Search result for sequence:
TACAGAGGGTGCAAGCGTTAATCGGATTTACTGGGCGTAAAGCGCGCGTAGGCGGCTAATTAAGTCAAATGTGAAATCCCCGAGCTTAACTTGGGAATTGCATTCGATACTGGTTAGCTAGAGTGTGGGAGAGGATGGTAGAATTCCAGG
common ontology terms
term enrichment score
TermScore
skin0.258668
united states of america0.168737
bog lake0.150327
state of wisconsin0.130682
panama0.130286
whole body0.130031
rhizosphere0.123508
freshwater lake0.122667
soil0.112676
body proper0.110429
homo sapiens0.106645
china0.104895
brazil0.104197
costa rica0.101695
larval stage0.099338
frog0.093750
hypolimnion0.084507
ph 4.5-50.084507
mexico0.083333
leaf0.081553
ant0.078014
epilimnion0.078014
river0.076816
intestine0.070332
water0.070073
amphibian larval stage0.065814
dimictic lake0.064748
germany0.063892
cultivated environment0.063380
adult0.058374
LOWER IN soil0.058182
fire salamander0.057971
salamandra salamandra0.056338
fresh water0.054496
canada0.054496
depth 0-20cm0.051948
guanajuato0.051095
agave0.051095
meromictic lake0.051095
polymictic lake0.051095
new york city0.050663
mucus0.050663
child0.050378
stomach0.047619
desert0.044304
culicoides <genus>0.044118
biting midge0.044118
populus0.044118
research facility0.043796
beetle0.043165
silt loam0.043165
pair of nares0.042705
state of tennessee0.041379
tree0.041379
poland0.040541
israel0.038585
leaf surface0.037500
stream0.037383
toad0.037383
rana catesbeiana0.037383
bullfrog0.037383
nicotiana tabacum0.037383
carnivorous beetle0.037037
raba river0.037037
sand fly0.037037
shaanxi province0.037037
saliva0.036980
ph 60.036364
loess plateau0.036364
farm0.036364
agricultural field0.036036
food (fermented)0.035714
pond0.035398
city0.035242
digestive system0.033898
feces0.033520
brassica oleracea0.030075
myrtillocactus geometrizans0.029851
opuntia robusta0.029851
agave salmiana0.029851
lesser foam frog0.029851
"hells kitchen" lake0.029851
neve yaar0.029851
lithobates catesbeianus0.029851
"north sparkling bog" lake0.029851
cigar0.029851
tobacco0.029851
campinas0.029851
lushan mountain0.029851
LOWER IN root0.029520
cactus0.029412
semi-arid0.029412
saccharum0.029412
sugarcane0.029412
forested area0.029412
bird0.029268
french republic0.029126
greenhouse0.028986
jiangxi province0.028986
sweden0.027972
Fraction of dbbact annotations with this term covered by the query
TermScore
leaf surface0.750000
brassica oleracea0.666667
stream0.666667
amphibian larval stage0.666667
toad0.666667
rana catesbeiana0.666667
bullfrog0.666667
1-month-old human stage0.666667
nicotiana tabacum0.666667
arm0.666667
venezuela0.666667
amerindian0.666667
LOWER IN stem0.666667
panama0.600000
LOWER IN soil0.533333
LOWER IN lower respiratory tract disease0.500000
respiratory technology dependent0.500000
eleutherodactylus atkinsi0.500000
ant0.500000
pseudomyrmex spinicola0.500000
phyllosphere0.500000
heliconius erato0.500000
tropical and subtropical moist broadleaf forest biome0.500000
caterpillar0.500000
frass0.500000
pseudomyrmex elongatus0.500000
wild type0.500000
myrtillocactus geometrizans0.500000
opuntia robusta0.500000
ixodes scapularis0.500000
teneral adult0.500000
guanajuato0.500000
agave0.500000
agave salmiana0.500000
pseudomyrmex cubaensis0.500000
tomato0.500000
slit loam soil0.500000
pseudomyrmex nigropilosus0.500000
agave tequiliana0.500000
pseudomyrmex nigrocinctus0.500000
fire salamander0.500000
lesser treefrog0.500000
lesser foam frog0.500000
scinax perereca0.500000
bufo bufo0.500000
common toad0.500000
carnivorous beetle0.500000
raba river0.500000
paederidus rubrothoracicus0.500000
meromictic lake0.500000
hypolimnion0.500000
bog lake0.500000
"hells kitchen" lake0.500000
skin of face0.500000
skin under eyes0.500000
ph 6-6.50.500000
"mary lake"0.500000
neve yaar0.500000
loamy sand soil0.500000
contact lens0.500000
stagnant water0.500000
culicoides <genus>0.500000
biting midge0.500000
culicoides helicaniae0.500000
periodontal pocket0.500000
fungus growing ant0.500000
atta sexdens0.500000
lithobates catesbeianus0.500000
toronto zoo0.500000
nile tilapia0.500000
leptodactylus latrans0.500000
neonate stage0.500000
trachemys scripta elegans0.500000
red-eared slider turtle0.500000
turtle farm0.500000
age 0 days0.500000
culex coronator0.500000
mosquito0.500000
rhinella icterica0.500000
yellow cururu toad0.500000
dimictic lake0.500000
ph 4.5-50.500000
"north sparkling bog" lake0.500000
"south sparkling bog" lake0.500000
fruit0.500000
ants0.500000
odontomachus0.500000
culicoides batesi0.500000
epilimnion0.500000
lutzomyia gomezi0.500000
sand fly0.500000
psychodopygus panamensis0.500000
polymictic lake0.500000
"forestry bog" lake0.500000
pseudomyrmex simplex0.500000
anal swab0.500000
myotis myotis0.500000
bat0.500000
greater mouse eared bat0.500000
culicoides foxi0.500000
Fraction of annotations for the query sequences containing the term
TermScore
united states of america0.311538
skin0.180769
homo sapiens0.126923
china0.115385
soil0.100000
adult0.092308
rhizosphere0.088462
state of wisconsin0.088462
bog lake0.088462
freshwater lake0.088462
whole body0.080769
panama0.073077
body proper0.069231
brazil0.069231
frog0.057692
costa rica0.057692
larval stage0.057692
female0.053846
leaf0.046154
mexico0.046154
research facility0.046154
hypolimnion0.046154
water0.046154
ph 4.5-50.046154
ant0.042308
intestine0.042308
germany0.042308
river0.042308
epilimnion0.042308
stomach0.038462
feces0.038462
cultivated environment0.034615
amphibian larval stage0.034615
dimictic lake0.034615
child0.030769
salamandra salamandra0.030769
