Search result for sequence:
TACAGAGGGTGCAAGCGTTGTTCGGAATTATTGGGCGTAAAGCGCGTGTAGGCGGCTTTGCAAGTCGGGTGTGAAAGCCCTCAGCTCAACTGAGGAAGTGCGCCCGAAACTGCAGAGCTTGAGTGCCGGAGAGGGTGGCGGAATTCCCCA
common ontology terms
term enrichment score
TermScore
soil0.533258
rhizosphere0.360574
china0.273616
cultivated environment0.226415
zea mays0.131148
triticum aestivum0.128032
silt loam0.121795
desert0.117647
oryza sativa0.115357
shaanxi province0.111498
loess plateau0.105611
united states of america0.101516
depth (soil) 0-20cm0.091603
ph 7-80.090850
citrus0.090435
depth (soil) 0-10cm0.087468
agricultural feature0.082365
kellogg biological station0.079422
mesic type hapludalf0.079422
kalamazoo loam0.079422
yunwushan national natural grassland protection zone0.079422
ningxia province0.079422
calci-orthic aridisol0.079422
haplic calcisol0.079422
grazing exclusion0.079422
agricultural field0.078078
root0.077876
mexico0.077670
clay loam0.074074
robinia pseudoacacia0.072727
reforestation0.072727
jiangsu province0.072687
glycine max0.071856
wheat0.071429
state of california0.071429
river0.070175
leaf0.068966
paddy field soil0.067039
hunan province0.066482
farm0.065398
state of michigan0.060274
tree0.060000
heilongjiang province0.059925
ph 90.059925
orchard0.055749
state of tennessee0.054237
ph 6-70.052345
guanajuato0.052045
agave0.052045
low sodicity0.052045
salic solonetz0.052045
da'an station0.052045
songnen plain0.052045
united states0.052045
nicollet soil series0.052045
des moines0.052045
restored prairie0.052045
germany0.051044
iowa0.050725
low salinity0.049470
skin0.047511
north china plain0.044944
populus0.044944
chrysanthemum morifolium ramat.0.044944
chrysanthemum0.044944
nanjing county0.044944
0-9 years of grazing exclusion0.044944
gleysol0.044944
sihong county0.044944
chenwei forest0.044944
poplar plantation0.044944
poplar0.044944
ph 7.60.043956
ph 6.90.043956
israel0.041522
state of new york0.040816
state of florida0.038835
rice0.038217
ph 60.037736
greenhouse soil0.037736
wanning city0.037736
vanilla planifolia0.037736
soil from vanilla field0.037736
fusarium oxysporum f. sp. vanillae0.037736
depth 0-40cm0.037736
LOWER IN root0.037037
depth (soil) 0-15cm0.037037
depth (soil) 10-25cm0.037037
solanum lycopersicum0.036697
sand0.036697
pot expreiment0.036364
biofilm0.036036
woodland area0.035398
brazil0.034884
winter0.032520
npk fertilizer0.030730
ph 7.50.030651
ph 5.90.030651
depth 5cm0.030573
fertilized soil0.030573
Fraction of dbbact annotations with this term covered by the query
TermScore
cane toad1.000000
bufo marinus1.000000
jinxiang county1.000000
LOWER IN low npk fertilizer dose1.000000
high npk fertilizer dose1.000000
rice0.750000
cultivated environment0.750000
npk fertilizer0.750000
oryza sativa0.714286
heilongjiang province0.666667
clay loam0.666667
paddy field soil0.666667
chemical fertilization n,p,k0.666667
trichoderma guizhouense njau 47420.666667
LOWER IN chemical fertilization n,p,k0.666667
ph 7.50.666667
ph 5.90.666667
ph 90.666667
depth 10-20cm0.666667
depth 5cm0.600000
fertilized soil0.600000
rhizosphere0.574468
hunan province0.571429
maryland county0.500000
field soil0.500000
seleniferous0.500000
non-seleniferous0.500000
vero beach, fl0.500000
quincy, fl0.500000
immokalee, fl0.500000
ft. pierce, fl0.500000
gainesville, fl0.500000
central park0.500000
merlot0.500000
grapevine0.500000
mississippi river0.500000
winter barley0.500000
myrtillocactus geometrizans0.500000
opuntia robusta0.500000
ph 6-6.50.500000
root zone soil0.500000
taxus0.500000
taxus media0.500000
taxus cuspidata0.500000
temperate0.500000
LOWER IN taxus mairei0.500000
LOWER IN southeast china0.500000
tomato0.500000
slit loam soil0.500000
ph 60.500000
slit loam0.500000
unionidae0.500000
phyllosphere0.500000
ph 7-90.500000
size < 10um0.500000
clear day0.500000
dust storm0.500000
epipsammic0.500000
LOWER IN epilithic0.500000
epilithic0.500000
arachis hypogaea0.500000
peanut0.500000
negev desert0.500000
LOWER IN heat stressed soil0.500000
ph 5.50.500000
boechera stricta0.500000
grassland0.500000
steppe0.500000
north china plain0.500000
ph>80.500000
ph>7, ph<80.500000
ph>6, ph<70.500000
ph>5, ph<60.500000
ph>4, ph<50.500000
desert0.500000
state of utah0.500000
depth 1cm0.500000
soil crust0.500000
lathyrus pratensis0.500000
meadow pea-vine0.500000
LOWER IN other plants0.500000
LOWER IN woundwort0.500000
LOWER IN prunella vulgaris0.500000
other plants0.500000
veronica chamaedrys0.500000
germander speedwell0.500000
festuca rubra0.500000
red fescue grass0.500000
galium mollugo0.500000
hedge bedstraw0.500000
geranium pratense0.500000
meadow geranium0.500000
onobrychis viciifolia0.500000
common sainfoin0.500000
plantago lanceolata0.500000
ribwort plantain0.500000
cambridgeshire0.500000
lissotriton vulgaris0.500000
triturus cristatus0.500000
moist tropical forest0.500000
Fraction of annotations for the query sequences containing the term
TermScore
soil0.643137
china0.494118
rhizosphere0.262745
united states of america0.188235
cultivated environment0.133333
zea mays0.078431
triticum aestivum0.074510
silt loam0.074510
