Search result for sequence:
TACAGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGTGCGTAGACGGTTATGTAAGTCGGGTGTGAAAGCCCCGGGCTCAACCTGGGAATGCCATTCGAGACTGCATAGCTAGGGTGCGGAAGAGGGAAGCGGAATTTCCGG
common ontology terms
term enrichment score
TermScore
soil0.361375
topsoil0.253165
minas gerais state0.227848
campos rupestres0.227848
depth (soil) 10-25cm0.205882
cultivated environment0.193906
depth (soil) 0-10cm0.176768
rhizosphere0.169526
brazil0.168367
alabama0.164384
ultisol0.164384
forest ecosystem0.161074
auburn0.151899
ph 60.140845
vellozia epidendroides0.140845
kellogg biological station0.140845
mesic type hapludalf0.140845
kalamazoo loam0.140845
lushan mountain0.115942
mesocosm0.115942
restored prairie0.115942
forested area0.098765
depth (soil) 0-20cm0.097826
woodland area0.096386
jiangxi province0.094118
china0.092121
soybean0.091603
agricultural field0.090226
state of michigan0.090090
coarse-loamy soil0.089552
day 820.089552
upland soil0.089552
foot slope 0.089552
state of georgia0.086022
depth (soil) 0-5cm0.085714
ph 4.50.085714
glycine max0.083916
tree0.078947
LOWER IN root0.078947
ph 4-50.074534
farm0.072508
cinnamomum camphora0.063492
anxi county0.063492
yunnan province0.062500
taxus0.061538
taxus mairei0.061538
yellow brown soil0.061538
barbacenia macrantha0.061538
miscanthus0.061538
dekalb county0.061538
illinois0.061538
state of new york0.060000
paddy field soil0.059701
corn0.059701
depth (soil) 15-30cm0.059701
mollisol0.059701
hunan province0.058824
orchard0.057971
nanjing city prefecture0.057971
biochar0.057971
citrus0.056338
silt loam0.054795
oryza sativa0.053333
state of illinois0.051948
united states of america0.049275
root0.043956
LOWER IN rhizosphere0.037037
volcan sumaco0.032258
field soil0.031746
central park0.031746
southeast china0.031746
LOWER IN taxus media0.031746
LOWER IN taxus cuspidata0.031746
LOWER IN temperate0.031746
temperate0.031746
tomato0.031746
slit loam0.031746
kakadu national park0.031746
LOWER IN uranium0.031746
LOWER IN high uranium0.031746
ph 5.40.031746
moist tropical forest0.031746
montane forest0.031746
savanna0.031746
subtropical broadleaf forest biome0.031746
red soil0.031746
reunion island0.031746
fragaria x ananassa0.031746
strawberry0.031746
LOWER IN age 10 years0.031746
LOWER IN continuous cropping0.031746
populus0.031746
ph 3.50.031746
LOWER IN stover amended0.031746
elevation 200-300m0.031746
elevation 500-600m0.031746
elevation 800-900m0.031746
elevation 1300-1400m0.031746
cherokia georgiana georgiana0.031746
millipede0.031746
Fraction of dbbact annotations with this term covered by the query
TermScore
depth (soil) 10-25cm1.000000
volcan sumaco1.000000
cinnamomum camphora1.000000
anxi county1.000000
soybean0.666667
yunnan province0.666667
cultivated environment0.625000
topsoil0.555556
field soil0.500000
central park0.500000
taxus0.500000
taxus mairei0.500000
southeast china0.500000
LOWER IN taxus media0.500000
LOWER IN taxus cuspidata0.500000
LOWER IN temperate0.500000
temperate0.500000
tomato0.500000
slit loam0.500000
ph 60.500000
kakadu national park0.500000
LOWER IN uranium0.500000
LOWER IN high uranium0.500000
ph 5.40.500000
moist tropical forest0.500000
montane forest0.500000
savanna0.500000
subtropical broadleaf forest biome0.500000
red soil0.500000
reunion island0.500000
fragaria x ananassa0.500000
strawberry0.500000
yellow brown soil0.500000
LOWER IN age 10 years0.500000
LOWER IN continuous cropping0.500000
populus0.500000
minas gerais state0.500000