fire salamander0.030769
LOWER IN soil0.030769
fresh water0.030769
canada0.030769
depth 0-20cm0.030769
desert0.026923
guanajuato0.026923
agave0.026923
meromictic lake0.026923
new york city0.026923
mucus0.026923
polymictic lake0.026923
poland0.023077
beetle0.023077
israel0.023077
culicoides <genus>0.023077
biting midge0.023077
farm0.023077
pair of nares0.023077
saliva0.023077
state of tennessee0.023077
populus0.023077
tree0.023077
silt loam0.023077
control0.019231
digestive system0.019231
ph 60.019231
stream0.019231
toad0.019231
carnivorous beetle0.019231
raba river0.019231
leaf surface0.019231
agricultural field0.019231
rana catesbeiana0.019231
bullfrog0.019231
pond0.019231
sand fly0.019231
food (fermented)0.019231
nicotiana tabacum0.019231
city0.019231
shaanxi province0.019231
loess plateau0.019231
brassica oleracea0.015385
myrtillocactus geometrizans0.015385
opuntia robusta0.015385
cactus0.015385
semi-arid0.015385
agave salmiana0.015385
lesser foam frog0.015385
"hells kitchen" lake0.015385
neve yaar0.015385
lithobates catesbeianus0.015385
japan0.015385
state of texas0.015385
"north sparkling bog" lake0.015385
french republic0.015385
bird0.015385
sweden0.015385
cigar0.015385
tobacco0.015385
ocean0.015385
sea water0.015385
pacific ocean0.015385
greenhouse0.015385
Exp. ID User ID Description Date Region Flag Sequences
468amnonhigher in kids who did not develop LRI in trachea of children with respiratory technology dependence ( high in control compared to lower respiratory tract disease in homo sapiens united states of america trachea child tracheal aspirate respiratory technology dependent )2019-01-14v4No1 / 2
492amnoncommon skin, adult, cuba, frog, eleutherodactylus atkinsi2019-02-27v4No1 / 3
408amnon high in stomach compared to larval stage in united states of america costa rica ant pseudomyrmex spinicola 2018-11-22v4No1 / 5
52amnondominant homo sapiens, nipple, skin, state of california2017-01-19v4No1 / 6
156amnondominant leaf, brassica oleracea, brassica, phyllosphere, china2017-07-27v4No1 / 6
52amnoncommon homo sapiens, nipple, skin, state of california2017-01-19v4No1 / 7
118amnondominant feces, larval stage, panama, butterfly, heliconius erato, tropical and subtropical moist broadleaf forest biome, caterpillar, frass, forest ecosystem2017-04-11v4No1 / 7
408amnondominant united states of america, stomach, costa rica, ant, pseudomyrmex elongatus2018-11-22v4No1 / 7
5amnondominant periplaneta americana, digestive system, united states of america, wild type2016-10-13v4No1 / 8
129amnondominant rhizosphere, mexico, myrtillocactus geometrizans, opuntia robusta, cactus, semi-arid2017-04-15v4No1 / 8
262amnondominant research facility, larval stage, body proper, ixodes scapularis, tick2017-12-10v4No1 / 8
408amnoncommon united states of america, stomach, costa rica, crematogaster, ant2018-11-22v4No1 / 8
118amnonhigh freq. in captive raised teneral adult butterfly (dominant body proper, panama, butterfly, heliconius erato, whole body, tropical and subtropical moist broadleaf forest biome, teneral adult, forest ecosystem)2017-04-11v4No1 / 9
360amnondominant desert, soil, rhizosphere, mexico, guanajuato, agave, agave salmiana2018-08-21v4No1 / 9
408amnoncommon united states of america, stomach, costa rica, eciton, ant2018-11-22v4No1 / 9
408amnoncommon united states of america, stomach, costa rica, ant, pseudomyrmex elongatus2018-11-22v4No1 / 10
408amnoncommon united states of america, stomach, costa rica, ant, pseudomyrmex cubaensis2018-11-22v4No1 / 10
146amnondominant united states of america, rhizosphere, solanum lycopersicum, tomato, slit loam soil, ph 62017-04-20v4No1 / 11
408amnoncommon united states of america, stomach, costa rica, ant, pseudomyrmex spinicola2018-11-22v4No1 / 11
408amnoncommon united states of america, stomach, costa rica, ant, pseudomyrmex nigropilosus2018-11-22v4No1 / 11
492amnondominant skin, adult, cuba, frog, eleutherodactylus atkinsi2019-02-27v4No1 / 11
118amnoncommon feces, larval stage, panama, butterfly, heliconius erato, tropical and subtropical moist broadleaf forest biome, caterpillar, frass, forest ecosystem2017-04-11v4No1 / 12
360amnondominant desert, soil, rhizosphere, mexico, guanajuato, agave, agave tequiliana, cultivated environment2018-08-21v4No1 / 12
408amnoncommon united states of america, stomach, costa rica, ant, pseudomyrmex nigrocinctus2018-11-22v4No1 / 12
149amnondominant stream, larval stage, intestine, amphibian larval stage, germany, salamandra salamandra, fire salamander2017-04-24v4No1 / 13
408amnondominant united states of america, stomach, costa rica, crematogaster, ant2018-11-22v4No1 / 13
492amnondominant skin, adult, brazil, frog, dendropsophus minutus, lesser treefrog2019-02-27v4No1 / 13
492amnondominant skin, adult, brazil, frog, lesser foam frog, scinax perereca2019-02-27v4No1 / 13
492amnondominant skin, adult, germany, toad, bufo bufo, common toad2019-02-27v4No1 / 13
515amnondominant river, poland, whole body, beetle, carnivorous beetle, raba river, paederidus rubrothoracicus2019-04-18v4No1 / 13
718amnondominant united states of america, state of wisconsin, meromictic lake, hypolimnion, bog lake, freshwater lake, "hells kitchen" lake2028-05-23v4No1 / 13
58amnondominant homo sapiens, skin of face, new york city, skin under eyes2017-02-02v4No1 / 14
129amnon high in rhizosphere compared to soil in mexico myrtillocactus geometrizans opuntia robusta cactus semi-arid ph 6-6.5 2017-04-15v4No1 / 14
