12-06v4No1 / 40
79amnoncommon united states of america, skin, peponocephala electra2017-03-03v4No1 / 40
79amnoncommon united states of america, skin, stenella attenuata2017-03-03v4No1 / 40
731amnonlower in oropharingeal otic fluid drainage compared to buccal mucosa ( high in mouth mucosa buccal mucosa compared to oropharynx in homo sapiens united states of america adult state of michigan )2021-01-09v4No1 / 41
355amnoncommon ocean, pacific ocean, canada, province of british columbia, calvert island, alga, laminaria setchelli, laminaria2018-08-01v4No1 / 42
79amnoncommon united states of america, skin, globicephala macrorhynchus, short finned pilot whale2017-03-03v4No1 / 42
587amnoncommon israel, food product type, vigna radiata, producer c1, mung bean sprouts2020-02-10v3No1 / 42
108amnoncommon united states of america, research facility, colon, oreochromis niloticus, state of texas, nile tilapia2017-04-07v4No1 / 43
231amnoncommon in dog genitalia (common united states of america, reproductive system, reproductive organ, canis lupus familiaris, dog, genitalia)2017-11-02v4No1 / 43
302amnoncommon in feces of parakeet pet birds (common feces, melopsittacus undulatus, mexico, bird, parakeet, pet)2018-03-05v4No1 / 44
327amnonlower in nasopharynx of antibiotics treated cows compared to cows without antibiotic injection ( high in control compared to antibiotic in nasopharynx bos taurus canada cow )2018-04-30v4No1 / 45
773amnoncommon homo sapiens, adult, palatine tonsil, tonsillitis, japan, tonsillectomy, recurrent tonsillitis2021-04-23v4No1 / 45
818amnoncommon research facility, ileum, gallus gallus, digesta, chicken, intestinal contents, female organism, china, hen, age 60 weeks2021-07-10v3No1 / 45
302amnoncommon in feces of canary pet birds (common feces, mexico, bird, pet, serinus canaria, canary)2018-03-05v4No1 / 47
408amnoncommon united states of america, larval stage, costa rica, ant, pseudomyrmex viduus2018-11-22v4No1 / 47
666amnoncommon feces, italy, delphinus delphis, rectal swab, short beaked common dolphin2020-09-25v3No1 / 48
149amnoncommon mucus, larval stage, amphibian larval stage, skin, germany, salamandra salamandra, fire salamander2017-04-24v4No1 / 49
79amnoncommon united states of america, skin, harbor seal, phoca vitulina2017-03-03v4No1 / 49
773amnoncommon homo sapiens, adult, palatine tonsil, iga glomerulonephritis, japan, tonsillectomy2021-04-23v4No1 / 54
354amnon high in bronchus bronchial epithelium bronchial brush compared to sputum induced sputum in homo sapiens united states of america adult 2018-07-30v4No1 / 55
492amnoncommon skin, adult, chile, frog, eupsophus vertebralis2019-02-27v4No1 / 55
642amnon high in water saline water sea water compared to sediment marine sediment in pacific ocean san diego 2020-08-28v4No1 / 56
237amnoncommon canada, bon portage island, bird, oceanodroma leucorhoa, seabird, brood patch2017-11-07v4No1 / 57
596amnoncommon homo sapiens, saliva, child, sweden, 2-year-old human stage2020-03-17v3No1 / 57
237amnoncommon uropygial gland, canada, bon portage island, bird, oceanodroma leucorhoa, seabird2017-11-07v4No1 / 58
67amnoncommon in wet processing of coffee beans (common coffea arabica, ecuador, wet processing)2017-02-19v4No1 / 59
770amnoncommon oral cavity, mouth mucosa, infant, macaca mulatta, age < 1 year, cayo santiago, puerto rico, indian rhesus macaque2021-04-19v4No1 / 59
596amnoncommon homo sapiens, saliva, child, sweden, 7-year-old human stage2020-03-17v3No1 / 59
196amnonhigher in biofilms in water at 60C compared to 40C ( high in temp 60c high temperature environment compared to control temp 40c in united states of america water biofilm drinking water )2017-09-12v4No1 / 62
302amnoncommon in feces of Cockatiel pet birds (common feces, mexico, bird, pet, nymphicus hollandicus, cockatiel)2018-03-05v4No1 / 63
355amnonhigh freq. in crustose sporophyte of mastocarpus algae (common ocean, pacific ocean, canada, province of british columbia, calvert island, mastocarpus, alga, mastocarpus alaskensis, crustose sporophyte)2018-08-01v4No1 / 66
162amnoncommon in periodontal pocket in humans (common homo sapiens, united states of america, dentition, san diego, subgingival plaque, periodontal pocket, mouth)2017-07-13v4No1 / 67
782amnon high in juvenile organism age 1 year compared to adult organism age 3 years in fish farm skin portuguese republic dicentrarchus labrax ria formosa open water pond seabass 2021-05-07v4No1 / 67
587amnoncommon israel, food product type, vigna radiata, producer c2, mung bean sprouts2020-02-10v3No1 / 67
770amnoncommon oral cavity, mouth mucosa, macaca mulatta, age 10-15 years, adult organism, cayo santiago, puerto rico, indian rhesus macaque2021-04-19v4No1 / 68
231amnoncommon in dog urine (common united states of america, urine, canis lupus familiaris, dog)2017-11-02v4No1 / 69
727amnoncommon body proper, kingdom of spain, whole body, tick, la rioja province, ixodes ricinus2021-01-03v3No1 / 69
697amnoncommon female, research facility, oral cavity, sprague dawley, sichuan province, female organism, china2028-03-29v3No1 / 73
77amnoncommon kelp forest, australia, ecklonia radiata, winter, algae2017-02-28v4No1 / 76
666amnoncommon feces, tursiops truncatus, italy, rectal swab, common bottlenose dolphin2020-09-25v3No1 / 76
569amnoncommon in gastric biopsies of patients positive for h. pylori (common homo sapiens, stomach, biopsy, mucosa of stomach, helicobacter pylori infectious disease, south korea)2019-12-16v3No1 / 77