depth (soil) 0-20cm0.066667
desert0.066667
oryza sativa0.062745
loess plateau0.062745
shaanxi province0.062745
ph 7-80.054902
citrus0.050980
agricultural feature0.050980
depth (soil) 0-10cm0.050980
agricultural field0.050980
mexico0.047059
state of california0.047059
root0.043137
germany0.043137
farm0.043137
jiangsu province0.043137
state of michigan0.043137
kellogg biological station0.043137
mesic type hapludalf0.043137
kalamazoo loam0.043137
yunwushan national natural grassland protection zone0.043137
ningxia province0.043137
calci-orthic aridisol0.043137
haplic calcisol0.043137
grazing exclusion0.043137
leaf0.039216
river0.039216
wheat0.039216
glycine max0.039216
clay loam0.039216
robinia pseudoacacia0.039216
reforestation0.039216
tree0.035294
hunan province0.035294
paddy field soil0.035294
heilongjiang province0.031373
orchard0.031373
ph 6-70.031373
state of tennessee0.031373
ph 90.031373
skin0.027451
guanajuato0.027451
agave0.027451
low salinity0.027451
low sodicity0.027451
salic solonetz0.027451
da'an station0.027451
songnen plain0.027451
united states0.027451
nicollet soil series0.027451
des moines0.027451
iowa0.027451
restored prairie0.027451
state of florida0.023529
state of new york0.023529
israel0.023529
biofilm0.023529
north china plain0.023529
winter0.023529
populus0.023529
ph 7.60.023529
ph 6.90.023529
chrysanthemum morifolium ramat.0.023529
chrysanthemum0.023529
nanjing county0.023529
0-9 years of grazing exclusion0.023529
gleysol0.023529
sihong county0.023529
chenwei forest0.023529
poplar plantation0.023529
poplar0.023529
woodland area0.019608
LOWER IN root0.019608
rice0.019608
solanum lycopersicum0.019608
ph 60.019608
sand0.019608
brazil0.019608
greenhouse soil0.019608
wanning city0.019608
pot expreiment0.019608
vanilla planifolia0.019608
soil from vanilla field0.019608
fusarium oxysporum f. sp. vanillae0.019608
depth (soil) 0-15cm0.019608
depth (soil) 10-25cm0.019608
depth 0-40cm0.019608
merlot0.015686
vitis vinifera0.015686
grapevine0.015686
myrtillocactus geometrizans0.015686
opuntia robusta0.015686
Exp. ID User ID Description Date Region Flag Sequences
360amnondominant desert, soil, state of california2018-08-21v4No1 / 4
893amnonlower in soil fertilized with composted manure compared to soil fertilized with manure ( high in animal manure compared to composted animal manure in raphanus sativus greenhouse radish commonwealth of virginia rhizosphere fertilized soil research facility united states of america )2022-04-11v4No1 / 88
360amnoncommon desert, soil, rhizosphere, agave, mexico, guanajuato, agave tequiliana, cultivated environment2018-08-21v4No1 / 98
1008amnon high in high npk fertilizer dose compared to low npk fertilizer dose in rhizosphere ph 7-8 jinxiang county garlic allium sativum fertilized soil farm china 2023-01-26v4No1 / 123
63amnon high in female compared to male in homo sapiens skin 2017-02-15v4No1 / 139
514amnoncommon united states of america, state of utah, sandstone, grand staircase-escalante national park, desert, depth (soil) 0-1cm2019-03-25v4No1 / 139
515amnoncommon bembidion decorum, carnivorous beetle, river, poland, raba river, whole body, beetle2019-04-18v4No1 / 198
360amnoncommon agave, desert, leaf, leaf surface, mexico, guanajuato, agave tequiliana, cultivated environment2018-08-21v4No1 / 210
824sheryoHigher in soil at 0-10cm depth after 0-9 years compared to after 27-35 years of grazing exclusion, Ningxia china ( high in 0-9 years of grazing exclusion compared to 27-35 years of grazing exclusion in depth (soil) 0-10cm yunwushan national natural grassland protection zone ningxia province calci-orthic aridisol haplic calcisol grazing exclusion china soil )2021-08-08v4No1 / 230
279amnoncommon grassland, steppe, mongolia, soil, china2018-01-24v4No1 / 235
824sheryoHigher soil at 40-60cm depth after 0-9 years compared to 27-35 years after of grazing exclusion, Ningxia china ( high in 0-9 years of grazing exclusion compared to 27-35 years of grazing exclusion in depth 40-60cm yunwushan national natural grassland protection zone ningxia province calci-orthic aridisol haplic calcisol grazing exclusion china soil )2021-08-08v4No1 / 247
259amnonhigher in fertilized soil (npk) compared to non-fertilized ( high in fertilized soil compared to non-fertilized soil in soil rhizosphere ph 5 arachis hypogaea peanut china )2017-12-02v4No1 / 280
171amnonhigher in roots of drought irrigated rice compared to irrigated conrols ( high in drought environment compared to control in united states of america state of california oryza sativa rice root )2017-07-25v4No1 / 282
156amnoncommon brassica, brassica oleracea, leaf, phyllosphere, china2017-07-27v4No1 / 292
37amnoncommon in plastic leaf plants (in field next to tomato plants) (common maryland county, leaf)2016-12-09v4No1 / 298
515amnoncommon carnivorous beetle, river, poland, raba river, whole body, beetle, bembidion punctulatum2019-04-18v4No1 / 305
515amnoncommon carnivorous beetle, river, poland, raba river, whole body, beetle, bembidion varicolor2019-04-18v4No1 / 308