360amnondominant desert, leaf, mexico, guanajuato, agave, agave salmiana, leaf surface2018-08-21v4No1 / 14
718amnondominant united states of america, state of wisconsin, meromictic lake, hypolimnion, bog lake, freshwater lake, ph 5.5-6, "mary lake"2028-05-23v4No1 / 14
662amnondominant soil, israel, depth 0-10cm, irrigated, agricultural field, neve yaar, loamy sand soil2020-09-22v3No1 / 14
58amnondominant homo sapiens, new york city, contact lens2017-02-02v4No1 / 15
341amnonlower in fresh drinking water compared to week old water ( high in stagnant water compared to fresh water in united states of america water drinking water tap water state of illinois )2018-05-28v4No1 / 15
674amnondominant female, body proper, panama, whole body, culicoides <genus>, biting midge, culicoides helicaniae2020-09-28v4No1 / 15
162amnon high in control compared to periodontitis in homo sapiens united states of america dentition san diego subgingival plaque periodontal pocket mouth 2017-07-13v4No1 / 16
397amnondominant digestive system, intestine, panama, fungus growing ant, atta sexdens2018-11-14v4No1 / 16
492amnondominant skin, adult, rana catesbeiana, bullfrog, frog, lithobates catesbeianus, japan2019-02-27v4No1 / 16
492amnondominant skin, adult, brazil, rana catesbeiana, bullfrog, frog, lithobates catesbeianus2019-02-27v4No1 / 16
499amnondominant pond, water, fresh water, pond water, brazil2019-03-05v4No1 / 16
565amnondominant zoological garden, skin, captive, pongo abelii, canada, toronto zoo, sumatran orangutan2019-11-21v3No1 / 16
108amnonincreases during fasting in nile tilapia caecum ( high in fasting late timepoints compared to early timepoints in united states of america research facility caecum oreochromis niloticus state of texas nile tilapia )2017-04-07v4No1 / 17
492amnondominant skin, adult, brazil, frog, leptodactylus latrans, lesser foam frog2019-02-27v4No1 / 17
590amnondominant farm, intestine, neonate stage, china, hainan autonomous prefecture, trachemys scripta elegans, red-eared slider turtle, turtle farm, age 0 days2020-02-10v4No1 / 17
674amnondominant female, body proper, whole body, panama, culex coronator, mosquito2020-09-28v4No1 / 17
149amnondominant mucus, larval stage, amphibian larval stage, skin, germany, salamandra salamandra, fire salamander2017-04-24v4No1 / 18
492amnondominant skin, adult, brazil, rhinella icterica, toad, yellow cururu toad2019-02-27v4No1 / 18
718amnondominant united states of america, state of wisconsin, hypolimnion, dimictic lake, bog lake, freshwater lake, ph 4.5-5, "north sparkling bog" lake2028-05-23v4No1 / 18
718amnondominant united states of america, state of wisconsin, hypolimnion, dimictic lake, bog lake, freshwater lake, ph 4.5-5, "south sparkling bog" lake2028-05-23v4No1 / 18
662amnondominant in cucumber surface (dominant surface, fruit, cucumis sativus, israel, cucumber, neve yaar)2020-09-22v3No1 / 19
184amnoncommon digestive system, peru, ants, odontomachus2017-08-15v4No1 / 20
58amnoncommon homo sapiens, skin of face, new york city, skin under eyes2017-02-02v4No1 / 21
149amnondominant pond, larval stage, intestine, amphibian larval stage, germany, salamandra salamandra, fire salamander2017-04-24v4No1 / 21
674amnondominant female, body proper, panama, whole body, culicoides <genus>, culicoides batesi, biting midge2020-09-28v4No1 / 21
718amnondominant united states of america, state of wisconsin, epilimnion, dimictic lake, bog lake, freshwater lake, ph 4.5-5, "north sparkling bog" lake2028-05-23v4No1 / 21
674amnondominant female, body proper, panama, whole body, lutzomyia gomezi, sand fly2020-09-28v4No1 / 22
674amnondominant female, body proper, whole body, panama, psychodopygus panamensis, sand fly2020-09-28v4No1 / 22
718amnondominant united states of america, state of wisconsin, hypolimnion, polymictic lake, bog lake, freshwater lake, "forestry bog" lake, ph 4.5-52028-05-23v4No1 / 22
58amnoncommon homo sapiens, new york city, contact lens2017-02-02v4No1 / 23
408amnoncommon united states of america, larval stage, costa rica, ant, pseudomyrmex simplex2018-11-22v4No1 / 23
492amnoncommon skin, adult, brazil, rana catesbeiana, bullfrog, frog, lithobates catesbeianus2019-02-27v4No1 / 23
718amnondominant united states of america, state of wisconsin, meromictic lake, epilimnion, bog lake, freshwater lake, "hells kitchen" lake2028-05-23v4No1 / 23
489amnoncommon feces, french republic, anal swab, myotis myotis, bat, greater mouse eared bat2019-02-25v4No1 / 24
515amnoncommon river, poland, whole body, beetle, carnivorous beetle, raba river, paederidus rubrothoracicus2019-04-18v4No1 / 25
674amnondominant female, body proper, whole body, culicoides <genus>, panama, culicoides foxi, biting midge2020-09-28v4No1 / 25
718amnondominant united states of america, state of wisconsin, hypolimnion, polymictic lake, bog lake, freshwater lake, ph 5-5.5, "west sparkling bog" lake2028-05-23v4No1 / 25
674amnoncommon female, body proper, panama, whole body, lutzomyia gomezi, sand fly2020-09-28v4No1 / 27
674amnoncommon female, body proper, whole body, panama, nyssomyia trapidoi, sand fly2020-09-28v4No1 / 27
58amnoncommon homo sapiens, conjunctiva, new york city2017-02-02v4No1 / 28
397amnoncommon digestive system, intestine, panama, fungus growing ant, myrmicocrypta ednaella2018-11-14v4No1 / 28
193amnonlower in nares of people working in dairy farms ( high in control compared to farm bos taurus in homo sapiens united states of america pair of nares )2017-09-05v4No1 / 29