596amnon high in under-1-year-old human stage compared to age 1-7 years 2-5 year-old child stage in homo sapiens saliva child sweden 2020-03-18v3No1 / 78
108amnon high in caecum compared to colon in united states of america research facility oreochromis niloticus state of texas nile tilapia 2017-04-07v4No1 / 80
133amnonhigher in healthy babies (<1yr) compared to acute respiratory illness ( high in control compared to acute respiratory illness respiratory system disease in homo sapiens nasopharynx infant australia )2017-04-16v4No1 / 80
136amnoncommon ocean, sea water, atlantic ocean, sargasso sea, trichodesmium2017-04-17v4No1 / 81
777amnon high in 3-year-old human stage compared to 5-year-old human stage in homo sapiens saliva child sweden municipality of umea 2021-04-26v3No1 / 81
231amnoncommon in dog rectum (common feces, united states of america, rectum, canis lupus familiaris, dog)2017-11-02v4No1 / 84
353amnoncommon in captive Triturus cristatus newts skin (common research facility, skin, adult, cambridgeshire, newt, triturus cristatus, united kingdom)2018-07-30v4No1 / 84
569amnoncommon in gastric biopsies of patients negative for h. pylori (common homo sapiens, stomach, biopsy, south korea, mucosa of stomach)2019-12-16v3No1 / 85
108amnon high in caecum compared to colon in united states of america research facility mus musculus state of texas mouse 2017-04-07v4No1 / 86
162amnoncommon in supragingival plaque in humans (common homo sapiens, united states of america, dentition, san diego, supragingival plaque, mouth)2017-07-13v4No1 / 86
353amnoncommon in captive Lissotriton vulgaris newts skin (common research facility, skin, adult, cambridgeshire, newt, lissotriton vulgaris, united kingdom)2018-07-30v4No1 / 86
355amnonlower in crustose sporophyte compared to upright gametophyte phase of mastocarpus algae ( high in upright gametophyte compared to crustose sporophyte in ocean pacific ocean canada province of british columbia calvert island mastocarpus alga mastocarpus alaskensis )2018-08-01v4No1 / 86
487amnoncommon feces, homo sapiens, united states of america, metabolic syndrome x, metabolic syndrome2019-02-24v4No1 / 88
79amnoncommon united states of america, skin, balaenoptera borealis, sei whale2017-03-03v4No1 / 90
354amnon high in bronchus bronchial epithelium bronchial brush compared to saliva oral wash in homo sapiens united states of america adult 2018-07-30v4No1 / 94
355amnoncommon ocean, pacific ocean, ulva, canada, province of british columbia, calvert island, alga, ulva lactuca2018-08-01v4No1 / 94
492amnoncommon skin, adult, brazil, rhinella icterica, toad, yellow cururu toad2019-02-27v4No1 / 95
196amnonlower in water compared to biofilm ( high in biofilm compared to water in united states of america drinking water )2017-09-12v4No1 / 100
136amnoncommon ocean, sea water, pacific ocean, north pacific ocean, trichodesmium2017-04-17v4No1 / 103
198amnoncommon united states of america, hot spring, geothermal field, water, yellowstone national park, high temperature environment2017-09-13v4No1 / 103
565amnoncommon skin, canada, sciurus carolinensis, eastern gray squirrel2019-11-21v3No1 / 104
777amnon high in 2-days-old human compared to 3-month-old human stage in homo sapiens saliva infant sweden municipality of umea 2021-04-26v3No1 / 104
79amnoncommon united states of america, skin, balaenoptera physalus, fin whale2017-03-03v4No1 / 105
587amnoncommon israel, food product type, medicago sativa, alfalfa sprouts, producer c12020-02-10v3No1 / 106
539amnon high in early timepoint days 1-15 aerobic fermentation compared to late timepoint days 30-60 anaerobic fermentation in ethiopia ensete ventricosum ethiopian banana food (fermented) 2019-07-31v4No1 / 110
770amnoncommon macaca mulatta, age > 1 year, penis, male organism, cayo santiago, puerto rico, indian rhesus macaque2021-04-19v4No1 / 110
198amnoncommon united states of america, geothermal field, sediment, thermophilic sediment, yellowstone national park, high temperature environment2017-09-13v4No1 / 113
79amnoncommon united states of america, skin, delphinus delphis2017-03-03v4No1 / 113
691amnon high in spring compared to summer in water drinking water french republic commune of paris 2028-03-11v3No1 / 115
195amnoncommon in boston subway surfaces (common city, urban biome, boston, train)2017-09-07v4No1 / 116
410amnonlower in feces compared to rectal biopsies in children with treatment naive uc ( high in rectum biopsy site biopsy compared to feces in homo sapiens united states of america child ulcerative colitis )2018-11-22v4No1 / 118
743amnoncommon feces, farm, adult, italy, captive, lepus europaeus, european hare2021-02-21v3No1 / 119
196amnoncommon in biofilm in tap water (common united states of america, water, biofilm, drinking water)2017-09-12v4No1 / 121
517amnoncommon homo sapiens, arm, skin, forearm, child, bolivia, chuquisaca department, rural community, age 5-13 years2019-05-29v4No1 / 121
699amnoncommon harbor, clavelina oblonga, sea squirts, inner tunic2028-04-01v4No1 / 123
136amnoncommon ocean, sea water, pacific ocean, south pacific ocean, trichodesmium2017-04-17v4No1 / 125
67amnoncommon in dry processing of coffee beans (common coffea arabica, ecuador, dry processing)2017-02-19v4No1 / 126
