Search result for sequence:
TACAGAGGGTGCAAGCGTTAATCGGATTTACTGGGCGTAAAGCGCGCGTAGGTGGCCAATTAAGTCAAATGTGAAATCCCCGAGCTTAACTTGGGAATTGCATTCGATACTGGTTGGCTAGAGTATGGGAGAGGATGGTAGAATTCCAGG
common ontology terms
term enrichment score
TermScore
skin0.262107
united states of america0.186762
canada0.183246
china0.156788
beetle0.118694
whole body0.113055
farm0.109739
homo sapiens0.107413
zoological garden0.103659
pair of nares0.090420
research facility0.090127
captive0.086260
ant0.085809
bulgaria0.079734
detritivorous beetle0.079734
nasal cavity0.079103
water0.077230
feces0.074640
balkan mountains0.073579
costa rica0.070652
fresh water0.069731
adult0.069543
river0.066445
italy0.065990
horse0.065862
equus caballus0.065147
soil0.063673
larval stage0.061792
poland0.059211
bird0.058632
stomach0.057508
israel0.057098
state of california0.049231
LOWER IN feces0.046980
bos taurus0.046543
leaf0.044872
rhizosphere0.043836
state of florida0.042489
dust0.041958
equus asinus africanus0.041958
mucus0.041739
mexico0.041237
child0.041176
french republic0.040886
duodenum0.040886
air0.040678
plant0.039867
city0.039280
floor0.035149
arm0.035149
nida basin0.034843
herbivorous beetle0.034843
barn0.034843
food product type0.034843
hay0.034247
province of ontario0.034247
felis catus0.034247
LOWER IN saliva0.034130
nasopharynx0.034052
epidermis0.033670
sus scrofa0.033670
pig0.033670
desert0.033670
kingdom of spain0.033113
rural community0.033113
gallus gallus0.031546
chicken0.031546
wild0.031546
australia0.030120
donkey0.028269
LOWER IN mouth0.028169
age 90 weeks0.028070
kenya0.028070
forearm0.028070
chuquisaca department0.028070
vigna radiata0.028070
mung bean sprouts0.028070
toronto zoo0.028070
bon portage island0.028070
oceanodroma leucorhoa0.028070
seabird0.028070
african lion safari0.028070
leaf surface0.028070
spring water0.028070
reforestation0.028070
shaanxi province0.028070
robinia pseudoacacia0.028070
depth 10 cm0.027875
belgium0.027810
foot0.027682
age 5-13 years0.027682
loess plateau0.027682
cat0.027491
bolivia0.027304
ileum0.026936
japan0.026936
LOWER IN caecum0.026696
breast milk0.026578
united kingdom0.026578
silt loam0.026578
Fraction of dbbact annotations with this term covered by the query
TermScore
dust0.666667
floor0.666667
influent0.666667
equus asinus africanus0.666667
donkey0.666667
arm0.666667
stream0.666667
ice0.666667
endosphere0.666667
state of idaho0.666667
LOWER IN nasopharynx0.666667
LOWER IN 1-month-old human stage0.666667
LOWER IN stem0.666667
venezuela0.666667
amerindian0.666667
cactus0.666667
skin0.575758
LOWER IN mouth0.571429
mucus0.571429
cleanroom0.500000
nida basin0.500000
herbivorous beetle0.500000
polydrusus inustus0.500000
biomat0.500000
microbial biomat0.500000
water treatment pond0.500000
benthic biomat0.500000
engineered wetland0.500000
uterine tube infundibulum0.500000
age 90 weeks0.500000
ant0.500000
pseudomyrmex gracilis0.500000
kenya0.500000
masai mara national park0.500000
cattle0.500000
connochaetes taurinus0.500000
blue wildebeest0.500000
onthophagus taurus0.500000
bulgaria0.500000
balkan mountains0.500000
detritivorous beetle0.500000
pheidole0.500000
ukraine0.500000
bank vole0.500000
myodes glareolus0.500000
aphodius pusillus0.500000
ryegrass0.500000
days 30-400.500000
tropical grassland biome0.500000
nanger granti0.500000
gazelle0.500000
pseudomyrmex elongatus0.500000
barn0.500000
pseudomyrmex nigrocinctus0.500000
centricnemus leucogrammus0.500000
milk0.500000
cow milk (fluid)0.500000
cow milk (raw)0.500000
lowland pasture0.500000
lowland farm0.500000
plantar part of pes0.500000
bottom of foot0.500000
hirundo rustica0.500000
barn swallow0.500000
calve0.500000
onthophagus similis0.500000
forearm0.500000
chuquisaca department0.500000
african wild ass0.500000
pygoscelis antarcticus0.500000
chinstrap penguin0.500000
interdigital region0.500000
pseudomyrmex flavicornis0.500000
aphodius haemorrhoidalis0.500000
onthophagus ovatus0.500000
food product type0.500000
vigna radiata0.500000
producer c10.500000
mung bean sprouts0.500000
equus asinus0.500000
toronto zoo0.500000
bon portage island0.500000
oceanodroma leucorhoa0.500000
seabird0.500000
maojian district0.500000
andrias davidianus0.500000
chinese giant salamander0.500000
pseudomyrmex nigropilosus0.500000
pseudomyrmex simplex0.500000
tapirus terrestris0.500000
south american tapir0.500000
age <= 24 hours0.500000
age 60 weeks0.500000
hippopotamus amphibius0.500000
lama guanicoe0.500000
kebbi state0.500000
schistosomiasis0.500000
urinary schistosomiasis0.500000
producer c20.500000
LOWER IN amphibian larval stage0.500000
Fraction of annotations for the query sequences containing the term
TermScore
united states of america0.263538
skin0.169675
feces0.151625
china0.148014
homo sapiens0.148014
canada0.126354
research facility0.079422
whole body0.075812
beetle0.072202
farm0.072202
adult0.072202
zoological garden0.061372
soil0.050542
pair of nares0.050542
captive0.050542
water0.050542
costa rica0.046931
ant0.046931
italy0.046931
bulgaria0.043321
detritivorous beetle0.043321
nasal cavity0.043321
balkan mountains0.039711
fresh water0.039711
larval stage0.036101
equus caballus0.036101
horse0.036101
river0.036101
poland0.032491
stomach0.032491
israel0.032491
bird0.032491
state of california0.028881
rhizosphere0.028881
bos taurus0.025271
child0.025271
LOWER IN feces0.025271
leaf0.025271
state of florida0.025271
dust0.021661
plant0.021661
french republic0.021661
equus asinus africanus0.021661
air0.021661
duodenum0.021661
mucus0.021661
city0.021661
mexico0.021661
floor0.018051