590amnoncommon farm, intestine, neonate stage, china, hainan autonomous prefecture, trachemys scripta elegans, red-eared slider turtle, turtle farm, age 0 days2020-02-10v4No1 / 29
492amnoncommon skin, adult, brazil, frog, lesser foam frog, scinax perereca2019-02-27v4No1 / 30
149amnoncommon pond, larval stage, intestine, amphibian larval stage, germany, salamandra salamandra, fire salamander2017-04-24v4No1 / 31
233amnon high in age age < 3 months compared to age > 3 months infant stage in feces homo sapiens united states of america infant 2017-11-05v4No1 / 31
262amnoncommon research facility, larval stage, body proper, ixodes scapularis, tick2017-12-10v4No1 / 31
492amnoncommon skin, adult, brazil, frog, dendropsophus minutus, lesser treefrog2019-02-27v4No1 / 31
674amnoncommon female, body proper, whole body, panama, culex coronator, mosquito2020-09-28v4No1 / 31
490amnonobserved in amniotic fluid and buffer and water controls (contamination)2019-02-25v4No1 / 32
492amnoncommon skin, adult, brazil, frog, leptodactylus latrans, lesser foam frog2019-02-27v4No1 / 34
674amnoncommon female, body proper, panama, whole body, psychodopygus panamensis, sand fly2020-09-28v4No1 / 34
48amnonlower in 3 months compared to 1 week in infant hypopharynx ( high in age age 1 week 1-month-old human stage compared to 3-month-old human stage in homo sapiens hypopharynx infant kingdom of denmark )2017-01-19v4No1 / 35
108amnoncommon united states of america, research facility, colon, state of texas, quail, coturnix coturnix2017-04-07v4No1 / 35
262amnonhigher in tick larvae fed on PIXR immunized mice compared to non immunized ( high in pixr immunized compared to control in research facility larval stage body proper ixodes scapularis tick )2017-12-10v4No1 / 35
350amnoncommon in feces of white faced capuchin from costa rica rain forest (common feces, costa rica, monkey, cebus capucinus, white-faced capuchin, woodland area)2018-07-30v4No1 / 35
539amnoncommon ethiopia, early timepoint, ensete ventricosum, ethiopian banana, days 1-15, aerobic fermentation, food (fermented)2019-07-31v4No1 / 35
79amnoncommon united states of america, skin, steno bredanensis, rough-toothed dolphin2017-03-03v4No1 / 35
674amnoncommon female, body proper, whole body, culicoides <genus>, panama, biting midge, culicoides helicaniae2020-09-28v4No1 / 36
674amnoncommon female, body proper, whole body, panama, culex declarator, mosquito2020-09-28v4No1 / 36
33amnoncommon homo sapiens, sputum, lung, bronchial epithelium, vancouver2016-12-06v4No1 / 40
79amnoncommon united states of america, skin, peponocephala electra2017-03-03v4No1 / 40
102amnonhigher in cheeks compared to teeth, saliva ( high in cheek compared to saliva dentition in homo sapiens united states of america atlanta mouth )2017-04-03v4No1 / 41
112amnoncommon research facility, intestine, danio rerio, zebra fish, china2017-04-09v4No1 / 41
79amnoncommon united states of america, skin, globicephala macrorhynchus, short finned pilot whale2017-03-03v4No1 / 42
587amnoncommon israel, food product type, vigna radiata, producer c1, mung bean sprouts2020-02-10v3No1 / 42
547amnon high in high salt concentration compared to low salt concentration in capsicum annuum sichuan province red pepper sauce food (fermented) china 2019-08-15v4No1 / 43
515amnoncommon river, poland, whole body, beetle, carnivorous beetle, raba river, paederidus ruficollis2019-04-18v4No1 / 45
302amnoncommon in feces of canary pet birds (common feces, mexico, bird, pet, serinus canaria, canary)2018-03-05v4No1 / 47
674amnoncommon female, body proper, panama, whole body, culicoides <genus>, culicoides batesi, biting midge2020-09-28v4No1 / 48
149amnoncommon mucus, larval stage, amphibian larval stage, skin, germany, salamandra salamandra, fire salamander2017-04-24v4No1 / 49
547amnoncommon capsicum annuum, sichuan province, red pepper sauce, food (fermented), china2019-08-15v4No1 / 49
674amnoncommon female, body proper, whole body, culicoides <genus>, panama, culicoides foxi, biting midge2020-09-28v4No1 / 49
79amnoncommon united states of america, skin, harbor seal, phoca vitulina2017-03-03v4No1 / 49
662amnoncommon in cucumber surface (common surface, fruit, cucumis sativus, israel, cucumber, neve yaar)2020-09-22v3No1 / 49
492amnoncommon skin, adult, chile, frog, eupsophus vertebralis2019-02-27v4No1 / 55
338amnon high in larval stage tadpole amphibian larval stage compared to adult in skin andrias japonicus japanese giant salamander japan 2018-05-21v4No1 / 59
149amnoncommon stream, larval stage, intestine, amphibian larval stage, germany, salamandra salamandra, fire salamander2017-04-24v4No1 / 60
600sheryoincearses after 12 days of unammendment in soil ( high in day 12 compared to day 1 in united states of america soil state of new york depth 0-5cm ph 6 coarse-loamy soil )2020-03-27v4No1 / 60
549amnoncommon puerto rico, isla palominos, coral, acropora cervicornis2019-08-17v4No1 / 62
587amnoncommon israel, food product type, vigna radiata, producer c2, mung bean sprouts2020-02-10v3No1 / 67
26amnoncommon homo sapiens, united states of america, mucus, pair of nares2016-12-05v4No1 / 73
299amnon high in control compared to mouth neoplasm cancer in homo sapiens saliva adult china 2018-02-27v4No1 / 75
596amnon high in under-1-year-old human stage compared to age 1-7 years 2-5 year-old child stage in homo sapiens saliva child sweden 2020-03-18v3No1 / 78
26amnoncommon united states of america, mucus, pair of nares, felis catus2016-12-05v4No1 / 80