campos rupestres0.500000
ph 3.50.500000
vellozia epidendroides0.500000
barbacenia macrantha0.500000
coarse-loamy soil0.500000
day 820.500000
LOWER IN stover amended0.500000
lushan mountain0.500000
elevation 200-300m0.500000
elevation 500-600m0.500000
elevation 800-900m0.500000
elevation 1300-1400m0.500000
mesocosm0.500000
cherokia georgiana georgiana0.500000
millipede0.500000
kellogg biological station0.500000
mesic type hapludalf0.500000
kalamazoo loam0.500000
continuous corn0.500000
restored prairie0.500000
miscanthus0.500000
panicum virgatum0.500000
panax notoginseng0.500000
sanqi plants0.500000
xundian county0.500000
alabama0.500000
upland soil0.500000
ultisol0.500000
foot slope 0.500000
LOWER IN depth 50-90cm0.500000
depth 0-27cm0.500000
dekalb county0.500000
illinois0.500000
depth 0-560.500000
LOWER IN depth 56-1400.500000
stratovolcano0.500000
forest ecosystem0.444444
depth (soil) 0-10cm0.384615
nicotiana tabacum0.333333
park0.333333
ph<60.333333
LOWER IN ph&gt;60.333333
LOWER IN northeast china0.333333
subtropical0.333333
northeast china0.333333
hokkaido0.333333
cambisol0.333333
paddy field soil0.333333
hubei province0.333333
ph 4-60.333333
depth (soil) 0-5cm0.333333
unamended soil0.333333
ph 4.50.333333
coniferous forest biome0.333333
LOWER IN plant litter0.333333
plant litter0.333333
corn0.333333
depth (soil) 25-50cm0.333333
auburn0.333333
LOWER IN depth (soil) 25-50cm0.333333
depth (soil) 0-15cm0.333333
depth (soil) 15-30cm0.333333
mollisol0.333333
Fraction of annotations for the query sequences containing the term
TermScore
soil0.754098
china0.311475
united states of america0.278689
rhizosphere0.196721
brazil0.180328
topsoil0.163934
depth (soil) 0-20cm0.147541
minas gerais state0.147541
campos rupestres0.147541
depth (soil) 0-10cm0.114754
cultivated environment0.114754
depth (soil) 10-25cm0.114754
forest ecosystem0.098361
auburn0.098361
alabama0.098361
agricultural field0.098361
ultisol0.098361
ph 60.081967
vellozia epidendroides0.081967
state of michigan0.081967
kellogg biological station0.081967
mesic type hapludalf0.081967
kalamazoo loam0.081967
woodland area0.065574
farm0.065574
jiangxi province0.065574
lushan mountain0.065574
forested area0.065574
mesocosm0.065574
state of georgia0.065574
restored prairie0.065574
tree0.049180
glycine max0.049180
soybean0.049180
LOWER IN root0.049180
depth (soil) 0-5cm0.049180
state of new york0.049180
coarse-loamy soil0.049180
day 820.049180
ph 4.50.049180
upland soil0.049180
foot slope 0.049180
ph 4-50.049180
taxus0.032787
taxus mairei0.032787
LOWER IN rhizosphere0.032787
hunan province0.032787
citrus0.032787
orchard0.032787
paddy field soil0.032787
oryza sativa0.032787
yunnan province0.032787
yellow brown soil0.032787
nanjing city prefecture0.032787
root0.032787
barbacenia macrantha0.032787
biochar0.032787
corn0.032787
miscanthus0.032787
depth (soil) 15-30cm0.032787
dekalb county0.032787
illinois0.032787
state of illinois0.032787
mollisol0.032787
silt loam0.032787
cinnamomum camphora0.032787
anxi county0.032787
field soil0.016393
nicotiana tabacum0.016393
urban biome0.016393
park0.016393
new york city0.016393
central park0.016393
ph0.016393
ph<60.016393
LOWER IN ph&gt;60.016393
southeast china0.016393
LOWER IN taxus media0.016393
LOWER IN taxus cuspidata0.016393
LOWER IN northeast china0.016393
subtropical0.016393
LOWER IN temperate0.016393
northeast china0.016393
temperate0.016393
solanum lycopersicum0.016393
tomato0.016393