828sheryoHigher at 0-20cm depth compared to 20-40cm depth in gleysol soil of poplar plantation, sihong, china ( high in depth (soil) 0-20cm compared to depth 20-40cm in ph 6-7 clay loam gleysol china jiangsu province sihong county chenwei forest soil poplar plantation poplar )2021-08-25v4No1 / 312
129amnoncommon mexico, myrtillocactus geometrizans, opuntia robusta, cactus, rhizosphere, semi-arid2017-04-15v4No1 / 338
767sheryoHigh in conservation tillage compared to conventional tillage soil planted with Chrysanthemum, fertilized with bio-organic fertilizer, amended with soil fumigant 'Dazomet' in Nanjing China ( high in conservation tillage compared to deep plough conventional tillage in dazomet soil fumigation soil ph 6.9 chrysanthemum morifolium ramat. chrysanthemum china nanjing county bio-organic fertilizer compost biofilter paenibacillus polymyxa paenibacillus compost soil pig manure )2021-04-18v4No1 / 350
792amnoncommon depth (soil) 20-60cm, nitraria tangutorum, rhizosphere, sand, ph 9, minqin county, depth (soil) 50cm, desert, china2021-06-07v4No1 / 352
686sheryoHigher in vanilla field soil infected with Fusarium oxysporum, fertilized with fungal and bacterial bio-fertilizer and had low Fusarium cumulative disease incidence ( high in fungal enriched bio-fertilizer bacterial enriched bio-fertilizer low fusarium cumulative disease incidence compared to chemical fertilization n,p,k organic fertilizer- chicken manure compost high fusarium cumulative disease incidence in fusarium oxysporum f. sp. vanillae soil from vanilla field vanilla planifolia pot expreiment wanning city ph 7.6 )2028-03-08v4No1 / 371
252amnonhigh on sand biofilm compared to rock biofilm in river ( high in epipsammic sand compared to epilithic rock in biofilm kingdom of spain biofilm river sediment )2017-11-22v4No1 / 374
412amnonhigh in pig manured soil with wheat-maize rotation compared to non-manured soil ( high in manured soil compared to non-manured soil in soil hunan province red soil cambisol zea mays triticum aestivum china )2018-11-26v4No1 / 395
360amnoncommon desert, soil, rhizosphere, agave, agave deserti, state of california2018-08-21v4No1 / 432
360amnoncommon desert, soil, mexico, guanajuato2018-08-21v4No1 / 437
792amnoncommon depth (soil) 20-60cm, haloxylon ammodendron, rhizosphere, sand, ph 9, minqin county, depth (soil) 50cm, desert, china2021-06-07v4No1 / 443
360amnoncommon desert, soil, rhizosphere, agave, agave salmiana, mexico, guanajuato2018-08-21v4No1 / 484
360amnoncommon agave, desert, leaf, leaf surface, agave salmiana, mexico, guanajuato2018-08-21v4No1 / 492
415amnoncommon rhizosphere, soil, citrus, orchard, united states of america, cultivated environment2018-11-27v4No1 / 494
360amnoncommon desert, soil, mexico, guanajuato, cultivated environment2018-08-21v4No1 / 500
373amnoncommon soil, rhizosphere, oryza sativa, rice, hunan province, rice field, china2018-09-08v4No1 / 501
801sheryoHigher at depth 0-15cm compared to depth 60-90cm in corn agriculture fields, Iowa USA ( high in depth (soil) 0-15cm compared to depth (soil) 60-90cm in kanawha nicollet soil series des moines united states agricultural field iowa zea mays soil )2021-06-15v4No1 / 501
98amnoncommon citrus, rhizosphere, immokalee, fl, root, state of florida2017-04-01v4No1 / 543
98amnoncommon citrus, rhizosphere, vero beach, fl, root, state of florida2017-04-01v4No1 / 544
309amnon high in other plants compared to woundwort prunella vulgaris in rhizosphere germany 2018-04-05v4No1 / 550
548amnoncommon in leaf surface of barbacenia macrantha (common minas gerais state, campos rupestres, brazil, barbacenia macrantha, leaf, leaf surface)2019-08-17v4No1 / 550
462amnon high in populus deltoides compared to populus trichocarpa x deltoides in united states of america state of tennessee populus tree leaf cultivated environment 2019-01-13v4No1 / 559
129amnoncommon mexico, myrtillocactus geometrizans, opuntia robusta, cactus, semi-arid, leaf2017-04-15v4No1 / 562
357amnoncommon soil, topsoil, depth (soil) 0-10cm, mediterranean forest biome, forest ecosystem, woodland area2018-08-19v4No1 / 564
548amnoncommon minas gerais state, campos rupestres, brazil, barbacenia macrantha, root endosphere, root2019-08-17v4No1 / 575
792amnoncommon depth (soil) 20-60cm, sand, ph 9, minqin county, depth (soil) 50cm, soil, desert, china2021-06-07v4No1 / 595
415amnoncommon rhizosphere, soil, citrus, orchard, south africa, cultivated environment2018-11-27v4No1 / 600
357amnoncommon soil, topsoil, depth (soil) 0-10cm, savanna, forest ecosystem, woodland area2018-08-19v4No1 / 614
609sheryoCommon in soil with tobacco plants amended with difenoconazole fungicide and biochar (common biochar, tobacco plant present, difenoconazole, fungicide, ph 7-8, china, tobacco field, limestone, depth 0-20cm, soil)2020-04-21v4No1 / 634
360amnoncommon desert, soil, state of california2018-08-21v4No1 / 637
360amnoncommon agave, desert, state of california, agave deserti, leaf, leaf surface2018-08-21v4No1 / 649