108amnon high in caecum compared to colon in united states of america research facility oreochromis niloticus state of texas nile tilapia 2017-04-07v4No1 / 80
777amnon high in 18-month-old human stage compared to 3-year-old human stage in homo sapiens saliva child sweden municipality of umea 2021-04-26v3No1 / 83
539amnon high in ensete ventricosum var. maze compared to ensete ventricosum var. ketishe in ethiopia late timepoint ensete ventricosum ethiopian banana days 30-60 anaerobic fermentation food (fermented) 2019-07-31v4No1 / 84
718amnoncommon united states of america, state of wisconsin, hypolimnion, polymictic lake, bog lake, freshwater lake, "forestry bog" lake, ph 4.5-52028-05-23v4No1 / 85
26amnon high in mucus pair of nares compared to saliva mouth in united states of america felis catus 2016-12-05v4No1 / 86
353amnoncommon in captive Lissotriton vulgaris newts skin (common research facility, skin, adult, cambridgeshire, newt, lissotriton vulgaris, united kingdom)2018-07-30v4No1 / 86
354amnon high in bronchus bronchial epithelium bronchial brush compared to saliva oral wash in homo sapiens united states of america adult 2018-07-30v4No1 / 94
492amnoncommon skin, adult, brazil, rhinella icterica, toad, yellow cururu toad2019-02-27v4No1 / 95
718amnoncommon united states of america, state of wisconsin, epilimnion, polymictic lake, bog lake, freshwater lake, "forestry bog" lake, ph 4.5-52028-05-23v4No1 / 95
558amnon high in colon compared to caecum in united states of america state of wyoming bird centrocercus urophasianus greater sage-grouse 2019-09-20v4No1 / 97
360amnoncommon desert, soil, rhizosphere, mexico, guanajuato, agave, agave tequiliana, cultivated environment2018-08-21v4No1 / 98
99amnoncommon united states of america, mucus, skin, commonwealth of virginia, rana catesbeiana, bullfrog2017-04-02v4No1 / 99
787amnonlower in first 2 hours compared to 5-6 hours following eating ( high in 5-6 hours compared to 1-2 hours in research facility rumen ruminal fluid capra hircus china shanxi province goat dairy goat )2021-05-23v3No1 / 101
718amnon high in epilimnion compared to hypolimnion in united states of america state of wisconsin polymictic lake bog lake freshwater lake ph 4-4.5 "crystal bog" lake 2028-05-23v4No1 / 104
149amnon high in stream compared to pond in larval stage intestine amphibian larval stage germany salamandra salamandra fire salamander 2017-04-24v4No1 / 107
353amnonhigher in captive compared to wild caught Lissotriton vulgaris newts skin ( high in research facility compared to wild in skin adult cambridgeshire newt lissotriton vulgaris united kingdom )2018-07-30v4No1 / 110
536amnoncommon united states of america, skin, snake, southern united states, thamnophis sirtalis, common garter snake2019-07-28v4No1 / 110
539amnon high in early timepoint days 1-15 aerobic fermentation compared to late timepoint days 30-60 anaerobic fermentation in ethiopia ensete ventricosum ethiopian banana food (fermented) 2019-07-31v4No1 / 110
536amnoncommon united states of america, skin, snake, southern united states, aquatic snake, nerodia sipedon, northern water snake2019-07-28v4No1 / 111
718amnoncommon united states of america, state of wisconsin, epilimnion, dimictic lake, bog lake, freshwater lake, ph 4.5-5, "north sparkling bog" lake2028-05-23v4No1 / 112
718amnoncommon united states of america, state of wisconsin, hypolimnion, polymictic lake, bog lake, freshwater lake, ph 5-5.5, "west sparkling bog" lake2028-05-23v4No1 / 112
79amnoncommon united states of america, skin, delphinus delphis2017-03-03v4No1 / 113
492amnoncommon skin, adult, germany, toad, bufo bufo, common toad2019-02-27v4No1 / 115
758amnoncommon in cigar tobacco (common nicotiana tabacum, cigar, tobacco, cheyenne menthol box cigar)2021-03-28v3No1 / 115
195amnoncommon in boston subway surfaces (common city, urban biome, boston, train)2017-09-07v4No1 / 116
149amnonhigher in larvae transferred to stream compared to pond ( high in stream compared to pond in mucus larval stage amphibian larval stage skin germany salamandra salamandra fire salamander )2017-04-24v4No1 / 117
343amnoncommon in apple flowers (common united states of america, flower structure, malus x domestica, state of connecticut, flower, apple)2018-05-28v4No1 / 118
777amnon high in 5-year-old human stage compared to 3-year-old human stage in homo sapiens saliva child sweden municipality of umea 2021-04-26v3No1 / 120
374amnoncommon skin, costa rica, amphibia, rhaebo haematiticus, truando toad, toad2018-09-09v4No1 / 121
718amnoncommon united states of america, state of wisconsin, epilimnion, dimictic lake, bog lake, freshwater lake, ph 4.5-5, "trout bog" lake2028-05-23v4No1 / 121
590amnoncommon in turtle pond water (common farm, water, pond water, china, hainan autonomous prefecture, turtle farm)2020-02-10v4No1 / 127
758amnoncommon in cigar tobacco (common nicotiana tabacum, cigar, tobacco, swisher sweets original cigar)2021-03-28v3No1 / 127
374amnoncommon skin, costa rica, frog, amphibia, craugastor fitzingeri, common rain frog2018-09-09v4No1 / 136
718amnoncommon united states of america, state of wisconsin, epilimnion, polymictic lake, bog lake, freshwater lake, ph 4-4.5, "crystal bog" lake2028-05-23v4No1 / 141
291amnoncommon nasal cavity, pair of nares, canis lupus familiaris, germany, dog2018-02-01v4No1 / 144
29amnoncommon brassica oleracea, french republic, seed2016-12-05v4No1 / 146