nida basin0.018051
herbivorous beetle0.018051
gallus gallus0.018051
chicken0.018051
wild0.018051
australia0.018051
hay0.018051
barn0.018051
province of ontario0.018051
epidermis0.018051
kingdom of spain0.018051
arm0.018051
rural community0.018051
felis catus0.018051
nasopharynx0.018051
food product type0.018051
LOWER IN saliva0.018051
sus scrofa0.018051
pig0.018051
desert0.018051
adult organism0.014440
age 90 weeks0.014440
kenya0.014440
foot0.014440
donkey0.014440
breast milk0.014440
forearm0.014440
bolivia0.014440
chuquisaca department0.014440
age 5-13 years0.014440
depth 10 cm0.014440
cat0.014440
vigna radiata0.014440
mung bean sprouts0.014440
toronto zoo0.014440
bon portage island0.014440
oceanodroma leucorhoa0.014440
seabird0.014440
age0.014440
infant0.014440
ileum0.014440
canis lupus familiaris0.014440
japan0.014440
LOWER IN mouth0.014440
sea water0.014440
belgium0.014440
LOWER IN caecum0.014440
african lion safari0.014440
leaf surface0.014440
united kingdom0.014440
spring water0.014440
Exp. ID User ID Description Date Region Flag Sequences
308amnonhigh freq. in spacecraft assembly cleanroom floor (dominant united states of america, dust, state of california, floor, cleanroom)2018-03-31v4No1 / 5
515amnondominant poland, whole body, plant, beetle, nida basin, herbivorous beetle, polydrusus inustus2019-04-18v4No1 / 6
665amnondominant united states of america, state of california, influent, late time points, biomat, microbial biomat, water treatment pond, benthic biomat, engineered wetland2020-09-23v4No1 / 6
795amnoncommon research facility, gallus gallus, chicken, uterine tube infundibulum, adult organism, china, age 90 weeks2021-06-08v4No1 / 6
408amnoncommon united states of america, larval stage, costa rica, ant, pseudomyrmex gracilis2018-11-22v4No1 / 7
781amnondominant feces, bos taurus, kenya, wild, masai mara national park, cattle2021-04-28v4No1 / 7
232amnonhigh freq. in foot of diabetic patients (dominant homo sapiens, skin, foot, australia, diabetes mellitus)2017-11-05v4No1 / 8
406amnondominant feces, zoological garden, french republic, connochaetes taurinus, blue wildebeest2018-11-21v4No1 / 8
408amnoncommon united states of america, stomach, costa rica, ant, pseudomyrmex gracilis2018-11-22v4No1 / 8
515amnondominant feces, onthophagus taurus, bulgaria, balkan mountains, whole body, beetle, detritivorous beetle2019-04-18v4No1 / 8
408amnondominant united states of america, stomach, costa rica, ant, pheidole2018-11-22v4No1 / 9
408amnoncommon united states of america, stomach, costa rica, eciton, ant2018-11-22v4No1 / 9
423amnondominant skin, ukraine, bank vole, myodes glareolus2018-12-05v4No1 / 9
515amnondominant feces, bulgaria, balkan mountains, whole body, beetle, detritivorous beetle, aphodius pusillus2019-04-18v4No1 / 9
624sheryodominant in ryegrass rhizosphere soil after 30-40 days (dominant soil, rhizosphere, 10 cm depth, jiangsu province, ph 7-8, china, ryegrass, days 30-40)2020-05-11v4No1 / 9
78amnondominant feces, tropical grassland biome, kenya, nanger granti, gazelle2017-03-01v4No1 / 10
408amnoncommon united states of america, larval stage, costa rica, ant, pseudomyrmex elongatus2018-11-22v4No1 / 10
565amnondominant farm, skin, canada, equus asinus africanus, donkey2019-11-21v3No1 / 10
308amnonhigh freq. in neonatal intensive care unit floor (dominant united states of america, dust, hospital, state of california, floor)2018-03-31v4No1 / 11
384amnondominant farm, hay, nasal cavity, pair of nares, equus caballus, canada, horse, barn2018-10-22v4No1 / 11
408amnondominant united states of america, stomach, costa rica, ant, pseudomyrmex nigrocinctus2018-11-22v4No1 / 11
515amnondominant poland, whole body, plant, beetle, nida basin, herbivorous beetle, centricnemus leucogrammus2019-04-18v4No1 / 11
617amnondominant farm, milk, italy, cow milk (fluid), cow milk (raw), lowland pasture, lowland farm2020-05-03v3No1 / 11
717amnondominant homo sapiens, skin, adult, canada, province of ontario, plantar part of pes, epidermis, bottom of foot2028-05-22v3No1 / 11
161amnonhigh freq. in barn swallows in colorado (dominant feces, united states of america, state of colorado, hirundo rustica, barn swallow)2017-07-12v4No1 / 12
408amnondominant united states of america, stomach, costa rica, ant, pseudomyrmex gracilis2018-11-22v4No1 / 12
408amnoncommon united states of america, stomach, costa rica, ant, pseudomyrmex nigrocinctus2018-11-22v4No1 / 12
559amnondominant feces, united states of america, zoological garden, captive, rhinoceros unicornis, greater one-horned rhinoceros2019-11-03v4No1 / 12
157amnonhigh freq. in naers of weened calves (dominant united states of america, nasal cavity, pair of nares, juvenile organism, bos taurus, calve)2017-07-04v4No1 / 13
245amnoncommon homo sapiens, breast milk, kingdom of spain2017-11-21v4No1 / 13
515amnondominant feces, bulgaria, balkan mountains, whole body, beetle, detritivorous beetle, onthophagus similis2019-04-18v4No1 / 13
517amnondominant homo sapiens, arm, skin, forearm, child, bolivia, chuquisaca department, rural community, age 5-13 years2019-05-29v4No1 / 13
795amnoncommon research facility, vagina, gallus gallus, chicken, adult organism, china, age 90 weeks2021-06-08v4No1 / 13
170amnondominant united states of america, river, stream, water, fresh water, depth 10 cm2017-07-24v4No1 / 14
666amnondominant feces, italy, equus asinus africanus, african wild ass2020-09-25v3No1 / 14
812amnondominant feces, zoological garden, captive, china, pygoscelis antarcticus, chinstrap penguin2021-06-22v3No1 / 14