609sheryocommon in soil with tobacco plants amended with difenoconazole fungicide (common tobacco plant present, difenoconazole, fungicide, ph 7-8, china, tobacco field, limestone, depth 0-20cm, soil)2020-04-21v4No1 / 671
309amnon high in lathyrus pratensis meadow pea-vine compared to other plants in rhizosphere germany 2018-04-05v4No1 / 680
357amnoncommon in temperate deciduous forests around the world (common soil, topsoil, depth (soil) 0-10cm, temperate woodland biome, temperate deciduos forest, woodland area, forest ecosystem)2018-08-18v4No1 / 681
422amnoncommon soil, paddy field soil, oryza sativa, heilongjiang province, ph 6-7, cultivated environment, china2018-12-04v4No1 / 682
100amnoncommon soil, urban biome, park, new york city, central park2017-04-03v4No1 / 685
746sheryoHigh in saline soil fertilized with biological fertilizer compared to chemical fertilizer, planted with tomatos, in dafeng, china ( high in trichoderma guizhouense njau 4742 chicken manure biological fertilization compared to chemical fertilization n,p,k in saline soil solonchak china dafeng city jiangsu province ph 7.5 solanum lycopersicum )2021-03-03v4No1 / 703
921amnon high in puerto rico compared to costa rica in cane toad bufo marinus skin epidermis skin 2022-07-24v4No1 / 704
232amnonlower in diabetec patient foot skin compared to healthy controls ( high in control compared to diabetes mellitus in homo sapiens skin australia foot )2017-11-05v4No1 / 708
415amnoncommon rhizosphere, soil, citrus, orchard, reunion island, cultivated environment2018-11-27v4No1 / 721
422amnoncommon soil, paddy field soil, oryza sativa, heilongjiang province, ph 5-6, cultivated environment, china2018-12-04v4No1 / 726
134amnon high in taxus media taxus cuspidata northeast china temperate compared to taxus mairei southeast china subtropical in rhizosphere tree taxus china 2017-04-16v4No1 / 734
415amnoncommon rhizosphere, soil, citrus, australia, orchard, cultivated environment2018-11-27v4No1 / 743
791sheryoHigher at 0cm depth compared to 80cm depth in low saline low sodicity soil in China ( high in depth (soil) 0-20cm depth 0cm compared to depth (soil) 80cm in ph 9 low salinity low sodicity soil salic solonetz da'an station china songnen plain )2021-06-08v4No1 / 748
206amnoncommon in air from israel particles <10um size (common air, dust, israel, size < 10um, clear day)2017-10-04v4No1 / 765
171amnoncommon soil, united states of america, state of california, rhizosphere, oryza sativa, rice2017-07-25v4No1 / 772
615amnoncommon in control soil with no sugarcane (common campinas, brazil, greenhouse, soil)2020-04-27v4No1 / 780
828sheryoCommon in gleysol soil of poplar plantation at 40-50cm depth, sihong, china (common depth 40-50cm, ph 6-7, clay loam, gleysol, china, jiangsu province, sihong county, chenwei forest, soil, poplar plantation, poplar)2021-08-25v4No1 / 790
384amnon high in pair of nares nasal cavity compared to oral cavity saliva mouth in equus caballus horse canada farm 2018-10-22v4No1 / 791
746sheryoCommon in saline soil fertilized with chemical fertilizer, planted with tomatos, in dafeng, china (common chemical fertilization n,p,k, solanum lycopersicum, ph 7.5, jiangsu province, dafeng city, china, solonchak, saline soil)2021-03-03v4No1 / 811
422amnoncommon soil, paddy field soil, oryza sativa, yunnan province, china, cultivated environment2018-12-02v4No1 / 821
412amnoncommon soil, hunan province, red soil, cambisol, zea mays, triticum aestivum, ph<5, china2018-11-26v4No1 / 823
415amnoncommon rhizosphere, soil, citrus, orchard, china, cultivated environment2018-11-27v4No1 / 830
837sheryoHigher at 0-40cm depth compared to 40-100cm in soil after 10 years reforestation with Black locust trees, shaanxi, China ( high in depth 0-40cm compared to depth 40-100cm in robinia pseudoacacia 10 years reforestation silt loam china loess plateau shaanxi province soil )2021-09-26v4No1 / 831
444amnoncommon rhizosphere, fragaria x ananassa, strawberry, greenhouse soil, farm, yellow brown soil, nanjing city prefecture, continuous cropping, age 5 years, age 10 years, china, cultivated environment2019-01-07v4No1 / 833
801sheryoCommon at depth 15-30cm in corn and soybean agriculture fields, Iowa USA (common ph 6, depth (soil) 15-30cm, subsurface drainage, glycine max, kelley, nicollet soil series, des moines, united states, agricultural field, iowa, zea mays, soil)2021-06-15v4No1 / 841
266amnoncommon in roots in JAM garden (common brassicaceae, boechera stricta, plant, united states of america, state of idaho, root)2017-12-19v4No1 / 843
828sheryoCommon in gleysol soil of poplar plantation at 30-40cm depth, sihong, china (common depth 30-4cm, ph 6-7, clay loam, gleysol, china, jiangsu province, sihong county, chenwei forest, soil, poplar plantation, poplar)2021-08-25v4No1 / 844
371amnonhigher in skin of amerindians compared to western visitors ( high in venezuela hunter gatherer amerindian compared to city united states of america in homo sapiens skin )2018-09-06v4No1 / 854
412amnoncommon soil, hunan province, red soil, cambisol, zea mays, triticum aestivum, ph>5, china2018-11-26v4No1 / 856