475amnoncommon in air next to subway stations in hong kong (common city, air, hong kong)2019-01-20v4No1 / 147
758amnoncommon in cigar tobacco (common nicotiana tabacum, cigar, tobacco, swisher sweets sweet cherry cigar)2021-03-28v3No1 / 154
273amnon high in age 1-month-old human stage compared to 1-year-old human stage in feces homo sapiens infant kingdom of denmark 2018-01-14v4No1 / 155
108amnon high in colon compared to caecum in united states of america research facility state of texas quail coturnix coturnix 2017-04-07v4No1 / 157
475amnoncommon in air in subway train in hong kong (common city, air, hong kong, subway)2019-01-20v4No1 / 161
121amnonhigh in diarrhea compared to recovery period ( high in diarrhea compared to control in feces homo sapiens adult bangladesh )2017-04-13v4No1 / 162
337amnoncommon in feces of house mice from new york city (common united states of america, city, mus musculus, new york city, mouse, house mice)2018-05-18v4No1 / 165
232amnoncoomon in foot of healthy controls (common homo sapiens, skin, foot, australia)2017-11-05v4No1 / 166
718amnoncommon united states of america, state of wisconsin, epilimnion, dimictic lake, bog lake, freshwater lake, ph 4.5-5, "south sparkling bog" lake2028-05-23v4No1 / 167
374amnoncommon skin, costa rica, frog, amphibia, craugastor bransfordii, bransford’s litter frog2018-09-09v4No1 / 171
534amnoncommon river, water, fresh water, nepal, free floating, depth 10 cm, filtered 0.2um, koshi river2019-07-22v4No1 / 172
565amnoncommon zoological garden, skin, captive, pongo abelii, canada, toronto zoo, sumatran orangutan2019-11-21v3No1 / 174
718amnoncommon united states of america, state of wisconsin, meromictic lake, epilimnion, bog lake, freshwater lake, "hells kitchen" lake2028-05-23v4No1 / 179
604amnoncommon research facility, caecum, gallus gallus, chicken, cecal content, china2020-04-06v3No1 / 185
567amnon high in pair of nares anterior naris compared to nasopharynx in homo sapiens adult belgium 2019-12-05v4No1 / 186
75amnoncommon homo sapiens, arm, skin, venezuela, amerindian, hunter gatherer2017-02-27v4No1 / 190
170amnoncommon united states of america, river, stream, water, fresh water, depth 10 cm2017-07-24v4No1 / 194
371amnoncommon homo sapiens, skin, venezuela, amerindian, hunter gatherer2018-09-06v4No1 / 195
371amnonlower in skin of amerindians compared to western visitors ( high in united states of america city compared to venezuela amerindian hunter gatherer in homo sapiens skin )2018-09-06v4No1 / 195
600sheryoIncearses after 12 days of stover ammendment in soil ( high in day 12 compared to day 1 in united states of america soil state of new york depth 0-5cm ph 6 coarse-loamy soil stover ammendment soil )2020-03-27v4No1 / 196
718amnoncommon united states of america, state of wisconsin, hypolimnion, dimictic lake, bog lake, freshwater lake, ph 4.5-5, "trout bog" lake2028-05-23v4No1 / 196
515amnoncommon river, poland, whole body, beetle, bembidion decorum, carnivorous beetle, raba river2019-04-18v4No1 / 198
718amnoncommon united states of america, state of wisconsin, meromictic lake, epilimnion, bog lake, freshwater lake, ph 5.5-6, "mary lake"2028-05-23v4No1 / 204
515amnon high in poland herbivorous beetle compared to bulgaria detritivorous beetle in whole body beetle 2019-04-19v4No1 / 205
718amnoncommon united states of america, state of wisconsin, hypolimnion, dimictic lake, bog lake, freshwater lake, ph 4.5-5, "south sparkling bog" lake2028-05-23v4No1 / 211
138amnoncommon in ocean water depth 5m (common ocean, sea water, pacific ocean, depth 5m)2017-04-18v4No1 / 214
499amnoncommon pond, water, fresh water, pond water, brazil2019-03-05v4No1 / 228
492amnoncommon skin, adult, rana catesbeiana, bullfrog, frog, lithobates catesbeianus, japan2019-02-27v4No1 / 236
384amnon high in pasture compared to hay barn in farm saliva equus caballus canada horse mouth 2018-10-22v4No1 / 245
253amnoncommon in clouds in puy de dome mountain in france (common air, french republic, autumn, cloud)2017-11-22v4No1 / 267
156amnoncommon leaf, brassica oleracea, brassica, phyllosphere, china2017-07-27v4No1 / 292
37amnoncommon in plastic leaf plants (in field next to tomato plants) (common leaf, maryland county)2016-12-09v4No1 / 298
237amnonlower in burrow soil compared to bird ( high in bird oceanodroma leucorhoa seabird compared to soil burrow in canada bon portage island )2017-11-07v4No1 / 298
499amnoncommon digestive system, pond, intestine, poecilia reticulata, brazil, fish, guppy2019-03-05v4No1 / 308
515amnoncommon river, poland, whole body, beetle, carnivorous beetle, raba river, bembidion varicolor2019-04-18v4No1 / 308
534amnoncommon river, water, fresh water, nepal, depth 10 cm, filtered 2.7um, particle bound, koshi river2019-07-22v4No1 / 315
650amnon high in asian compared to caucasian european in feces homo sapiens united states of america adult state of new york 2020-09-12v4No1 / 317
615amnon high in leaf leaf surface compared to stem upper stem stem surface in brazil greenhouse exosphere campinas saccharum sugarcane 2020-04-27v4No1 / 321
311amnoncommon in floor of kimchi production facility (common united states of america, food processing factory, state of rhode island, floor)2018-04-09v4No1 / 324
338amnonlower in wild salamanders compared to zoo grown salamanders ( high in zoological garden zoo compared to pond area designated as a nature reserve in skin andrias japonicus japanese giant salamander japan )2018-05-21v4No1 / 334