280amnoncommon coral reef, atlantic ocean, portuguese republic, depth 20m, eunicella labiata, gorgonian coral, coral2018-01-25v4No1 / 128
173amnoncommon homo sapiens, saliva, austria, graz city district2017-07-26v4No1 / 129
355amnoncommon in upright gametophyte of mastocarpus algae (common ocean, pacific ocean, canada, province of british columbia, calvert island, mastocarpus, alga, mastocarpus alaskensis, upright gametophyte)2018-08-01v4No1 / 129
609sheryohigher in soil with tobacco plants and with difenoconazole fungicide ( high in presence of tobacco plants compared to absence of tobacco plants in soil ph 7-8 depth 0-20cm limestone fungicide china tobacco field difenoconazole )2020-04-21v4No1 / 131
108amnoncommon united states of america, research facility, colon, state of texas, anaxyrus terrestris, southern toad2017-04-07v4No1 / 132
578amnon high in kingdom of spain compared to sweden in feces homo sapiens hiv infection adult gay homosexual msm male 2020-01-14v3No1 / 133
675sheryoHigher in watermelon rhizosphere soil inoculated with fusarium oxysporum f. sp. niveum compared to uninoculated watermelon rhizosphere soil ( high in inoculated with fusarium oxysporum f. sp. niveum compared to un-inoculated in rhizosphere ph 7 citrullus lanatus china co culture with wheat (triticum aestivum l.) )2028-02-22v4No1 / 136
617amnoncommon farm, milk, italy, cow milk (fluid), cow milk (raw), alpine, alpine pasture2020-05-03v3No1 / 137
291amnoncommon nasal cavity, pair of nares, canis lupus familiaris, germany, dog2018-02-01v4No1 / 144
355amnoncommon ocean, pacific ocean, canada, province of british columbia, calvert island, alga, pyropia, pyropia perforata, purple laver2018-08-01v4No1 / 145
241amnonhigher in babies from russia compared to estonia ( high in russia compared to estonia in feces homo sapiens infant age < 3 years )2017-11-13v4No1 / 146
355amnoncommon ocean, pacific ocean, canada, province of british columbia, calvert island, alga, pseudolithophyllum, pseudolithophyllum neofarlowii2018-08-01v4No1 / 146
666amnoncommon feces, zoological garden, italy, hippopotamus amphibius2020-09-25v3No1 / 146
355amnoncommon ocean, pacific ocean, canada, province of british columbia, calvert island, gloiopeltis, gloiopeltis furcata, alga, glueweed2018-08-01v4No1 / 147
515amnoncommon feces, bulgaria, balkan mountains, whole body, beetle, detritivorous beetle, aphodius haemorrhoidalis2019-04-18v4No1 / 147
362amnoncommon hydrothermal vent, volcanic crater, water, volcanic rock, marine sediment, sea water, marine hydrothermal vent, mediterranean sea, greece, active vent2018-08-29v4No1 / 150
780amnon high in small intestine duodenum jejunum compared to caecum in research facility gallus gallus chicken china jinzhou city prefecture 2021-04-28v3No1 / 153
273amnon high in age 1-month-old human stage compared to 1-year-old human stage in feces homo sapiens infant kingdom of denmark 2018-01-14v4No1 / 155
266amnoncommon on perennial plant leaves (common united states of america, leaf, state of idaho, plant, brassicaceae, boechera stricta)2017-12-19v4No1 / 156
108amnon high in colon compared to caecum in united states of america research facility state of texas quail coturnix coturnix 2017-04-07v4No1 / 157
121amnonhigh in diarrhea compared to recovery period ( high in diarrhea compared to control in feces homo sapiens adult bangladesh )2017-04-13v4No1 / 162
486amnoncommon ocean, sediment, oil seep, pacific ocean, state of oregon, depth 500-1000m, carbonate, lithified carbonate blocks, hydrate ridge, active methane seep2019-02-19v4No1 / 163
652amnoncommon homo sapiens, saliva, adult, sichuan province, china2020-09-13v3No1 / 166
770amnoncommon vagina, macaca mulatta, age > 1 year, female organism, cayo santiago, puerto rico, indian rhesus macaque2021-04-19v4No1 / 169
666amnoncommon feces, italy, apodemus sylvaticus, wood mouse2020-09-25v3No1 / 171
499amnoncommon digestive system, pond, intestine, tadpole, brazil, frog, scinax fuscovarius2019-03-05v4No1 / 176
355amnoncommon ocean, pacific ocean, canada, province of british columbia, calvert island, alga, odonthalia floccosa, odonthalia2018-08-01v4No1 / 178
311amnoncommon united states of america, state of rhode island, ginger, foodon product type2018-04-09v4No1 / 180
777amnon high in 3-year-old human stage compared to 18-month-old human stage in homo sapiens saliva child sweden municipality of umea 2021-04-26v3No1 / 184
73amnonhigh in children with Crohn's disease compared to healthy adult controls ( high in child obsolete_juvenile stage crohn's disease compared to control adult in feces homo sapiens glasgow )2017-02-26v4No1 / 185
355amnoncommon ocean, pacific ocean, canada, province of british columbia, calvert island, alga, phylospadix, surfgrass2018-08-01v4No1 / 191
617amnonhigher in cow milk of cows in alpine pasture compared to lowland farm ( high in alpine alpine pasture compared to lowland pasture lowland farm in farm milk italy cow milk (fluid) cow milk (raw) )2020-05-03v3No1 / 204
511amnoncommon kingdom of norway, sweden, finland, lapland, depth 0-5cm, snow2019-03-20v4No1 / 213
138amnoncommon in ocean water depth 5m (common ocean, sea water, pacific ocean, depth 5m)2017-04-18v4No1 / 214
587amnoncommon israel, food product type, medicago sativa, alfalfa sprouts, producer c22020-02-10v3No1 / 215
108amnoncommon united states of america, research facility, caecum, state of texas, quail, coturnix coturnix2017-04-07v4No1 / 216