slit loam0.016393
australia0.016393
kakadu national park0.016393
sediment0.016393
control0.016393
LOWER IN uranium0.016393
LOWER IN high uranium0.016393
LOWER IN root structure0.016393
state of ohio0.016393
ph 50.016393
hokkaido0.016393
ph 5.40.016393
japan0.016393
moist tropical forest0.016393
Exp. ID User ID Description Date Region Flag Sequences
357amnoncommon in moist tropical forest topsoil around the world (common soil, topsoil, depth (soil) 0-10cm, moist tropical forest, woodland area, forest ecosystem)2018-08-18v4No1 / 171
548amnon high in rhizosphere compared to root in minas gerais state campos rupestres brazil vellozia epidendroides 2019-08-15v4No1 / 197
316amnoncommon united states of america, soil, topsoil, state of ohio, depth (soil) 0-10cm, ph 5, forest ecosystem2018-04-10v4No1 / 199
788amnoncommon plant litter, mesocosm, state of georgia, united states of america2021-05-31v4No1 / 259
548amnoncommon minas gerais state, campos rupestres, brazil, vellozia epidendroides, stem2019-08-17v4No1 / 431
412amnonlower in pig manured soil with wheat-maize rotation compared to non-manured soil ( high in non-manured soil compared to manured soil in soil hunan province red soil cambisol zea mays triticum aestivum china )2018-11-26v4No1 / 437
989amnon high in soil compared to rhizosphere in china farm ph 4-5 anxi county cinnamomum camphora depth (soil) 0-20cm 2022-12-26v3No1 / 448
823sheryoHigher in 10-25cm depth compared to 25-50cm depth in ultisol soil in auburn, alabama ( high in depth (soil) 10-25cm compared to depth (soil) 25-50cm in alabama auburn upland soil ultisol agricultural field soil )2021-08-07v3No1 / 455
964amnoncommon stratovolcano, ph 4-5, soil, depth (soil) 10-25cm, ecuador, volcan sumaco2022-12-21v3No1 / 472
548amnoncommon on leaf surface (common minas gerais state, campos rupestres, brazil, vellozia epidendroides, leaf)2019-08-17v4No1 / 548
548amnoncommon minas gerais state, campos rupestres, brazil, barbacenia macrantha, root endosphere, root2019-08-17v4No1 / 575
667amnoncommon depth (soil) 0-20cm, ph 4.5, elevation 500-600m, jiangxi province, lushan mountain, china, forested area, topsoil, soil2020-09-25v4No1 / 575
357amnoncommon soil, topsoil, depth (soil) 0-10cm, montane forest, woodland area, forest ecosystem2018-08-19v4No1 / 592
788amnoncommon cherokia georgiana georgiana, millipede, feces, mesocosm, state of georgia, united states of america2021-05-31v4No1 / 607
667amnoncommon depth (soil) 0-20cm, jiangxi province, lushan mountain, china, forested area, ph 4.5, elevation 200-300m, topsoil, soil2020-09-25v4No1 / 613
357amnoncommon soil, topsoil, depth (soil) 0-10cm, savanna, forest ecosystem, woodland area2018-08-19v4No1 / 614
829sheryoHigher in soil depth of 0-56cm compared to soil depth of 56-140cm in Mollisol soil, Dekalb, Illinois, united states of america ( high in depth 0-56 compared to depth 56-140 in united states of america soil silt loam mollisol state of illinois illinois dekalb county )2021-08-26v3No1 / 631
548amnoncommon minas gerais state, campos rupestres, brazil, barbacenia macrantha, rhizosphere2019-08-17v4No1 / 651
134amnon high in taxus mairei southeast china subtropical compared to taxus media taxus cuspidata northeast china temperate in rhizosphere tree taxus china 2017-04-16v4No1 / 694
667amnoncommon depth (soil) 0-20cm, elevation 800-900m, ph 4.5, jiangxi province, lushan mountain, china, forested area, topsoil, soil2020-09-25v4No1 / 694