769sheryocommon in conventional tillage wheat field in northern israel (common conventional tillage, bulk soil, soil, vertisol, israel, northen israel, triticum aestivum)2021-04-18v4No1 / 861
801sheryoCommon at depth 0-15cm in corn agriculture fields, Iowa USA (common kanawha, ph 7.1, nicollet soil series, depth (soil) 0-15cm, des moines, united states, agricultural field, iowa, zea mays, soil)2021-06-15v4No1 / 862
767sheryoCommon in soil planted with Chrysanthemum, fertilized with bio-organic fertilizer in Nanjing China (common paenibacillus polymyxa, paenibacillus, compost, compost biofilter, pig manure, bio-organic fertilizer, soil, ph 6.9, chrysanthemum morifolium ramat., chrysanthemum, china, nanjing county)2021-04-14v4No1 / 866
769sheryocommon in no tillage wheat field in northern israel (common bulk soil, soil, vertisol, israel, northen israel, no tillage, triticum aestivum)2021-04-18v4No1 / 871
767sheryoCommon in soil planted with Chrysanthemum, fertilized with bio-organic fertilizer and amended with soil fumigant 'Dazomet' in Nanjing China (common pig manure, compost soil, paenibacillus, paenibacillus polymyxa, compost biofilter, bio-organic fertilizer, nanjing county, china, chrysanthemum, chrysanthemum morifolium ramat., ph 6.9, soil, soil fumigation, dazomet)2021-04-14v4No1 / 875
129amnoncommon ph 6-6.5, mexico, myrtillocactus geometrizans, opuntia robusta, cactus, semi-arid, soil2017-04-15v4No1 / 884
171amnoncommon in soil with rice growth irrigation protocol (common soil, united states of america, state of california, depth 5cm)2017-07-25v4No1 / 890
462amnon high in leaf compared to stem in united states of america state of tennessee populus tree cultivated environment 2019-01-13v4No1 / 890
791sheryoHigher in low sodicity and low salinity soil compared to high sodicity and high salinity soil at 80cm depth in China ( high in ph 9 low sodicity low salinity compared to ph 10 high sodicity high salinity in depth (soil) 80cm soil salic solonetz da'an station china songnen plain )2021-06-08v4No1 / 895
206amnoncommon in dust storm air from israel particles <10um size (common israel, air, size < 10um, dust, dust storm)2017-10-04v4No1 / 902
801sheryoCommon in soybean and corn agriculture fields at depth 15-30cm, Iowa USA (common ph 7.4, depth (soil) 15-30cm, united states, nicollet soil series, glycine max, zea mays, ames, des moines, iowa, agricultural field, soil)2021-06-15v4No1 / 905
462amnoncommon depth (soil) 20-60cm, united states of america, state of tennessee, depth 30-75cm, silt clay loam, rhizosphere, populus, tree, cultivated environment2019-01-13v4No1 / 908
609sheryoCommon in soil without tobacco plants amended with difenoconazole fungicide and biochar (common biochar, without plants, difenoconazole, fungicide, ph 7-8, china, tobacco field, limestone, depth 0-20cm, soil)2020-07-05v4No1 / 910
609sheryoCommon in soil without tobacco plants amended with difenoconazole fungicide (common without plants, difenoconazole, fungicide, ph 7-8, china, tobacco field, limestone, depth 0-20cm, soil)2020-07-05v4No1 / 915
767sheryocommon in soil planted with Chrysanthemum, infested with fusarium in Nanjing China (common soil, fusarium, fusarium oxysporum f. sp. chrysanthemi, ph 6.9, chrysanthemum morifolium ramat., chrysanthemum, china, nanjing county)2021-04-14v4No1 / 922
548amnoncommon minas gerais state, campos rupestres, brazil, rock2019-08-17v4No1 / 924
126amnoncommon rhizosphere, germany, hordeum vulgare, winter barley2017-04-14v4No1 / 925
791sheryoHigher in low sodicity and low salinity soil compared to high sodicity and high salinity soil at 0cm depth in China ( high in ph 8.5 low sodicity low salinity compared to ph 10.5 high sodicity high salinity in depth (soil) 0-20cm depth 0cm soil salic solonetz da'an station china songnen plain )2021-06-08v4No1 / 932
462amnoncommon depth (soil) 0-30 cm, depth (soil) 0-20cm, united states of america, state of tennessee, soil, silt loam, cultivated environment2019-01-13v4No1 / 938
444amnoncommon in uncultivated soil plot (common yellow brown soil, nanjing city prefecture, soil, china)2019-01-07v4No1 / 946
767sheryoCommon in soil planted with Chrysanthemum, amended with soil fumigant 'Dazomet' in Nanjing China (common nanjing county, china, chrysanthemum, chrysanthemum morifolium ramat., ph 6.9, soil, soil fumigation, dazomet)2021-04-14v4No1 / 946
37amnonlower in tomato plant leaves compared to plastic control ( high in control compared to solanum lycopersicum in maryland county leaf )2016-12-09v4No1 / 950
98amnoncommon citrus, rhizosphere, quincy, fl, root, state of florida2017-04-01v4No1 / 950
422amnoncommon soil, paddy field soil, jiangsu province, oryza sativa, china, cultivated environment2018-12-02v4No1 / 957
129amnoncommon ph 6-6.5, mexico, myrtillocactus geometrizans, opuntia robusta, cactus, semi-arid, soil, root zone soil2017-04-15v4No1 / 968
821sheryoCommon in soil of restored prairie at 25-50cm depth, Michigan USA (common depth (soil) 25-50cm, restored prairie, united states of america, state of michigan, kellogg biological station, mesic type hapludalf, kalamazoo loam, soil)2021-07-28v4No1 / 968