355amnoncommon ocean, pacific ocean, canada, province of british columbia, calvert island, alga, ptilota filicina, ptilota2018-08-01v4No1 / 230
780amnoncommon research facility, small intestine, duodenum, jejunum, gallus gallus, chicken, china, jinzhou city prefecture2021-04-28v3No1 / 232
492amnoncommon skin, adult, rana catesbeiana, bullfrog, frog, lithobates catesbeianus, japan2019-02-27v4No1 / 236
355amnoncommon ocean, pacific ocean, canada, province of british columbia, calvert island, alga, endocladia, endocladia muricata, turfweed2018-08-01v4No1 / 237
108amnoncommon united states of america, research facility, caecum, mus musculus, state of texas, mouse2017-04-07v4No1 / 241
517amnon high in mouth mucosa mouth compared to feces in homo sapiens child bolivia chuquisaca department rural community age 5-13 years 2019-05-29v4No1 / 242
462amnon high in populus deltoides compared to populus trichocarpa x deltoides in united states of america state of tennessee populus tree cultivated environment root 2019-01-13v4No1 / 254
355amnoncommon ocean, pacific ocean, canada, province of british columbia, calvert island, alga, colpomenia, colpomenia sp. 1peregrina2018-08-01v4No1 / 255
415amnonlower in citrus from humid subtropical compared to mediterranean and semi-arid climate ( high in mediterranean semi-arid compared to subtropical in orchard soil rhizosphere citrus cultivated environment )2018-11-27v4No1 / 264
309amnon high in other plants compared to geranium pratense meadow geranium in rhizosphere germany 2018-04-05v4No1 / 267
499amnoncommon digestive system, pond, intestine, brazil, fish, astyanax paranae, astyanax2019-03-05v4No1 / 273
355amnoncommon ocean, pacific ocean, canada, province of british columbia, calvert island, alga, cryptosiphonia woodii, cryptosiphonia2018-08-01v4No1 / 281
762sheryoCommon in rhizosphere soil of a pot experiment with lettuce planted in npk fertilized haplic luvisol Switzerland (common soil, rhizosphere, switzerland, thyrow, pot expreiment, npk fertilization, lettuce, mineral fertilization, haplic luvisol)2021-04-08v3No1 / 286
423amnoncommon skin, ukraine, bank vole, myodes glareolus2018-12-05v4No1 / 291
237amnonlower in burrow soil compared to bird ( high in bird oceanodroma leucorhoa seabird compared to soil burrow in canada bon portage island )2017-11-07v4No1 / 298
77amnon high in winter compared to summer in marine biome kelp forest australia algae 2017-02-28v4No1 / 303
751sheryoCommon in tomato soil infected with Fusarium oxysporum (common soil, solanum lycopersicum, fusarium oxysporum, shandong province, china, luojiazhuang)2021-03-11v3No1 / 305
241amnonhigher in babies from russia compared to finland ( high in russia compared to finland in feces homo sapiens infant age < 3 years )2017-11-13v4No1 / 306
499amnoncommon digestive system, pond, intestine, poecilia reticulata, brazil, fish, guppy2019-03-05v4No1 / 308
61amnoncommon united states of america, research facility, skin, inguinal region, canis lupus familiaris2017-02-05v4No1 / 327
512amnoncommon peatland, fen, soil, peat soil, baekdudaegan, ph 5-6, hani peatland, china2019-03-22v4No1 / 329
750sheryoCommon in soil of wheat field in China (common soil, triticum aestivum, china, hebei province, luancheng county, ph 7.6, fluvo-aquic soil)2021-03-11v3No1 / 337
355amnoncommon ocean, pacific ocean, canada, province of british columbia, calvert island, alga, prionitis, prionitis sternbergii2018-08-01v4No1 / 345
134amnon high in taxus media compared to taxus cuspidata in rhizosphere tree taxus china 2017-04-16v4No1 / 358
583amnoncommon mountain, soil, switzerland, depth 0-10cm, canton of graubunden, elevation 2000-3000m, siliceous parent material, ph 4.5-72020-01-27v3No1 / 359
565amnoncommon zoological garden, skin, captive, canada, african lion safari, macropus rufus, red kangaroo2019-11-21v3No1 / 360
512amnon high in baekdudaegan ph 5-6 hani peatland compared to tibetan plateau riganqiao peatland ph 5.5-6.5 in peatland fen soil peat soil china 2019-03-22v4No1 / 363
486amnoncommon ocean, sediment, pacific ocean, state of oregon, depth 500-1000m, carbonate, lithified carbonate blocks, hydrate ridge, low activity methane seep2019-02-19v4No1 / 371
355amnoncommon ocean, pacific ocean, canada, province of british columbia, calvert island, alga, bossiella frondescems, bossiella2018-08-01v4No1 / 399
662amnoncommon soil, israel, depth 0-10cm, irrigated, agricultural field, clay soil, neve yaar2020-09-21v3No1 / 402
309amnon high in other plants compared to veronica chamaedrys germander speedwell in rhizosphere germany 2018-04-05v4No1 / 404
355amnoncommon ocean, pacific ocean, canada, province of british columbia, calvert island, alga, corallina vancouveriensis, corallina, graceful coral seaweed2018-08-01v4No1 / 408
800amnoncommon 100-250 days following heavy metal contamination (common lake, sediment, fresh water, summer, autumn, heavy metal, reservoir, china, xiannv lake, sediment depth 0-10cm)2021-06-15v4No1 / 412
353amnoncommon in wild Lissotriton vulgaris newts skin (common skin, adult, cambridgeshire, newt, lissotriton vulgaris, united kingdom)2018-07-30v4No1 / 418
355amnoncommon ocean, pacific ocean, canada, province of british columbia, calvert island, alga, neogastroclonium subarticulatum, neogastroclonium2018-08-01v4No1 / 419
355amnoncommon ocean, pacific ocean, canada, province of british columbia, calvert island, alga, plocamium violaceum, plocamium2018-08-01v4No1 / 444