443amnonlower in lower mississippi river (downstream) compared to upper mississippi river ( high in upstream upper mississippi river compared to downstream lower mississippi river in united states of america river water fresh water mississippi river free floating depth 1m filtered 0.2um )2019-01-07v4No1 / 335
129amnoncommon rhizosphere, mexico, myrtillocactus geometrizans, opuntia robusta, cactus, semi-arid2017-04-15v4No1 / 338
254amnoncommon river, water, fresh water, fujian province, depth 0.5m, jiulong river, china2017-11-23v4No1 / 347
29amnon high in seed compared to seedling in brassica oleracea french republic 2016-12-05v4No1 / 379
256amnonhigher in small intestine compared to colon in pigs ( high in duodenum jejunum ileum compared to caecum left colon right colon in sus scrofa pig united kingdom )2017-11-26v4No1 / 387
718amnoncommon united states of america, state of wisconsin, meromictic lake, hypolimnion, bog lake, freshwater lake, "hells kitchen" lake2028-05-23v4No1 / 400
662amnoncommon soil, israel, depth 0-10cm, irrigated, agricultural field, clay soil, neve yaar2020-09-21v3No1 / 402
558amnon high in gizzard compared to crop in united states of america state of wyoming bird centrocercus urophasianus greater sage-grouse 2019-09-20v4No1 / 408
443amnonlower in lower mississippi river (downstream) compared to upper mississippi river ( high in upstream upper mississippi river compared to downstream lower mississippi river in united states of america river water fresh water mississippi river particles depth 1m filtered 2.7um )2019-01-07v4No1 / 425
360amnoncommon desert, soil, rhizosphere, mexico, guanajuato, agave, agave salmiana2018-08-21v4No1 / 484
718amnon high in epilimnion compared to hypolimnion in united states of america state of wisconsin dimictic lake bog lake freshwater lake ph 4.5-5 "north sparkling bog" lake 2028-05-23v4No1 / 488
360amnoncommon desert, leaf, mexico, guanajuato, agave, agave salmiana, leaf surface2018-08-21v4No1 / 492
352amnon high in small intestine duodenum compared to feces in homo sapiens new delhi india 2018-07-30v4No1 / 545
548amnoncommon in leaf surface of barbacenia macrantha (common leaf, brazil, minas gerais state, leaf surface, campos rupestres, barbacenia macrantha)2019-08-17v4No1 / 550
462amnon high in populus deltoides compared to populus trichocarpa x deltoides in united states of america state of tennessee leaf populus tree cultivated environment 2019-01-13v4No1 / 559
718amnoncommon united states of america, state of wisconsin, meromictic lake, hypolimnion, bog lake, freshwater lake, ph 5.5-6, "mary lake"2028-05-23v4No1 / 559
138amnoncommon in ocean water depth 1000m (common ocean, sea water, pacific ocean, depth 1000m)2017-04-18v4No1 / 566
667amnoncommon soil, topsoil, jiangxi province, ph 4.5, depth 0-20cm, forested area, china, lushan mountain, elevation 500-600m2020-09-25v4No1 / 575
138amnoncommon in ocean water depth 150-500m (common ocean, sea water, pacific ocean, depth 150-500m)2017-04-18v4No1 / 582
777amnon high in child 18-month-old human stage compared to infant 3-month-old human stage in homo sapiens saliva sweden municipality of umea 2021-04-26v3No1 / 583
146amnon high in rhizosphere compared to soil in united states of america solanum lycopersicum tomato ph 6 slit loam 2017-04-20v4No1 / 590
667amnoncommon soil, topsoil, jiangxi province, ph 4.5, depth 0-20cm, forested area, china, elevation 200-300m, lushan mountain2020-09-25v4No1 / 613
425amnon high in duodenum compared to feces in homo sapiens child africa 2018-12-08v4No1 / 622
667amnoncommon soil, topsoil, jiangxi province, depth 0-20cm, forested area, coniferous forest biome, china, lushan mountain, elevation 1000-1100m, ph 4-4.52020-09-25v4No1 / 630
360amnonhigher in leaf surface compared to soil in agave plants ( high in leaf leaf surface compared to soil in desert state of california mexico guanajuato agave )2018-08-21v4No1 / 645
138amnoncommon in ocean water depth 2000-4000m (common ocean, sea water, pacific ocean, depth 2000-4000m)2017-04-18v4No1 / 674
100amnoncommon park, soil, urban biome, new york city, central park2017-04-03v4No1 / 685
667amnoncommon soil, topsoil, jiangxi province, ph 4.5, depth 0-20cm, forested area, china, lushan mountain, elevation 800-900m2020-09-25v4No1 / 694
758amnon high in swisher sweets original cigar swisher sweets sweet cherry cigar compared to cheyenne full flavor cigar cheyenne menthol box cigar in nicotiana tabacum cigar tobacco 2021-03-28v3No1 / 710
271amnon high in rhizosphere glycine max soybean compared to soil in depth 0-20cm china 2018-01-09v4No1 / 750
615amnoncommon brazil, endosphere, greenhouse, root, campinas, saccharum, sugarcane2020-04-27v4No1 / 776
517amnon high in arm skin forearm compared to feces in homo sapiens child bolivia chuquisaca department rural community age 5-13 years 2019-05-29v4No1 / 836
265amnoncommon water, canada, province of quebec, soilwater2017-12-11v4No1 / 841
767sheryoCommon in soil planted with Chrysanthemum, fertilized with bio-organic fertilizer in Nanjing China (common soil, compost biofilter, compost, pig manure, paenibacillus, china, nanjing county, chrysanthemum, bio-organic fertilizer, chrysanthemum morifolium ramat., ph 6.9, paenibacillus polymyxa)2021-04-14v4No1 / 866
129amnoncommon soil, mexico, myrtillocactus geometrizans, opuntia robusta, cactus, semi-arid, ph 6-6.52017-04-15v4No1 / 884
462amnon high in leaf compared to stem in united states of america state of tennessee populus tree cultivated environment 2019-01-13v4No1 / 890