158amnondominant united states of america, interdigital region, felis catus, cat2017-07-06v4No1 / 15
245amnoncommon homo sapiens, breast milk, china2017-11-21v4No1 / 15
327amnondominant nasopharynx, bos taurus, canada, cow2018-04-30v4No1 / 15
408amnoncommon united states of america, larval stage, costa rica, ant, pseudomyrmex flavicornis2018-11-22v4No1 / 15
515amnondominant feces, bulgaria, balkan mountains, whole body, beetle, detritivorous beetle, aphodius haemorrhoidalis2019-04-18v4No1 / 15
515amnondominant feces, bulgaria, balkan mountains, whole body, beetle, detritivorous beetle, onthophagus ovatus2019-04-18v4No1 / 15
587amnondominant israel, food product type, vigna radiata, producer c1, mung bean sprouts2020-02-10v3No1 / 15
666amnondominant feces, italy, equus asinus africanus, equus asinus, donkey2020-09-25v3No1 / 15
565amnondominant zoological garden, skin, captive, pongo abelii, canada, toronto zoo, sumatran orangutan2019-11-21v3No1 / 16
237amnondominant uropygial gland, canada, bon portage island, bird, oceanodroma leucorhoa, seabird2017-11-07v4No1 / 17
408amnondominant united states of america, larval stage, costa rica, ant, pseudomyrmex nigrocinctus2018-11-22v4No1 / 17
661amnondominant farm, lung, china, maojian district, andrias davidianus, chinese giant salamander, age 3 years2020-09-20v4No1 / 17
245amnoncommon homo sapiens, breast milk, finland2017-11-21v4No1 / 18
408amnoncommon united states of america, larval stage, costa rica, ant, pseudomyrmex nigropilosus2018-11-22v4No1 / 18
408amnondominant united states of america, larval stage, costa rica, ant, pseudomyrmex simplex2018-11-22v4No1 / 18
245amnoncommon homo sapiens, breast milk, south africa2017-11-21v4No1 / 19
666amnondominant feces, italy, tapirus terrestris, south american tapir2020-09-25v3No1 / 19
227amnoncommon in baby nasopharynx age <= 1 day (common homo sapiens, nasal cavity, nasopharynx, age, infant, kingdom of the netherlands, age <= 24 hours)2017-10-30v4No1 / 20
818amnondominant research facility, ileum, gallus gallus, digesta, chicken, intestinal contents, female organism, china, hen, age 60 weeks2021-07-10v3No1 / 20
666amnondominant feces, zoological garden, italy, hippopotamus amphibius2020-09-25v3No1 / 21
795amnondominant research facility, gallus gallus, chicken, uterine tube infundibulum, adult organism, china, age 90 weeks2021-06-08v4No1 / 22
666amnondominant feces, italy, lama guanicoe, lepus europaeus, european hare2020-09-25v3No1 / 22
61amnondominant united states of america, research facility, skin, inguinal region, canis lupus familiaris2017-02-05v4No1 / 23
308amnoncommon in spacecraft assembly cleanroom floor (common united states of america, dust, state of california, floor, cleanroom)2018-03-31v4No1 / 23
408amnoncommon united states of america, larval stage, costa rica, ant, pseudomyrmex simplex2018-11-22v4No1 / 23
509amnondominant feces, homo sapiens, child, nigeria, kebbi state, rural community, schistosomiasis, urinary schistosomiasis, 10-15-years-old human2019-03-18v4No1 / 23
795amnondominant research facility, vagina, gallus gallus, chicken, adult organism, china, age 90 weeks2021-06-08v4No1 / 23
587amnondominant israel, food product type, vigna radiata, producer c2, mung bean sprouts2020-02-10v3No1 / 23
338amnon high in adult compared to larval stage tadpole amphibian larval stage in skin andrias japonicus japanese giant salamander japan 2018-05-21v4No1 / 24
158amnonhigher in skin sites compared to mouth in cats ( high in skin compared to saliva mouth in united states of america felis catus cat )2017-07-06v4No1 / 26
565amnoncommon skin, felis catus, cat, canada2019-11-21v3No1 / 26
605amnon high in control compared to recurrent otitis media in nasopharynx child australia age 1-3 years perth 2-year-old human stage 1-year-old human stage 2020-04-07v3No1 / 27
85amnonlower in shrimps exposed to sulfide compared to controls ( high in control compared to sulfide in digestive system sea water litopenaeus vannamei shenzhen city prefecture pacific white shrimp china )2017-03-06v4No1 / 36
367amnoncommon coast, air, namibia2018-09-02v4No1 / 36
232amnoncommon in foot of diabetic patients (common homo sapiens, skin, foot, australia, diabetes mellitus)2017-11-05v4No1 / 37
277amnoncommon homo sapiens, nasal cavity, pair of nares, adult, belgium2018-01-23v4No1 / 37
267amnonhigher in gut of fish in water with cadmium contamination compared to control ( high in cadmium compared to control in digestive system research facility oreochromis niloticus fish china )2017-12-24v4No1 / 41
538amnon high in ileum terminal ileum compared to feces in research facility mus musculus c57bl/6 canada mouse taconic farms age 8 weeks 2019-07-29v4No1 / 41
158amnoncommon united states of america, interdigital region, felis catus, cat2017-07-06v4No1 / 42
587amnoncommon israel, food product type, vigna radiata, producer c1, mung bean sprouts2020-02-10v3No1 / 42
763amnon high in subsurface depth 20-100cm compared to surface depth 0-20cm in glacier sweden filtered 0.2um ice 2021-04-10v3No1 / 42
189amnoncommon united states of america, stem, vitis vinifera, state of california, grape, endosphere2017-08-30v4No1 / 43
666amnoncommon feces, italy, panthera tigris, tiger2020-09-25v3No1 / 43
717amnoncommon homo sapiens, dorsum, skin, adult, canada, province of ontario, back, epidermis2028-05-22v3No1 / 44
287amnoncommon mountain, snow field, depth 6-7m, japan2018-01-29v4No1 / 47
327amnoncommon nasopharynx, bos taurus, canada, cow2018-04-30v4No1 / 50