266amnoncommon in soil from MIL garden (common soil, united states of america, state of idaho, ph 6.5)2017-12-18v4No1 / 980
675sheryoCommon in watermelon rhizosphere soil (common co culture with wheat (triticum aestivum l.), un-inoculated, ph 7, citrullus lanatus, rhizosphere, china)2028-02-22v4No1 / 980
828sheryoCommon in gleysol soil of poplar plantation at 20-30cm depth, sihong, china (common depth (soil) 20-30cm, ph 6-7, clay loam, gleysol, china, jiangsu province, sihong county, chenwei forest, soil, poplar plantation, poplar)2021-08-25v4No1 / 989
360amnon high in soil compared to agave rhizosphere in desert mexico state of california 2018-08-21v4No1 / 992
746sheryoCommon in saline soil fertilized with biological fertilizer, planted with tomatos, in dafeng, china (common saline soil, solonchak, china, dafeng city, jiangsu province, ph 7.5, solanum lycopersicum, biological fertilization, chicken manure, trichoderma guizhouense njau 4742)2021-03-03v4No1 / 993
462amnoncommon depth (soil) 0-30 cm, depth (soil) 0-20cm, united states of america, state of tennessee, rhizosphere, populus, tree, silt loam, cultivated environment2019-01-13v4No1 / 997
412amnon high in ph>5 compared to ph<5 in soil hunan province red soil cambisol zea mays triticum aestivum china 2018-11-26v4No1 / 1005
479amnoncommon rhizosphere, united states of america, state of california, heteromeles arbutifolia, ph 6-72019-02-05v4No1 / 1006
824sheryoHigher at 20-40cm depth compared to 40-60cm depth in soil after grazing exclusion, Ningxia china ( high in depth 20-40cm compared to depth 40-60cm in yunwushan national natural grassland protection zone ningxia province calci-orthic aridisol haplic calcisol grazing exclusion china soil )2021-08-08v4No1 / 1025
791sheryoCommon at 0cm depth in low saline low sodicity soil in China (common depth (soil) 0-20cm, ph 8.5, depth 0cm, low salinity, low sodicity, soil, salic solonetz, da'an station, china, songnen plain)2021-06-07v4No1 / 1035
422amnoncommon soil, paddy field soil, oryza sativa, heilongjiang province, china, cultivated environment2018-12-02v4No1 / 1049
828sheryoCommon in gleysol soil of poplar plantation at 0-10cm depth, sihong, china (common depth (soil) 0-10cm, ph 6-7, clay loam, gleysol, china, jiangsu province, sihong county, chenwei forest, soil, poplar plantation, poplar)2021-08-25v4No1 / 1069
263amnoncommon in desert soil irrigated daily in lab (common soil, israel, sandy loam soil, negev desert, ph 7-8, irrigated, research facility)2017-12-11v4No1 / 1076
252amnoncommon in river rock biofilm (common biofilm, kingdom of spain, biofilm, river, rock, epilithic)2017-11-22v4No1 / 1081
478amnoncommon farm, shrimp farm, sediment, china2019-02-19v4No1 / 1085
791sheryoCommon at 40cm depth in low saline low sodicity soil in China (common depth (soil) 40cm, ph 9, low salinity, low sodicity, soil, salic solonetz, da'an station, china, songnen plain)2021-06-08v4No1 / 1085
415amnoncommon rhizosphere, soil, citrus, orchard, brazil, cultivated environment2018-11-27v4No1 / 1091
415amnoncommon rhizosphere, soil, citrus, orchard, kingdom of spain, cultivated environment2018-11-27v4No1 / 1099
801sheryoHigher at depth 0-15cm compared to depth 60-90cm in soybean and corn agriculture fields , Iowa USA ( high in depth (soil) 0-15cm compared to depth (soil) 60-90cm in united states nicollet soil series glycine max zea mays ames des moines iowa agricultural field soil )2021-06-15v4No1 / 1102
414amnoncommon soil, heilongjiang province, agricultural feature, triticum aestivum, glycine max, zea mays, black soil, mollisol, npk fertilizer, ph<6, china2018-11-26v4No1 / 1105
101amnoncommon state of new york, merlot, vitis vinifera, grapevine, united states of america, root2017-04-03v4No1 / 1106
360amnonlower in leaf surface compared to soil in agave plants ( high in soil compared to leaf leaf surface in desert state of california mexico guanajuato agave )2018-08-21v4No1 / 1108
767sheryocommon in soil planted with Chrysanthemum, fertilized with bio-organic fertilizer, amended with soil fumigant 'Dazomet' and deep plough in Nanjing China (common dazomet, soil fumigation, soil, ph 6.9, chrysanthemum morifolium ramat., chrysanthemum, china, nanjing county, bio-organic fertilizer, compost biofilter, paenibacillus polymyxa, paenibacillus, compost soil, pig manure, conventional tillage, deep plough)2021-04-18v4No1 / 1109
824sheryocommon in soil after 0-9 years of grazing exclusion at 40-60cm depth, Ningxia china (common 0-9 years of grazing exclusion, yunwushan national natural grassland protection zone, ningxia province, calci-orthic aridisol, haplic calcisol, grazing exclusion, depth 40-60cm, china, soil)2021-08-08v4No1 / 1113
828sheryoCommon in gleysol soil of poplar plantation at 10-20cm depth, sihong, china (common depth 10-20cm, ph 6-7, clay loam, gleysol, china, jiangsu province, sihong county, chenwei forest, soil, poplar plantation, poplar)2021-08-25v4No1 / 1123