415amnoncommon rhizosphere, soil, citrus, orchard, reunion island, cultivated environment2018-11-27v4No1 / 721
823sheryoCommon at 0-10cm depth in ultisol soil in auburn, alabama (common depth (soil) 0-10cm, auburn, alabama, upland soil, agricultural field, ultisol, soil)2021-08-07v3No1 / 730
823sheryoCommon at 10-25cm depth in ultisol soil in auburn, alabama (common depth (soil) 10-25cm, alabama, auburn, upland soil, ultisol, agricultural field, soil)2021-08-07v3No1 / 732
989amnoncommon depth (soil) 0-20cm, cinnamomum camphora, anxi county, ph 4-5, farm, china, soil2022-12-26v3No1 / 738
667amnoncommon depth (soil) 0-20cm, ph 4, elevation 1300-1400m, coniferous forest biome, jiangxi province, lushan mountain, china, forested area, topsoil, soil2020-09-25v4No1 / 777
752sheryoCommon in soil planted with Panax notoginseng amended with2% biochar (common biochar, panax notoginseng, sanqi plants, ph 6, xundian county, yunnan province, china, pot expreiment, soil)2021-03-11v3No1 / 783
829sheryoCommon in soil depth of 0-27cm in Mollisol soil, Dekalb, Illinois, united states of america (common depth 0-27cm, dekalb county, illinois, state of illinois, mollisol, silt loam, soil, united states of america)2021-08-26v3No1 / 798
548amnoncommon in endopytic roots of Vellozia epidendroides (common minas gerais state, campos rupestres, brazil, vellozia epidendroides, plant, root)2019-08-15v4No1 / 800
422amnoncommon soil, paddy field soil, oryza sativa, yunnan province, china, cultivated environment2018-12-02v4No1 / 821
356amnoncommon in deciduous broad leaved forest top soil in japan (common soil, depth (soil) 0-10cm, hokkaido, topsoil, ph 5.4, japan, forest ecosystem)2018-08-15v4No1 / 834
788amnoncommon soil, mesocosm, state of georgia, united states of america2021-05-31v4No1 / 897
548amnoncommon minas gerais state, campos rupestres, brazil, rock2019-08-17v4No1 / 924
821sheryoHigher at 10-25cm depth compared to 0-10cm depth in soil in Michigan USA ( high in depth (soil) 10-25cm compared to depth (soil) 0-10cm in restored prairie corn miscanthus panicum virgatum kellogg biological station mesic type hapludalf kalamazoo loam state of michigan soil united states of america )2021-08-05v4No1 / 930
359amnoncommon soil, topsoil, depth (soil) 0-10cm, guangdong province, subtropical broadleaf forest biome, china, forest ecosystem, woodland area2018-08-19v4No1 / 935
444amnoncommon in uncultivated soil plot (common yellow brown soil, nanjing city prefecture, soil, china)2019-01-07v4No1 / 946
821sheryoCommon in soil of restored prairie at 25-50cm depth, Michigan USA (common depth (soil) 25-50cm, restored prairie, united states of america, state of michigan, kellogg biological station, mesic type hapludalf, kalamazoo loam, soil)2021-07-28v4No1 / 968
823sheryoHigher at 15-30cm depth compared to 50-90cm depth in foot slope ultisol soil in auburn, alabama ( high in depth (soil) 15-30cm compared to depth 50-90cm in foot slope alabama auburn ultisol agricultural field soil )2021-08-08v3No1 / 968
134amnoncommon rhizosphere, tree, taxus, northeast china, temperate, taxus mairei, china2017-04-16v4No1 / 973
474amnoncommon soil, farm, glycine max, soybean, ph 4-6, brazil, cultivated environment2019-01-16v4No1 / 974
548amnoncommon minas gerais state, campos rupestres, brazil, rhizosphere, vellozia epidendroides2019-08-15v4No1 / 1040
415amnoncommon rhizosphere, soil, citrus, orchard, brazil, cultivated environment2018-11-27v4No1 / 1091