338amnonhigher in wild salamanders compared to zoo grown salamanders ( high in pond area designated as a nature reserve compared to zoological garden zoo in skin andrias japonicus japanese giant salamander japan )2018-05-21v4No1 / 51
661amnoncommon farm, lung, china, maojian district, andrias davidianus, chinese giant salamander, age 3 years2020-09-20v4No1 / 53
515amnoncommon poland, whole body, plant, beetle, aphthona venustula, nida basin, herbivorous beetle2019-04-18v4No1 / 54
771amnoncommon body proper, whole body, china, aphis gossypii, cotton aphid2021-04-21v3No1 / 54
354amnon high in bronchus bronchial epithelium bronchial brush compared to sputum induced sputum in homo sapiens united states of america adult 2018-07-30v4No1 / 55
63amnoncommon in skin in american gut (common homo sapiens, skin)2017-02-15v4No1 / 56
717amnoncommon homo sapiens, skin, adult, canada, province of ontario, chest, epidermis, torso2028-05-22v3No1 / 56
812amnoncommon feces, zoological garden, captive, china, pygoscelis antarcticus, chinstrap penguin2021-06-22v3No1 / 56
56amnoncommon nectar, israel, nicotiana galuca, flower2017-01-30v4No1 / 57
237amnoncommon canada, bon portage island, bird, oceanodroma leucorhoa, seabird, brood patch2017-11-07v4No1 / 57
308amnoncommon in neonatal intensive care unit floor (common united states of america, dust, hospital, state of california, floor)2018-03-31v4No1 / 57
431amnoncommon in midgut of hibernating bumble bees (common research facility, midgut, belgium, bombus terrestris, bumble bee, queen, hibernation)2018-12-16v4No1 / 57
717amnoncommon homo sapiens, skin, adult, canada, province of ontario, palmar part of manus, epidermis, palm of hand2028-05-22v3No1 / 57
237amnoncommon uropygial gland, canada, bon portage island, bird, oceanodroma leucorhoa, seabird2017-11-07v4No1 / 58
565amnoncommon farm, skin, equus caballus, horse, canada2019-11-21v3No1 / 58
717amnoncommon homo sapiens, skin, adult, canada, province of ontario, plantar part of pes, epidermis, bottom of foot2028-05-22v3No1 / 58
281amnoncommon cloaca, shinisaurus crocodilurus, crocodile lizard, china2018-01-25v4No1 / 59
149amnoncommon stream, larval stage, intestine, amphibian larval stage, germany, salamandra salamandra, fire salamander2017-04-24v4No1 / 60
558amnon high in duodenum compared to caecum in united states of america state of wyoming bird centrocercus urophasianus greater sage-grouse 2019-09-20v4No1 / 64
71amnon high in stomach small intestine compared to feces hindgut colon in research facility argentina liolaemus ruibali 2017-02-25v4No1 / 67
587amnoncommon israel, food product type, vigna radiata, producer c2, mung bean sprouts2020-02-10v3No1 / 67
763amnonhigher in blank compared to samples (contamination)2021-04-10v3No1 / 70
645amnon high in cloaca compared to feces in state of idaho bird captive gymnogyps californianus california condor 2020-09-03v4No1 / 71
389amnoncommon united states of america, farm, nipple, skin, adult, sus scrofa, state of michigan, pig2018-11-04v4No1 / 72
483amnoncommon united states of america, water, sea water, hawaii, pearl harbor, depth 1-2m2019-02-13v4No1 / 72
653amnon high in tongue dermal layer of tongue compared to saliva in homo sapiens adult toronto canada third decade human stage 2020-09-13v3No1 / 72
26amnoncommon homo sapiens, united states of america, mucus, pair of nares2016-12-05v4No1 / 73
697amnoncommon female, research facility, oral cavity, sprague dawley, sichuan province, female organism, china2028-03-29v3No1 / 73
603amnonhigher in inital batches of baijiu fermentation pit mud ( high in days 0-90 compared to days 180-270 in mud fermentation pit mud china hefei city prefecture baijiu )2020-04-05v3No1 / 74
666amnoncommon feces, italy, hexaprotodon liberiensis, pygmy hippopotamus2020-09-25v3No1 / 76
69amnoncommon united states of america, research facility, mucus, nasal cavity, canis lupus familiaris, beagle dog2017-02-21v4No1 / 77
565amnoncommon skin, canis lupus familiaris, dog, canada2019-11-21v3No1 / 83
565amnoncommon zoological garden, skin, captive, canada, eidolon helvum, toronto zoo, fruit bat2019-11-21v3No1 / 83
406amnonhigher in captive bovidae compared to wild ( high in zoological garden compared to wild in feces bovidae )2018-11-21v4No1 / 84
515amnoncommon poland, whole body, plant, beetle, nida basin, herbivorous beetle, centricnemus leucogrammus2019-04-18v4No1 / 84
227amnonhiger in first 24hrs compared to later timepoints in baby nasopharynx ( high in age age <=24 hours compared to age >= 7 days in homo sapiens nasal cavity nasopharynx infant kingdom of the netherlands )2017-10-30v4No1 / 85
26amnon high in mucus pair of nares compared to saliva mouth in united states of america felis catus 2016-12-05v4No1 / 86
277amnon high in nasal cavity pair of nares compared to nasopharynx in homo sapiens adult belgium 2018-01-23v4No1 / 86
513amnoncommon city, waste water, hospital, xinxiang city prefecture, china2019-03-25v4No1 / 86
600sheryoIncearses after 12 days of biochar ammendment in soil ( high in day 12 compared to day 1 in united states of america soil state of new york depth 0-5cm ph 6 biochar coarse-loamy soil )2020-03-27v4No1 / 86
79amnoncommon united states of america, skin, balaenoptera borealis, sei whale2017-03-03v4No1 / 90
26amnon high in mucus pair of nares compared to sebum axilla inguinal region in homo sapiens united states of america 2016-12-05v4No1 / 92
354amnon high in bronchus bronchial epithelium bronchial brush compared to saliva oral wash in homo sapiens united states of america adult 2018-07-30v4No1 / 94