791sheryoCommon at 80cm depth in low saline low sodicity soil in China (common depth (soil) 80cm, ph 9, low salinity, low sodicity, soil, salic solonetz, da'an station, china, songnen plain)2021-06-08v4No1 / 1128
515amnon high in carabidae compared to staphylinidae in whole body beetle carnivorous beetle river poland 2019-04-19v4No1 / 1130
146amnon high in soil compared to rhizosphere in united states of america solanum lycopersicum tomato slit loam ph 6 2017-04-20v4No1 / 1135
134amnoncommon rhizosphere, tree, taxus, northeast china, temperate, taxus cuspidata, china2017-04-16v4No1 / 1141
146amnoncommon united states of america, solanum lycopersicum, tomato, soil, slit loam soil, ph 62017-04-20v4No1 / 1144
791sheryoCommon at 20cm depth in low saline low sodicity soil in China (common ph 9, depth 20cm, ph 8.5, low salinity, low sodicity, soil, salic solonetz, da'an station, china, songnen plain)2021-06-08v4No1 / 1155
422amnoncommon soil, paddy field soil, oryza sativa, heilongjiang province, ph 7-8, cultivated environment, china2018-12-04v4No1 / 1169
746sheryoCommon in saline soil in dafeng, china (common ph 7.6, jiangsu province, dafeng city, china, solonchak, saline soil)2021-03-03v4No1 / 1170
252amnoncommon in river sand biofilm (common biofilm, river, biofilm, kingdom of spain, sand)2017-11-22v4No1 / 1181
421amnoncommon soil, paddy field soil, zhejiang province, china2018-12-04v4No1 / 1194
801sheryoCommon at depth 0-15cm in corn and soybean agriculture fields, Iowa USA (common subsurface drainage, ph 6.2, depth (soil) 0-15cm, glycine max, kelley, nicollet soil series, des moines, united states, agricultural field, iowa, zea mays, soil)2021-06-15v4No1 / 1202
837sheryoCommon in agricultural field at depths 100-300cm, shaanxi, China (common depth 100-300cm, agricultural field, zea mays, triticum aestivum, silt loam, china, loess plateau, shaanxi province, soil)2021-09-26v4No1 / 1220
444amnonlower in continuously cropped strawberry soil ( high in age 1 year compared to age 5 years age 10 years continuous cropping in rhizosphere fragaria x ananassa strawberry greenhouse soil farm yellow brown soil nanjing city prefecture china cultivated environment )2019-01-07v4No1 / 1221
801sheryoCommon in soybean and corn agriculture fields at depth 0-15cm, Iowa USA (common united states, ph 7.5, nicollet soil series, depth (soil) 0-15cm, glycine max, zea mays, ames, des moines, iowa, agricultural field, soil)2021-06-15v4No1 / 1226
824sheryoCommon in soil after 27-35 years of grazing exclusion at 40-60cm depth, Ningxia china (common 27-35 years of grazing exclusion, depth 40-60cm, yunwushan national natural grassland protection zone, ningxia province, calci-orthic aridisol, haplic calcisol, grazing exclusion, china, soil)2021-08-08v4No1 / 1232
420amnoncommon in soil of vegetables in organic field (common soil, ph>7, ph 7-8, agricultural feature, farm, shanghai proper, clay loam, organic farming, cultivated environment, china)2018-12-02v4No1 / 1240
821sheryoCommon in soil of restored prairie at 10-25cm depth, Michigan USA (common depth (soil) 10-25cm, restored prairie, united states of america, state of michigan, kellogg biological station, mesic type hapludalf, kalamazoo loam, soil)2021-07-28v4No1 / 1241
901amnoncommon taihu lake, depth (sediment) 0-20cm, depth (water) 20-100cm, taihu national park, china, lake sediment2022-04-25v4No1 / 1246
134amnoncommon rhizosphere, tree, taxus, taxus media, northeast china, temperate, china2017-04-16v4No1 / 1251
837sheryoCommon in agricultural field at depths 40-100cm, shaanxi, China (common depth 40-100cm, agricultural field, zea mays, triticum aestivum, silt loam, china, loess plateau, shaanxi province, soil)2021-09-26v4No1 / 1263
298amnoncommon soil, desert, united states of america, state of utah, depth 1cm, soil crust2018-02-20v4No1 / 1265
675sheryoCommon in watermelon rhizosphere soil inoculated with Fusarium oxysporum f. sp. niveum (common china, rhizosphere, citrullus lanatus, co culture with wheat (triticum aestivum l.), ph 7, inoculated with fusarium oxysporum f. sp. niveum)2028-02-22v4No1 / 1271
309amnon high in veronica chamaedrys germander speedwell compared to other plants in rhizosphere germany 2018-04-05v4No1 / 1272
824sheryoCommoon in soil after 0-9 years of grazing exclusion at 20-40cm depth, Ningxia china (common depth 20-40cm, 0-9 years of grazing exclusion, yunwushan national natural grassland protection zone, ningxia province, calci-orthic aridisol, haplic calcisol, grazing exclusion, china, soil)2021-08-08v4No1 / 1274
415amnoncommon rhizosphere, soil, citrus, orchard, italy, cultivated environment2018-11-27v4No1 / 1279
414amnoncommon soil, heilongjiang province, agricultural feature, triticum aestivum, glycine max, zea mays, black soil, mollisol, ph>6, china2018-11-26v4No1 / 1282
821sheryoCommon in soil of restored prairie at 0-10cm depth, Michigan USA (common ph 6.5, depth (soil) 0-10cm, restored prairie, united states of america, state of michigan, kellogg biological station, mesic type hapludalf, kalamazoo loam, soil)2021-07-28v4No1 / 1291