758amnon high in cheyenne full flavor cigar cheyenne menthol box cigar compared to swisher sweets original cigar swisher sweets sweet cherry cigar in nicotiana tabacum cigar tobacco 2021-03-28v3No1 / 452
353amnoncommon in wild Triturus cristatus newts skin (common skin, adult, cambridgeshire, newt, triturus cristatus, united kingdom)2018-07-30v4No1 / 456
355amnoncommon ocean, pacific ocean, canada, province of british columbia, calvert island, alga, analipus, analipus japonicus, sea fir2018-08-01v4No1 / 461
80amnon high in tropical moist broadleaf forest biome compared to dry forest in feces state of florida central america alouatta pigra howler monkey 2017-03-03v4No1 / 465
355amnoncommon ocean, pacific ocean, canada, province of british columbia, calvert island, alga, egregia menziesii, egregia2018-08-01v4No1 / 472
357amnoncommon soil, topsoil, depth 0-10cm, woodland area, forest ecosystem2018-08-19v4No1 / 474
782amnon high in dicentrarchus labrax seabass compared to sparus aurata seabream in fish farm gill portuguese republic ria formosa open water pond 2021-05-06v4No1 / 477
375amnoncommon in oil contaminated desert soil (common desert, soil, oil contaminated soil, kuwait)2018-09-09v4No1 / 490
357amnoncommon soil, topsoil, depth 0-10cm, southern temperate forest, temperate broadleaf and mixed forest biome, woodland area, forest ecosystem2018-08-19v4No1 / 499
798amnoncommon orchard, hay, italy, depth 10 cm, plant litter, apennine mountains, prunus armeniaca, apricot, litter bag2021-06-13v3No1 / 508
139amnonpositively correlated with sediment depth (in ocean floor depth 4000m) ( high in sediment depth 8-10cm compared to sediment depth 0-5cm in marine sediment pacific ocean depth 4000m )2017-04-18v4No1 / 522
357amnoncommon soil, subpolar coniferous forest biome, topsoil, depth 0-10cm, boreal forest, woodland area, forest ecosystem2018-08-19v4No1 / 538
138amnoncommon in ocean water depth 1000m (common ocean, sea water, pacific ocean, depth 1000m)2017-04-18v4No1 / 566
667amnoncommon soil, topsoil, jiangxi province, ph 4.5, depth 0-20cm, forested area, china, lushan mountain, elevation 500-600m2020-09-25v4No1 / 575
138amnoncommon in ocean water depth 150-500m (common ocean, sea water, pacific ocean, depth 150-500m)2017-04-18v4No1 / 582
777amnon high in child 18-month-old human stage compared to infant 3-month-old human stage in homo sapiens saliva sweden municipality of umea 2021-04-26v3No1 / 583
808amnon high in ileum compared to caecum in research facility mucosa gallus gallus germany chicken age 35 weeks hen 2021-06-20v1No1 / 587
536amnon high in terrestrial snake compared to aquatic snake in united states of america skin snake southern united states 2019-07-28v4No1 / 590
603amnoncommon in baijiu fermentation pit mud in later batches (common mud, fermentation pit mud, china, hefei city prefecture, baijiu, days 180-270)2020-04-05v3No1 / 608
667amnoncommon soil, topsoil, jiangxi province, ph 4.5, depth 0-20cm, forested area, china, elevation 200-300m, lushan mountain2020-09-25v4No1 / 613
309amnon high in galium mollugo hedge bedstraw compared to other plants in rhizosphere germany 2018-04-05v4No1 / 618
698amnoncommon park, rhizosphere, depth 0-30cm, united kingdom, london, quercus, ph 4-4.5, oak2028-04-01v3No1 / 623
667amnoncommon soil, topsoil, jiangxi province, depth 0-20cm, forested area, coniferous forest biome, china, lushan mountain, elevation 1000-1100m, ph 4-4.52020-09-25v4No1 / 630
800amnonhigher at 100-250 days compared to 7-28 days following heavy metal contamination ( high in summer autumn compared to spring in lake sediment fresh water heavy metal reservoir china xiannv lake sediment depth 0-10cm )2021-06-15v4No1 / 644
827sheryoCommon in soil at 230cm depth in clayey till loam soil, Lund Denmark (common kingdom of denmark, agricultural field, lund, loam soil, clayey till, late weichselian glaciation, depth 200-260cm)2021-08-24v3No1 / 644
471amnon high in tadpole compared to adult in digestive system united states of america research facility state of florida frog osteopilus septentrionalis 2019-01-14v4No1 / 648
729amnon high in zoological garden captive europe compared to wild cameroon in feces gorilla gorilla monkey 2021-01-05v3No1 / 656
609sheryocommon in soil with tobacco plants amended with difenoconazole fungicide (common soil, ph 7-8, depth 0-20cm, limestone, fungicide, china, tobacco field, difenoconazole, tobacco plant present)2020-04-21v4No1 / 671
138amnoncommon in ocean water depth 2000-4000m (common ocean, sea water, pacific ocean, depth 2000-4000m)2017-04-18v4No1 / 674
565amnoncommon zoological garden, skin, captive, canada, tragelaphus oryx, toronto zoo, eland2019-11-21v3No1 / 674
309amnon high in meadow pea-vine lathyrus pratensis compared to other plants in rhizosphere germany 2018-04-05v4No1 / 680
667amnoncommon soil, topsoil, jiangxi province, ph 4.5, depth 0-20cm, forested area, china, lushan mountain, elevation 800-900m2020-09-25v4No1 / 694
801sheryoCommon at depth 30-60cm in corn agriculture fields, Iowa USA (common soil, zea mays, iowa, agricultural field, united states, des moines, depth (soil) 30-60cm, nicollet soil series, kanawha, ph 8.1)2021-06-15v4No1 / 703
134amnon high in temperate taxus media taxus cuspidata northeast china compared to subtropical taxus mairei southeast china in rhizosphere tree taxus china 2017-04-16v4No1 / 734