787amnonhigher in first 2 hours compared to 5-6 hours following eating ( high in 1-2 hours compared to 5-6 hours in research facility rumen ruminal fluid capra hircus china shanxi province goat dairy goat )2021-05-23v3No1 / 96
558amnon high in colon compared to caecum in united states of america state of wyoming bird centrocercus urophasianus greater sage-grouse 2019-09-20v4No1 / 97
645amnoncommon cloaca, state of idaho, bird, captive, gymnogyps californianus, california condor2020-09-03v4No1 / 99
198amnoncommon united states of america, hot spring, geothermal field, water, yellowstone national park, high temperature environment2017-09-13v4No1 / 103
587amnoncommon israel, food product type, medicago sativa, alfalfa sprouts, producer c12020-02-10v3No1 / 106
539amnon high in early timepoint days 1-15 aerobic fermentation compared to late timepoint days 30-60 anaerobic fermentation in ethiopia ensete ventricosum ethiopian banana food (fermented) 2019-07-31v4No1 / 110
565amnoncommon zoological garden, skin, equus przewalskii, captive, canada, toronto zoo, wild horse2019-11-21v3No1 / 112
198amnoncommon united states of america, geothermal field, sediment, thermophilic sediment, yellowstone national park, high temperature environment2017-09-13v4No1 / 113
269amnoncommon in fresh yao meat food (common foodon product type, china)2018-01-09v4No1 / 113
691amnon high in spring compared to summer in water drinking water french republic commune of paris 2028-03-11v3No1 / 115
48amnonhigher in 3 months compared to 1 week in infant hypopharynx ( high in age 3-month-old human stage compared to age 1 week 1-month-old human stage in homo sapiens hypopharynx infant kingdom of denmark )2017-01-19v4No1 / 116
195amnoncommon in boston subway surfaces (common city, urban biome, boston, train)2017-09-07v4No1 / 116
613amnoncommon research facility, aquarium, gastrointestinal system, poland, fish, olsztyn, esox lucius, pike fry, gut2020-04-25v3No1 / 116
343amnoncommon in apple flowers (common united states of america, flower structure, malus x domestica, state of connecticut, flower, apple)2018-05-28v4No1 / 118
615amnon high in leaf leaf endosphere compared to stem stem endosphere upper stem in brazil endosphere greenhouse campinas saccharum sugarcane 2020-04-27v4No1 / 118
311amnoncommon united states of america, state of rhode island, scallion, foodon product type2018-04-09v4No1 / 121
352amnoncommon in duodenal biopsies (common homo sapiens, small intestine, duodenum, new delhi, india)2018-07-30v4No1 / 121
515amnoncommon feces, bulgaria, balkan mountains, whole body, beetle, aphodius depressus, detritivorous beetle2019-04-18v4No1 / 121
517amnoncommon homo sapiens, arm, skin, forearm, child, bolivia, chuquisaca department, rural community, age 5-13 years2019-05-29v4No1 / 121
565amnoncommon zoological garden, skin, captive, canada, camelus bactrianus, african lion safari, bactrian camel2019-11-21v3No1 / 122
565amnoncommon zoological garden, skin, ceratotherium simum, white rhinoceros, captive, canada, african lion safari2019-11-21v3No1 / 122
273amnon high in age age 1 week 1-month-old human stage compared to 1-month-old human stage in feces homo sapiens infant kingdom of denmark 2018-01-14v4No1 / 127
384amnoncommon farm, hay, nasal cavity, pair of nares, equus caballus, canada, horse, barn2018-10-22v4No1 / 131
526amnon high in cholelithiasis compared to control in homo sapiens bile gallbladder adult kingdom of spain 2019-07-14v3No1 / 131
149amnonhigher in larvae transferred to pond compared to stream ( high in pond compared to stream in mucus larval stage amphibian larval stage skin germany salamandra salamandra fire salamander )2017-04-24v4No1 / 132
585amnoncommon china, qingpu district, pomacea canaliculata, golden apple snail, nanheng river, buccal mass2020-02-02v3No1 / 136
582amnoncommon united states of america, axilla, wild, santa catalina island, urocyon littoralis, urocyon littoralis catalinae, santa catalina island fox2020-01-22v4No1 / 140
255amnoncommon in fish feed (common united states of america, research facility, state of minnesota, fish feed)2017-11-24v4No1 / 141
29amnoncommon brassica oleracea, french republic, seed2016-12-05v4No1 / 146
666amnoncommon feces, zoological garden, italy, hippopotamus amphibius2020-09-25v3No1 / 146
475amnoncommon in air next to subway stations in hong kong (common city, air, hong kong)2019-01-20v4No1 / 147
515amnoncommon feces, bulgaria, balkan mountains, whole body, beetle, detritivorous beetle, aphodius haemorrhoidalis2019-04-18v4No1 / 147
53amnonhigher in sewer and wastewater influent comapred to feces in low income south america ( high in wastewater treatment plant sewer compared to feces in city south america low income )2017-01-21v4No1 / 148
254amnon high in winter dry season compared to summer autumn wet season in river water fresh water fujian province depth 0.5m jiulong river china 2017-11-23v4No1 / 153
515amnoncommon poland, whole body, plant, beetle, nida basin, herbivorous beetle, crioceris duodecimpunctata2019-04-18v4No1 / 157
180amnoncommon larval stage, czech republic, dermanyssus gallinae, red poulty mite, poulty farm, shelled egg2017-08-14v4No1 / 158
384amnon high in hay barn compared to pasture in farm nasal cavity pair of nares equus caballus canada horse 2018-10-22v4No1 / 161
475amnoncommon in air in subway train in hong kong (common city, air, hong kong, subway)2019-01-20v4No1 / 161
232amnoncoomon in foot of healthy controls (common homo sapiens, skin, foot, australia)2017-11-05v4No1 / 166