146amnoncommon united states of america, rhizosphere, solanum lycopersicum, tomato, slit loam soil, ph 62017-04-20v4No1 / 894
462amnoncommon united states of america, state of tennessee, rhizosphere, populus, tree, silt clay loam, depth 30-75cm, cultivated environment2019-01-13v4No1 / 908
767sheryoCommon in soil planted with Chrysanthemum, amended with soil fumigant 'Dazomet' in Nanjing China (common soil, china, nanjing county, chrysanthemum, chrysanthemum morifolium ramat., ph 6.9, soil fumigation, dazomet)2021-04-14v4No1 / 946
37amnonlower in tomato plant leaves compared to plastic control ( high in control compared to solanum lycopersicum in leaf maryland county )2016-12-09v4No1 / 950
615amnoncommon rhizosphere, brazil, greenhouse, campinas, saccharum, sugarcane2020-04-27v4No1 / 974
462amnoncommon united states of america, state of tennessee, rhizosphere, populus, tree, depth 0-30cm, silt loam, cultivated environment2019-01-13v4No1 / 997
517amnon high in arm skin forearm compared to mouth mucosa mouth in homo sapiens child bolivia chuquisaca department rural community age 5-13 years 2019-05-29v4No1 / 1014
618amnon high in early flowering stage compared to late flowering stage in farm rhizosphere canada cannabis sativa 2020-05-04v4No1 / 1040
454amnon high in wild compared to captive in feces elaphurus davidianus pere deer deer china 2019-01-10v4No1 / 1094
415amnoncommon orchard, soil, rhizosphere, kingdom of spain, citrus, cultivated environment2018-11-27v4No1 / 1099
266amnon high in leaf compared to root in united states of america state of idaho plant brassicaceae boechera stricta 2017-12-19v4No1 / 1175
615amnon high in rhizosphere compared to soil in brazil greenhouse campinas saccharum sugarcane 2020-04-27v4No1 / 1181
423amnon high in no human contact chernobyl exclusion zone compared to human contact in skin ukraine bank vole myodes glareolus 2018-12-05v4No1 / 1229
40amnoncommon soil, field soil, rhizosphere, nicotiana tabacum, china2016-12-09v4No1 / 1420
462amnon high in rhizosphere compared to soil in united states of america state of tennessee populus tree cultivated environment 2019-01-12v4No1 / 1428
271amnoncommon rhizosphere, glycine max, soybean, depth 0-20cm, china2018-01-09v4No1 / 1459
686sheryoCommon in vanilla field soil infected with Fusarium oxysporum, fertilized with fungal bio-fertilizer and had low Fusarium cumulative disease incidence (common wanning city, vanilla planifolia, ph 7.6, pot expreiment, soil from vanilla field, fusarium oxysporum f. sp. vanillae, low fusarium cumulative disease incidence , fungal enriched bio-fertilizer, trichoderma guizhouense njau 4742)2028-03-08v4No1 / 1661
686sheryoCommon in vanilla field soil infected with Fusarium oxysporum, fertilized with organic fertilizer and had high Fusarium cumulative disease incidence (common wanning city, vanilla planifolia, ph 7.6, pot expreiment, soil from vanilla field, fusarium oxysporum f. sp. vanillae, high fusarium cumulative disease incidence , organic fertilizer- chicken manure compost)2028-03-08v4No1 / 1765
536amnon high in aquatic snake compared to terrestrial snake in united states of america skin snake southern united states 2019-07-28v4No1 / 1772
175amnoncommon in heavy metal contaminated soils in china (common soil, heavy metal, ph 7-9, china)2017-07-29v4No1 / 2133
271amnoncommon soil, depth 0-20cm, china2018-01-09v4No1 / 2856
837sheryoHigher in soil of agricultural feild compared to after 20 years reforestation with Black locust trees , shaanxi, China ( high in zea mays triticum aestivum agricultural field compared to reforestation robinia pseudoacacia 20 years in soil silt loam china shaanxi province loess plateau )2021-09-26v4No1 / 2892
837sheryoHigher in soil of agricultural feild compared to after 30 years reforestation with Black locust trees , shaanxi, China ( high in zea mays triticum aestivum agricultural field compared to reforestation robinia pseudoacacia 30 years in soil silt loam china shaanxi province loess plateau )2021-09-27v4No1 / 2927
837sheryoHigher in soil in agricultural feild compared after 10 years reforestation with Black locust trees, shaanxi, China ( high in zea mays triticum aestivum agricultural field compared to reforestation robinia pseudoacacia 10 years in soil silt loam china shaanxi province loess plateau )2021-09-26v4No1 / 2994
618amnon high in rhizosphere compared to root endosphere root in farm canada cannabis sativa 2020-05-04v4No1 / 3134
265amnon high in water soilwater compared to soil in canada province of quebec 2017-12-11v4No1 / 3277
837sheryoHigher in soil after 10 years compared to 30 years of reforestation with Black locust trees, shaanxi, China ( high in 10 years compared to 30 years in soil silt loam reforestation china shaanxi province loess plateau robinia pseudoacacia )2021-09-27v4No1 / 3368
837sheryoHigher in soil after 20 years compared to 30 years of reforestation with Black locust trees, shaanxi, China ( high in 20 years compared to 30 years in soil silt loam reforestation china shaanxi province loess plateau robinia pseudoacacia )2021-09-27v4No1 / 3893
462amnon high in rhizosphere compared to root in united states of america state of tennessee populus tree cultivated environment 2019-01-13v4No1 / 4630
271amnon high in soil rhizosphere compared to root structure root in glycine max soybean depth 0-20cm china 2018-01-09v4No1 / 7954

Problems / suggestions? Please email info AT dbbact DOT org