813amnoncommon united states of america, soil, state of washington, forested area, olympic national park, temperate rainforest2021-06-22v4No1 / 740
801sheryoCommon at depth 60-90cm in corn agriculture fields, Iowa USA (common soil, zea mays, iowa, agricultural field, united states, des moines, nicollet soil series, depth 60-90cm, kanawha, ph 8.3)2021-06-15v4No1 / 764
157amnoncommon in naers of weened calves (common united states of america, nasal cavity, pair of nares, juvenile organism, bos taurus, calve)2017-07-04v4No1 / 766
667amnoncommon soil, topsoil, jiangxi province, ph 4, depth 0-20cm, forested area, coniferous forest biome, china, lushan mountain, elevation 1300-1400m2020-09-25v4No1 / 777
827sheryoCommon in soil at 465cm depth in clayey till loam soil, Lund Denmark (common kingdom of denmark, agricultural field, lund, loam soil, clayey till, late weichselian glaciation, depth 450-480cm)2021-09-13v3No1 / 786
583amnoncommon mountain, soil, switzerland, depth 0-10cm, ph 7-8, canton of graubunden, elevation 2000-3000m, calcareous parent material2020-01-28v3No1 / 830
837sheryoHigher at 0-40cm depth compared to 40-100cm in soil after 10 years reforestation with Black locust trees, shaanxi, China ( high in depth 0-40cm compared to depth 40-100cm in soil silt loam reforestation china shaanxi province loess plateau robinia pseudoacacia 10 years )2021-09-26v4No1 / 831
232amnonlower in diabetec foot ulcers compared to non-ulcer skin in diabetic patients ( high in control compared to ulcer wound in homo sapiens skin foot australia diabetes mellitus )2017-11-05v4No1 / 836
517amnon high in arm skin forearm compared to feces in homo sapiens child bolivia chuquisaca department rural community age 5-13 years 2019-05-29v4No1 / 836
801sheryoCommon in soybean and corn agriculture fields at depth 30-60cm, Iowa USA (common soil, zea mays, glycine max, iowa, agricultural field, united states, ames, des moines, depth (soil) 30-60cm, nicollet soil series, ph 7.4)2021-06-15v4No1 / 839
266amnoncommon in roots in JAM garden (common united states of america, state of idaho, plant, brassicaceae, boechera stricta, root)2017-12-19v4No1 / 843
801sheryoCommon at depth 0-15cm in corn agriculture fields, Iowa USA (common soil, zea mays, iowa, agricultural field, united states, des moines, depth 0-15cm, nicollet soil series, ph 7.1, kanawha)2021-06-15v4No1 / 862
791sheryoHigher in low sodicity and low salinity soil compared to high sodicity and high salinity soil at 80cm depth in China ( high in low salinity low sodicity ph 9 compared to high salinity high sodicity ph 10 in soil china songnen plain da'an station salic solonetz depth (soil) 80cm )2021-06-08v4No1 / 895
801sheryoCommon in soybean and corn agriculture fields at depth 15-30cm, Iowa USA (common soil, zea mays, glycine max, iowa, agricultural field, united states, ames, des moines, nicollet soil series, depth 15-30cm, ph 7.4)2021-06-15v4No1 / 905
103amnoncommon united states of america, river, aquatic biome, fresh water, mississippi river, particles2017-04-05v4No1 / 909
103amnoncommon united states of america, river, aquatic biome, fresh water, mississippi river, free floating2017-04-05v4No1 / 909
609sheryoCommon in soil without tobacco plants amended with difenoconazole fungicide and biochar (common soil, ph 7-8, depth 0-20cm, limestone, biochar, fungicide, china, tobacco field, difenoconazole, without plants)2020-07-05v4No1 / 910
126amnoncommon rhizosphere, hordeum vulgare, germany, winter barley2017-04-14v4No1 / 925
791sheryoHigher in low sodicity and low salinity soil compared to high sodicity and high salinity soil at 0cm depth in China ( high in low salinity low sodicity ph 8.5 compared to high salinity high sodicity ph 10.5 in soil depth 0cm china songnen plain da'an station salic solonetz )2021-06-08v4No1 / 932
37amnonlower in tomato plant leaves compared to plastic control ( high in control compared to solanum lycopersicum in leaf maryland county )2016-12-09v4No1 / 950
266amnoncommon in soil from MIL garden (common united states of america, soil, state of idaho, ph 6.5)2017-12-18v4No1 / 980
675sheryoCommon in watermelon rhizosphere soil (common rhizosphere, ph 7, citrullus lanatus, china, co culture with wheat (triticum aestivum l.), un-inoculated)2028-02-22v4No1 / 980
610sheryoCommon in agricultural field soil amended with straw (common soil, triticum aestivum, kingdom of denmark, wheat, ph 7, agricultural field, straw)2020-04-21v3No1 / 998
517amnon high in arm skin forearm compared to mouth mucosa mouth in homo sapiens child bolivia chuquisaca department rural community age 5-13 years 2019-05-29v4No1 / 1014
768sheryoCommon in maize fields in Brittany, France (common soil, cambisol, zea mays, french republic, maize field, bretagne region)2021-04-18v3No1 / 1034
791sheryoCommon at 0cm depth in low saline low sodicity soil in China (common soil, depth 0cm, low salinity, china, songnen plain, da'an station, salic solonetz, low sodicity, ph 8.5)2021-06-07v4No1 / 1035
824sheryoHigher at 10-20cm depth compared to 20-40cm depth in soil after grazing exclusion, Ningxia china ( high in depth 10-20cm compared to depth 20-40cm in soil china grazing exclusion haplic calcisol calci-orthic aridisol ningxia province yunwushan national natural grassland protection zone )2021-08-08v4No1 / 1038