565amnoncommon zoological garden, skin, captive, pongo abelii, canada, toronto zoo, sumatran orangutan2019-11-21v3No1 / 174
384amnoncommon farm, pasture, nasal cavity, pair of nares, equus caballus, canada, horse2018-10-22v4No1 / 175
515amnoncommon feces, bulgaria, balkan mountains, whole body, beetle, detritivorous beetle, onthophagus ruficapillus2019-04-18v4No1 / 178
311amnoncommon united states of america, state of rhode island, ginger, foodon product type2018-04-09v4No1 / 180
567amnon high in pair of nares anterior naris compared to nasopharynx in homo sapiens adult belgium 2019-12-05v4No1 / 186
75amnoncommon homo sapiens, arm, skin, venezuela, amerindian, hunter gatherer2017-02-27v4No1 / 190
201amnoncommon in decaying Saguaro cactus (common desert, mexico, cactus, carnegiea gigantea, saguaro, decaying)2017-10-01v4No1 / 193
201amnoncommon in decaying Cardon cactus (common desert, mexico, cactus, decaying, pachycereus pringlei, cardon)2017-10-01v4No1 / 193
534amnoncommon river, tributary, water, fresh water, nepal, depth 10 cm, filtered 2.7um, particle bound, koshi river2019-07-22v4No1 / 193
170amnoncommon united states of america, river, stream, water, fresh water, depth 10 cm2017-07-24v4No1 / 194
585amnoncommon stomach, china, qingpu district, pomacea canaliculata, golden apple snail, nanheng river2020-02-02v3No1 / 194
371amnoncommon homo sapiens, skin, venezuela, amerindian, hunter gatherer2018-09-06v4No1 / 195
6amnoncommon homo sapiens, urine, female, pregnancy, state of tennessee2016-10-13v4No1 / 201
360amnoncommon desert, leaf, mexico, guanajuato, agave, agave tequiliana, leaf surface, cultivated environment2018-08-21v4No1 / 210
388amnon high in age 6-10 weeks compared to age 12-19 weeks in united states of america farm tonsil sus scrofa state of michigan pig 2018-11-03v4No1 / 210
545amnoncommon ocean, biofilm, atlantic ocean, debris, depth 200-2000 m2019-08-04v4No1 / 227
351amnoncommon feces, united states of america, research facility, state of florida, eagle harbor, lytechinus variegatus, sea urchin2018-07-30v4No1 / 233
78amnoncommon feces, tropical grassland biome, kenya, nanger granti, gazelle2017-03-01v4No1 / 234
811amnoncommon glacier, glacial ice, ice, shetland islands, south shetland glacier2021-06-22v3No1 / 234
492amnoncommon skin, adult, rana catesbeiana, bullfrog, frog, lithobates catesbeianus, japan2019-02-27v4No1 / 236
161amnoncommon in barn swallows in colorado (common feces, united states of america, state of colorado, hirundo rustica, barn swallow)2017-07-12v4No1 / 245
351amnoncommon united states of america, research facility, coelomic fluid, state of florida, eagle harbor, lytechinus variegatus, sea urchin2018-07-30v4No1 / 249
617amnoncommon farm, milk, italy, cow milk (fluid), cow milk (raw), lowland pasture, lowland farm2020-05-03v3No1 / 257
253amnoncommon in clouds in puy de dome mountain in france (common air, french republic, autumn, cloud)2017-11-22v4No1 / 267
384amnoncommon farm, hay, saliva, oral cavity, equus caballus, canada, horse, barn, mouth2018-10-22v4No1 / 274
696amnon high in georissa georissa similis compared to alycaeus jagori in stomach gastrointestinal system malaysia state of sabah land snail 2028-03-28v3No1 / 282
384amnon high in hay barn compared to pasture in farm saliva equus caballus canada horse mouth 2018-10-22v4No1 / 283
423amnoncommon skin, ukraine, bank vole, myodes glareolus2018-12-05v4No1 / 291
237amnonlower in burrow soil compared to bird ( high in bird oceanodroma leucorhoa seabird compared to soil burrow in canada bon portage island )2017-11-07v4No1 / 298
78amnon high in male compared to female in feces tropical grassland biome kenya nanger granti gazelle 2017-03-01v4No1 / 301
782amnon high in skin compared to gill in fish farm portuguese republic dicentrarchus labrax ria formosa open water pond seabass 2021-05-06v4No1 / 304
515amnoncommon river, poland, whole body, beetle, carnivorous beetle, raba river, bembidion punctulatum2019-04-18v4No1 / 305
615amnon high in soil compared to rhizosphere in brazil greenhouse campinas saccharum sugarcane 2020-04-27v4No1 / 306
653amnon high in tongue dermal layer of tongue compared to dentition supragingival plaque supragingival dental plaque in homo sapiens adult toronto canada third decade human stage 2020-09-13v3No1 / 306
515amnoncommon river, poland, whole body, beetle, carnivorous beetle, raba river, bembidion varicolor2019-04-18v4No1 / 308
565amnoncommon zoological garden, skin, giraffa camelopardalis, giraffe, captive, canada, african lion safari2019-11-21v3No1 / 310
534amnoncommon river, water, fresh water, nepal, depth 10 cm, filtered 2.7um, particle bound, koshi river2019-07-22v4No1 / 315
565amnoncommon farm, skin, bos taurus, cow, canada2019-11-21v3No1 / 318
615amnon high in leaf leaf surface compared to stem upper stem stem surface in brazil greenhouse exosphere campinas saccharum sugarcane 2020-04-27v4No1 / 321
515amnoncommon feces, bulgaria, balkan mountains, whole body, beetle, detritivorous beetle, onthophagus ovatus2019-04-18v4No1 / 322
311amnoncommon in floor of kimchi production facility (common united states of america, food processing factory, state of rhode island, floor)2018-04-09v4No1 / 324
61amnoncommon united states of america, research facility, skin, inguinal region, canis lupus familiaris2017-02-05v4No1 / 327
423amnon high in human contact compared to no human contact chernobyl exclusion zone in skin ukraine bank vole myodes glareolus 2018-12-05v4No1 / 334