146amnon high in soil compared to rhizosphere in united states of america solanum lycopersicum tomato slit loam ph 6 2017-04-20v4No1 / 1135
823sheryoCommon at 0-15cm depth in foot slope ultisol soil in auburn, alabama (common foot slope , depth (soil) 0-15cm, alabama, auburn, ultisol, agricultural field, soil)2021-08-08v3No1 / 1199
823sheryoCommon at 15-30cm depth in foot slope ultisol soil in auburn, alabama (common depth (soil) 15-30cm, foot slope , alabama, auburn, ultisol, agricultural field, soil)2021-08-08v3No1 / 1218
444amnonlower in continuously cropped strawberry soil ( high in age 1 year compared to age 5 years age 10 years continuous cropping in rhizosphere fragaria x ananassa strawberry greenhouse soil farm yellow brown soil nanjing city prefecture china cultivated environment )2019-01-07v4No1 / 1221
821sheryoCommon in soil of restored prairie at 10-25cm depth, Michigan USA (common depth (soil) 10-25cm, restored prairie, united states of america, state of michigan, kellogg biological station, mesic type hapludalf, kalamazoo loam, soil)2021-07-28v4No1 / 1241
788amnon high in soil compared to plant litter in mesocosm state of georgia united states of america 2021-05-31v4No1 / 1280
600sheryoCommon in biochar ammended soil after 82 days (common depth (soil) 0-5cm, state of new york, soil, biochar, united states of america, coarse-loamy soil, ph 6, day 82)2020-03-27v4No1 / 1326
821sheryoCommon in soil of miscanthus field at 10-25cm depth, Michigan USA (common depth (soil) 10-25cm, miscanthus, restored prairie, united states of america, state of michigan, kellogg biological station, mesic type hapludalf, kalamazoo loam, soil)2021-08-02v4No1 / 1377
600sheryoCommon in unammended soil after 82 days (common depth (soil) 0-5cm, state of new york, soil, united states of america, coarse-loamy soil, ph 6, day 82)2020-03-27v4No1 / 1395
422amnoncommon soil, paddy field soil, oryza sativa, hunan province, hubei province, china, cultivated environment2018-12-02v4No1 / 1399
40amnoncommon soil, field soil, nicotiana tabacum, rhizosphere, china2016-12-09v4No1 / 1420
271amnoncommon depth (soil) 0-20cm, rhizosphere, glycine max, soybean, china2018-01-09v4No1 / 1459
548amnoncommon in phosphorus impoverished soil (common soil, minas gerais state, campos rupestres, brazil, ph 3.5)2019-08-15v4No1 / 1483
600sheryolower in stover ammendment soil ( high in unamended soil compared to stover amended in depth (soil) 0-5cm state of new york soil united states of america coarse-loamy soil ph 6 day 82 )2020-03-27v4No1 / 1612
821sheryoCommon in soil of continuous corn field at 10-25cm depth, Michigan USA (common depth (soil) 10-25cm, united states of america, state of michigan, kellogg biological station, mesic type hapludalf, kalamazoo loam, continuous corn, corn, soil)2021-07-28v4No1 / 1649
154amnon high in control compared to uranium high uranium in soil australia kakadu national park sediment 2017-06-29v4No1 / 1663
271amnoncommon depth (soil) 0-20cm, soil, china2018-01-09v4No1 / 2856
462amnon high in rhizosphere compared to root in united states of america state of tennessee populus tree cultivated environment 2019-01-13v4No1 / 4630
100amnon high in ph ph<6 compared to ph>6 in soil urban biome park new york city central park 2017-04-03v4No1 / 5770
271amnon high in soil rhizosphere compared to root structure root in depth (soil) 0-20cm glycine max soybean china 2018-01-09v4No1 / 7954

Problems / suggestions? Please email info AT dbbact DOT org