791sheryoCommon at 40cm depth in low saline low sodicity soil in China (common soil, low salinity, china, songnen plain, da'an station, salic solonetz, low sodicity, ph 9, depth (soil) 40cm)2021-06-08v4No1 / 1085
415amnoncommon orchard, soil, rhizosphere, kingdom of spain, citrus, cultivated environment2018-11-27v4No1 / 1099
266amnoncommon in roots in MAH garden (common united states of america, state of idaho, plant, brassicaceae, boechera stricta, root)2017-12-19v4No1 / 1110
827sheryoCommon in soil at 25cm depth in clayey till loam soil, Lund Denmark (common kingdom of denmark, depth (soil) 20-30cm, agricultural field, lund, loam soil, clayey till, late weichselian glaciation, plough layer )2021-08-24v3No1 / 1111
791sheryoCommon at 80cm depth in low saline low sodicity soil in China (common soil, low salinity, china, songnen plain, da'an station, salic solonetz, low sodicity, ph 9, depth (soil) 80cm)2021-06-08v4No1 / 1128
764sheryocommon in leoss soil in wheat field grown under crop rotation with rapeseed pre-crop in germany (common soil, triticum aestivum, brassica napus, germany, ph 7.6, bernburg, crop rotation, rapeseed pre-crop)2021-04-12v3No1 / 1129
764sheryoCommon in leoss soil in wheat field grown under conservation tillage and crop rotation in germany (common soil, triticum aestivum, germany, ph 7.6, bernburg, crop rotation, conservation tillage, cultivator tillage)2021-04-12v3No1 / 1140
134amnoncommon rhizosphere, temperate, tree, taxus, taxus cuspidata, northeast china, china2017-04-16v4No1 / 1141
791sheryoCommon at 20cm depth in low saline low sodicity soil in China (common soil, depth 20cm, low salinity, china, songnen plain, da'an station, salic solonetz, low sodicity, ph 8.5, ph 9)2021-06-08v4No1 / 1155
139amnoncommon marine sediment, polymetallic nodule, pacific ocean, depth 4000m2017-04-18v4No1 / 1196
764sheryoCommon in leoss soil in wheat field grown under conventional tillage and crop rotation in germany (common soil, triticum aestivum, germany, ph 7.6, bernburg, loess chernozem, conventional tillage, mouldboard plough, crop rotation)2021-04-12v3No1 / 1213
309amnoncommon rhizosphere, germany, prunella vulgaris, woundwort2018-04-05v4No1 / 1217
764sheryoCommon in leoss soil in wheat field grown under crop rotation with maize pre-crop in germany (common soil, triticum aestivum, germany, ph 7.6, bernburg, crop rotation, maize pre-crop)2021-04-12v3No1 / 1225
801sheryoCommon in soybean and corn agriculture fields at depth 0-15cm, Iowa USA (common soil, zea mays, glycine max, iowa, agricultural field, united states, ames, des moines, ph 7.5, depth 0-15cm, nicollet soil series)2021-06-15v4No1 / 1226
423amnon high in no human contact chernobyl exclusion zone compared to human contact in skin ukraine bank vole myodes glareolus 2018-12-05v4No1 / 1229
798amnoncommon orchard, soil, italy, depth 10 cm, ph 7-8, apennine mountains, prunus armeniaca, apricot2021-06-13v3No1 / 1230
134amnoncommon rhizosphere, temperate, tree, taxus, taxus media, northeast china, china2017-04-16v4No1 / 1251
675sheryoCommon in watermelon rhizosphere soil inoculated with Fusarium oxysporum f. sp. niveum (common rhizosphere, ph 7, citrullus lanatus, china, co culture with wheat (triticum aestivum l.), inoculated with fusarium oxysporum f. sp. niveum)2028-02-22v4No1 / 1271
415amnoncommon orchard, soil, rhizosphere, italy, citrus, cultivated environment2018-11-27v4No1 / 1279
309amnoncommon rhizosphere, germany, meadow pea-vine, lathyrus pratensis2018-04-05v4No1 / 1296
309amnoncommon rhizosphere, germany, onobrychis viciifolia, common sainfoin2018-04-05v4No1 / 1323
808amnon high in mucosa ileal mucosa compared to digesta in research facility ileum gallus gallus germany chicken age 35 weeks hen 2021-06-20v1No1 / 1360
266amnoncommon in soil from SIL garden (common united states of america, soil, state of idaho, ph 6)2017-12-18v4No1 / 1389
824sheryoCommon in soil after 0-9 years of grazing exclusion at 10-20cm depth, Ningxia china (common soil, china, grazing exclusion, haplic calcisol, calci-orthic aridisol, ningxia province, yunwushan national natural grassland protection zone, 0-9 years of grazing exclusion, depth 10-20cm)2021-08-08v4No1 / 1397
266amnoncoomon in roots in SIL garden (common united states of america, state of idaho, plant, brassicaceae, boechera stricta, root)2017-12-19v4No1 / 1399
266amnoncommon in soil from JAM garden (common united states of america, soil, state of idaho, ph 5.5)2017-12-18v4No1 / 1456
824sheryoCommon in soil after 27-35 years of grazing exclusion at 10-20cm depth, Ningxia china (common soil, china, grazing exclusion, 27-35 years of grazing exclusion, haplic calcisol, calci-orthic aridisol, ningxia province, yunwushan national natural grassland protection zone, depth 10-20cm)2021-08-08v4No1 / 1477
309amnoncommon rhizosphere, germany, red fescue grass, festuca rubra2018-04-05v4No1 / 1510
515amnon high in bulgaria detritivorous beetle compared to poland herbivorous beetle in whole body beetle 2019-04-19v4No1 / 1543
309amnoncommon rhizosphere, germany, galium mollugo, hedge bedstraw2018-04-05v4No1 / 1599
137amnoncommon feces, united states of america, state of florida, gopherus polyphemus, gopher tortoise2017-04-17v4No1 / 1622
631sheryocommon in maize field unamended rhizosphere soil (common soil, rhizosphere, maize field, china, guizhou province, kaiyang county, unamended soil, after 6 years, ph 7.6)2020-06-02v3No1 / 1637