565amnoncommon farm, skin, canada, equus asinus africanus, donkey2019-11-21v3No1 / 335
351amnoncommon in artificial sea water where sea urchins were grown (common united states of america, research facility, sea water, state of florida, lytechinus variegatus, sea urchin, artificial seawater)2018-07-30v4No1 / 338
209amnonhigher in whale blow condensate compared to ocean water ( high in respiratory airway megaptera novaeangliae humpback whale exhaled air condensate whale blow compared to ocean sea water depth 25cm in north america )2017-10-15v4No1 / 359
565amnoncommon zoological garden, skin, captive, canada, african lion safari, macropus rufus, red kangaroo2019-11-21v3No1 / 360
341amnonhigher in fresh drinking water compared to week old water ( high in fresh water compared to stagnant water in united states of america water drinking water tap water state of illinois )2018-05-28v4No1 / 365
582amnon high in external acoustic meatus ear canal compared to rectum perianal skin in united states of america wild santa catalina island urocyon littoralis urocyon littoralis catalinae santa catalina island fox 2020-01-22v4No1 / 374
29amnon high in seed compared to seedling in brassica oleracea french republic 2016-12-05v4No1 / 379
256amnoncommon duodenum, jejunum, ileum, sus scrofa, pig, united kingdom2017-11-26v4No1 / 380
612amnoncommon united states of america, water, fresh water, state of florida, spring water, location 52020-04-22v4No1 / 383
256amnonhigher in small intestine compared to colon in pigs ( high in duodenum jejunum ileum compared to caecum left colon right colon in sus scrofa pig united kingdom )2017-11-26v4No1 / 387
662amnoncommon soil, israel, depth 0-10cm, irrigated, agricultural field, clay soil, neve yaar2020-09-21v3No1 / 402
558amnon high in gizzard compared to crop in united states of america state of wyoming bird centrocercus urophasianus greater sage-grouse 2019-09-20v4No1 / 408
612amnoncommon united states of america, water, fresh water, state of florida, spring water, location 32020-04-22v4No1 / 420
515amnoncommon feces, bulgaria, balkan mountains, whole body, beetle, detritivorous beetle, aphodius pusillus2019-04-18v4No1 / 421
99amnoncommon united states of america, mucus, skin, commonwealth of virginia, pseudacris crucifer, peeper2017-04-02v4No1 / 438
53amnonlower in wastewater plant effluent compared to influent and sewer in south america ( high in sewage influent compared to effluent in city wastewater treatment plant south america )2017-01-21v4No1 / 440
666amnoncommon feces, italy, equus asinus africanus, equus asinus, donkey2020-09-25v3No1 / 450
424amnoncommon feces, farm, sus scrofa, jinhua city prefecture, pig, jinhua pig, china2018-12-06v4No1 / 452
504amnon high in water sea water compared to sediment marine sediment in nan'ao island china 2019-03-14v4No1 / 462
438amnonhigher in centenarians compared to adults ( high in age >94 ninth decade human stage tenth decade human stage compared to 65-79 year-old human stage fourth decade human stage fifth decade human stage in feces homo sapiens china )2018-12-30v4No1 / 474
617amnonlower in cow milk of cows in alpine pasture compared to lowland farm ( high in lowland pasture lowland farm compared to alpine alpine pasture in farm milk italy cow milk (fluid) cow milk (raw) )2020-05-03v3No1 / 484
718amnon high in epilimnion compared to hypolimnion in united states of america state of wisconsin dimictic lake bog lake freshwater lake ph 4.5-5 "north sparkling bog" lake 2028-05-23v4No1 / 488
360amnoncommon desert, leaf, mexico, guanajuato, agave, agave salmiana, leaf surface2018-08-21v4No1 / 492
657amnoncommon research facility, rumen, ovis aries, qinghai province, rumen liquid, age < 1 year, sheep, lamb, china2020-09-13v4No1 / 517
406amnoncommon feces, zoological garden, french republic, equus zebra, mountain zebra2018-11-21v4No1 / 527
515amnoncommon feces, onthophagus taurus, bulgaria, balkan mountains, whole body, beetle, detritivorous beetle2019-04-18v4No1 / 533
603amnoncommon in baijiu fermentation pit mud in first 2 batches (common mud, fermentation pit mud, china, hefei city prefecture, baijiu, days 0-90)2020-04-05v3No1 / 542
352amnon high in small intestine duodenum compared to feces in homo sapiens new delhi india 2018-07-30v4No1 / 545
129amnoncommon leaf, mexico, myrtillocactus geometrizans, opuntia robusta, cactus, semi-arid2017-04-15v4No1 / 562
612amnoncommon united states of america, water, fresh water, state of florida, spring water, location 22020-04-22v4No1 / 596
406amnoncommon feces, united states of america, zoological garden, switzerland, diceros bicornis, black rhinoceros2018-11-21v4No1 / 600
425amnon high in duodenum compared to feces in homo sapiens child africa 2018-12-08v4No1 / 622
800amnonhigher at 100-250 days compared to 7-28 days following heavy metal contamination ( high in summer autumn compared to spring in lake sediment fresh water heavy metal reservoir china xiannv lake sediment depth 0-10cm )2021-06-15v4No1 / 644
360amnonhigher in leaf surface compared to soil in agave plants ( high in leaf leaf surface compared to soil in desert state of california mexico guanajuato agave )2018-08-21v4No1 / 645
612amnoncommon united states of america, water, fresh water, state of florida, spring water, location 42020-04-22v4No1 / 655
666amnoncommon feces, italy, equus asinus africanus, african wild ass2020-09-25v3No1 / 683
271amnon high in rhizosphere glycine max soybean compared to soil in depth 0-20cm china 2018-01-09v4No1 / 750