608sheryoCommon in wheat field in China, amended and unamended biochar, unamended with nitrogen fertilizer (common soil, china, silty clay, triticum aestivum l. cv., xiaoyan no. 22)2020-04-20v4No1 / 1643
473amnon high in depth 50-100m compared to depth 5-50m in water saline water sea water state of california pacific ocean monterey bay 2019-01-16v4No1 / 1656
824sheryoCommon in soil after 27-35 years of grazing exclusion at 0-10cm depth, Ningxia china (common soil, depth 0-10cm, china, grazing exclusion, 27-35 years of grazing exclusion, haplic calcisol, calci-orthic aridisol, ningxia province, yunwushan national natural grassland protection zone)2021-08-08v4No1 / 1659
608sheryoCommon in wheat field in China, amended and unamended biochar, amended with nitrogen fertilizer (common soil, urea enriched soil, china, silty clay, triticum aestivum l. cv., xiaoyan no. 22)2020-04-20v4No1 / 1682
138amnoncommon marine sediment, pacific ocean, depth 4000m2017-04-18v4No1 / 1753
486amnon high in low activity methane seep compared to oil seep active methane seep in ocean sediment pacific ocean state of oregon depth 500-1000m carbonate lithified carbonate blocks hydrate ridge 2019-02-19v4No1 / 1791
631sheryoCommon in maize field unamended bulk soil (common soil, bulk soil, maize field, china, guizhou province, kaiyang county, unamended soil, ph 7.9)2020-06-02v3No1 / 1814
353amnonlower in captive compared to wild caught Lissotriton vulgaris newts skin ( high in wild compared to research facility in skin adult cambridgeshire newt triturus cristatus united kingdom )2018-07-30v4No1 / 1834
631sheryocommon in maize field biochar amended bulk soil, after 6 years of biochar amended (common soil, bulk soil, maize field, biochar, china, guizhou province, kaiyang county, after 6 years, ph 8)2020-06-02v3No1 / 1872
824sheryoCommon in soil after 0-9 years of grazing exclusion at 0-10cm depth, Ningxia china (common soil, depth 0-10cm, china, grazing exclusion, haplic calcisol, calci-orthic aridisol, ningxia province, yunwushan national natural grassland protection zone, 0-9 years of grazing exclusion)2021-08-08v4No1 / 1903
155amnoncommon in soil tightly bound to wheat root (common soil, triticum aestivum, wheat, root, china)2017-07-02v4No1 / 1977
175amnoncommon in heavy metal contaminated soils in china (common soil, heavy metal, ph 7-9, china)2017-07-29v4No1 / 2133
296amnoncommon agricultural feature, soil, winter, wheat, depth 0-20cm, north china plain, ph>7, ph<8, china2018-02-11v4No1 / 2160
353amnonlower in captive compared to wild caught Lissotriton vulgaris newts skin ( high in wild compared to research facility in skin adult cambridgeshire newt lissotriton vulgaris united kingdom )2018-07-30v4No1 / 2162
296amnoncommon in wheat field soil (common agricultural feature, soil, winter, depth 5cm, wheat, north china plain, china)2018-02-11v4No1 / 2341
155amnoncommon in soil loosely bound to wheat root (common soil, rhizosphere, triticum aestivum, wheat, china)2017-07-02v4No1 / 2425
296amnoncommon agricultural feature, soil, winter, wheat, depth 0-20cm, north china plain, ph>8, china2018-02-11v4No1 / 2646
271amnoncommon soil, depth 0-20cm, china2018-01-09v4No1 / 2856
296amnoncommon agricultural feature, soil, winter, wheat, depth 0-20cm, north china plain, ph>5, ph<6, china2018-02-11v4No1 / 3508
676amnon high in biofilm saline water biofilm compared to saline water sea water in fish farm aquarium french republic english channel coastal waters of france 2028-02-27v4No1 / 3904
837sheryoHigher in soil after 10 years reforestation with Black locust trees compared to agricultural feild, shaanxi, China ( high in reforestation robinia pseudoacacia 10 years compared to zea mays wheat agricultural field in soil silt loam china shaanxi province loess plateau )2021-09-26v4No1 / 3932
837sheryoHigher in soil after 30 years compared to 20 years of reforestation with Black locust trees, shaanxi, China ( high in 30 years compared to 20 years in soil silt loam reforestation china shaanxi province loess plateau robinia pseudoacacia )2021-09-27v4No1 / 3936
271amnon high in soil compared to rhizosphere glycine max soybean in depth 0-20cm china 2018-01-09v4No1 / 4853
837sheryoHigher in soil after 30 years compared to 10 years of reforestation with Black locust trees, shaanxi, China ( high in 30 years compared to 10 years in soil silt loam reforestation china shaanxi province loess plateau robinia pseudoacacia )2021-09-27v4No1 / 5245
837sheryoHigher in soil after 30 years reforestation with Black locust trees compared to agricultural feild, shaanxi, China ( high in reforestation robinia pseudoacacia 30 years compared to zea mays triticum aestivum agricultural field in soil silt loam china shaanxi province loess plateau )2021-09-27v4No1 / 5596
837sheryoHigher in soil after 20 years reforestation with Black locust trees compared agricultural feild, shaanxi, China ( high in reforestation robinia pseudoacacia 20 years compared to zea mays triticum aestivum agricultural field in soil silt loam china shaanxi province loess plateau )2021-09-26v4No1 / 5661
266amnon high in root compared to leaf in united states of america state of idaho plant brassicaceae boechera stricta 2017-12-19v4No1 / 5886
271amnon high in soil rhizosphere compared to root structure root in glycine max soybean depth 0-20cm china 2018-01-09v4No1 / 7954

Problems / suggestions? Please email info AT dbbact DOT org