206amnoncommon in air from israel particles <10um size (common air, dust, israel, size < 10um, clear day)2017-10-04v4No1 / 765
157amnoncommon in naers of weened calves (common united states of america, nasal cavity, pair of nares, juvenile organism, bos taurus, calve)2017-07-04v4No1 / 766
384amnon high in nasal cavity pair of nares compared to saliva oral cavity mouth in farm equus caballus canada horse 2018-10-22v4No1 / 791
232amnonlower in diabetec foot ulcers compared to non-ulcer skin in diabetic patients ( high in control compared to ulcer wound in homo sapiens skin foot australia diabetes mellitus )2017-11-05v4No1 / 836
517amnon high in arm skin forearm compared to feces in homo sapiens child bolivia chuquisaca department rural community age 5-13 years 2019-05-29v4No1 / 836
632amnoncommon feces, united states of america, research facility, adult, equus caballus, state of texas, horse2020-06-10v4No1 / 848
665amnon high in late time points compared to early time points in united states of america state of california biomat microbial biomat water treatment pond benthic biomat engineered wetland 2020-09-23v4No1 / 884
462amnon high in leaf compared to stem in united states of america state of tennessee populus tree cultivated environment 2019-01-13v4No1 / 890
632amnon high in feces compared to caecum cecal content in united states of america research facility adult equus caballus state of texas horse 2020-06-10v4No1 / 897
206amnoncommon in dust storm air from israel particles <10um size (common air, dust, israel, size < 10um, dust storm)2017-10-04v4No1 / 902
624sheryoCommon in ryegrass rhizosphere soil after 30-40 days (common soil, rhizosphere, 10 cm depth, jiangsu province, ph 7-8, china, ryegrass, days 30-40)2020-05-11v4No1 / 966
193amnonhigher in nares of people working in dairy farms ( high in farm bos taurus compared to control in homo sapiens united states of america pair of nares )2017-09-05v4No1 / 992
517amnon high in arm skin forearm compared to mouth mucosa mouth in homo sapiens child bolivia chuquisaca department rural community age 5-13 years 2019-05-29v4No1 / 1014
624sheryocommon in ryegrass rhizosphere soil amended with biochar after 30-40 days (common soil, rhizosphere, 10 cm depth, jiangsu province, ph 7-8, biochar, china, ryegrass, days 30-40)2020-05-11v4No1 / 1017
252amnoncommon in river rock biofilm (common river, rock, biofilm, kingdom of spain, epilithic)2017-11-22v4No1 / 1081
415amnoncommon orchard, soil, rhizosphere, kingdom of spain, citrus, cultivated environment2018-11-27v4No1 / 1099
515amnon high in carabidae compared to staphylinidae in river poland whole body beetle carnivorous beetle 2019-04-19v4No1 / 1130
252amnoncommon in river sand biofilm (common river, biofilm, sand, kingdom of spain)2017-11-22v4No1 / 1181
454amnon high in captive compared to wild in feces elaphurus davidianus pere deer deer china 2019-01-10v4No1 / 1374
40amnoncommon soil, field soil, rhizosphere, nicotiana tabacum, china2016-12-09v4No1 / 1420
271amnoncommon rhizosphere, glycine max, soybean, depth 0-20cm, china2018-01-09v4No1 / 1459
515amnon high in bulgaria detritivorous beetle compared to poland herbivorous beetle in whole body beetle 2019-04-19v4No1 / 1543
536amnon high in aquatic snake compared to terrestrial snake in united states of america skin snake southern united states 2019-07-28v4No1 / 1772
353amnonlower in captive compared to wild caught Lissotriton vulgaris newts skin ( high in wild compared to research facility in skin adult cambridgeshire newt triturus cristatus united kingdom )2018-07-30v4No1 / 1834
353amnonlower in captive compared to wild caught Lissotriton vulgaris newts skin ( high in wild compared to research facility in skin adult cambridgeshire newt lissotriton vulgaris united kingdom )2018-07-30v4No1 / 2162
718amnon high in hypolimnion compared to epilimnion in united states of america state of wisconsin meromictic lake bog lake freshwater lake ph 5.5-6 "mary lake" 2028-05-23v4No1 / 2370
271amnoncommon soil, depth 0-20cm, china2018-01-09v4No1 / 2856
837sheryoHigher in soil after 30 years compared to 10 years of reforestation with Black locust trees, shaanxi, China ( high in 30 years compared to 10 years in soil silt loam reforestation china shaanxi province loess plateau robinia pseudoacacia )2021-09-27v4No1 / 5245
837sheryoHigher in soil after 20 years compared to 10 years of reforestation with Black locust trees, shaanxi, China ( high in 20 years compared to 10 years in soil silt loam reforestation china shaanxi province loess plateau robinia pseudoacacia )2021-09-27v4No1 / 5270
837sheryoHigher in soil after 30 years reforestation with Black locust trees compared to agricultural feild, shaanxi, China ( high in reforestation robinia pseudoacacia 30 years compared to zea mays triticum aestivum agricultural field in soil silt loam china shaanxi province loess plateau )2021-09-27v4No1 / 5596
837sheryoHigher in soil after 20 years reforestation with Black locust trees compared agricultural feild, shaanxi, China ( high in reforestation robinia pseudoacacia 20 years compared to zea mays triticum aestivum agricultural field in soil silt loam china shaanxi province loess plateau )2021-09-26v4No1 / 5661
266amnon high in root compared to leaf in united states of america state of idaho plant brassicaceae boechera stricta 2017-12-19v4No1 / 5886
271amnon high in soil rhizosphere compared to root structure root in glycine max soybean depth 0-20cm china 2018-01-09v4No1 / 7954

Problems / suggestions? Please email info AT dbbact DOT org