420amnoncommon in soil of vegetables in organic plastic tunnel (common soil, ph>7, ph 7-8, agricultural feature, farm, shanghai proper, clay loam, organic farming, greenhouse soil, china, cultivated environment)2018-12-02v4No1 / 1294
837sheryoCommon in soil at 0-40-100cm depth after 20 years reforestation with Black locust trees, shaanxi, China (common depth 40-100cm, 20 years, robinia pseudoacacia, reforestation, silt loam, china, loess plateau, shaanxi province, soil)2021-09-26v4No1 / 1294
309amnoncommon lathyrus pratensis, rhizosphere, germany, meadow pea-vine2018-04-05v4No1 / 1296
837sheryoCommon in soil at 40-100cm depth after 30 years reforestation with Black locust trees, shaanxi, China (common depth 40-100cm, 30 years, robinia pseudoacacia, reforestation, silt loam, china, loess plateau, shaanxi province, soil)2021-09-26v4No1 / 1311
101amnon high in rhizosphere compared to root in state of new york vitis vinifera united states of america merlot grapevine 2017-04-03v4No1 / 1315
837sheryoCommon in soil after 10 years reforestation with Black locust trees at 0-40cm depth, shaanxi, China (common depth 0-40cm, robinia pseudoacacia, 10 years, reforestation, silt loam, china, loess plateau, shaanxi province, soil)2021-09-26v4No1 / 1317
837sheryoCommon in soil at 100-300cm depth after 20 years reforestation with Black locust trees, shaanxi, China (common depth 100-300cm, 20 years, robinia pseudoacacia, reforestation, silt loam, china, loess plateau, shaanxi province, soil)2021-09-26v4No1 / 1317
309amnoncommon rhizosphere, germany, onobrychis viciifolia, common sainfoin2018-04-05v4No1 / 1323
837sheryoCommon in soil at 0-40cm depth after 20 years reforestation with Black locust trees, shaanxi, China (common 20 years, depth 0-40cm, robinia pseudoacacia, loess plateau, shaanxi province, china, reforestation, silt loam, soil)2021-09-26v4No1 / 1323
783sheryocommon in desert soil in mongolia without water addition treatment (common no water addition, ambient precipitation, ph 7.85, luvic gypsisols, cambic arenosols, china, mongolia, dengkou county, ulan buh desert, bajada, sandy desert, soil)2021-05-11v4No1 / 1324
600sheryoCommon in biochar ammended soil after 82 days (common depth (soil) 0-5cm, state of new york, soil, biochar, united states of america, coarse-loamy soil, ph 6, day 82)2020-03-27v4No1 / 1326
259amnoncommon in soil and rhizpsphere of peanut plants (common soil, rhizosphere, ph 5, arachis hypogaea, peanut, china)2017-12-02v4No1 / 1334
98amnoncommon citrus, rhizosphere, ft. pierce, fl, root, state of florida2017-04-01v4No1 / 1340
837sheryoCommon in soil at 0-40 cm depth after 30 years reforestation with Black locust trees, shaanxi, China (common 30 years, depth 0-40cm, robinia pseudoacacia, reforestation, silt loam, china, loess plateau, shaanxi province, soil)2021-09-26v4No1 / 1346
837sheryoCommon in soil at 100-300cm depth after 30 years reforestation with Black locust trees, shaanxi, China (common depth 100-300cm, 30 years, robinia pseudoacacia, reforestation, silt loam, china, loess plateau, shaanxi province, soil)2021-09-26v4No1 / 1354
809amnoncommon dendrobium huoshanense, lu'an city prefecture, flowerpot, research facility, greenhouse, rhizosphere, china2021-06-20v4No1 / 1356
824sheryoCommon in soil after 27-35 years of grazing exclusion at 20-40cm depth, Ningxia china (common depth 20-40cm, 27-35 years of grazing exclusion, yunwushan national natural grassland protection zone, ningxia province, calci-orthic aridisol, haplic calcisol, grazing exclusion, china, soil)2021-08-08v4No1 / 1369
98amnoncommon citrus, rhizosphere, gainesville, fl, root, state of florida2017-04-01v4No1 / 1371
420amnoncommon in soil of vegetable open field (common soil, ph>7, ph 7-8, agricultural feature, farm, shanghai proper, clay loam, npk fertilizer, cultivated environment, china)2018-12-02v4No1 / 1376
821sheryoCommon in soil of miscanthus field at 10-25cm depth, Michigan USA (common depth (soil) 10-25cm, miscanthus, restored prairie, united states of america, state of michigan, kellogg biological station, mesic type hapludalf, kalamazoo loam, soil)2021-08-02v4No1 / 1377
901amnoncommon in macrophyte plant rhizosphere (common rhizosphere, depth (sediment) 0-20cm, taihu lake, taihu national park, china, depth (water) 20-100cm, lake sediment)2022-04-25v4No1 / 1378
821sheryoCommon in soil of continuous corn field at 0-10cm depth, Michigan USA (common united states of america, state of michigan, kellogg biological station, ph 5.9, mesic type hapludalf, kalamazoo loam, depth (soil) 0-10cm, continuous corn, corn, soil)2021-07-28v4No1 / 1380
883amnon high in non-contaminated soil compared to oil contaminated soil oilfield in yellow river delta china shengli oilfield soil 2022-03-20v4No1 / 1381
821sheryoHigher at 0-10cm depth compared to 10-25cm depth in soil in Michigan USA ( high in depth (soil) 0-10cm compared to depth (soil) 10-25cm in restored prairie corn miscanthus panicum virgatum kellogg biological station mesic type hapludalf kalamazoo loam state of michigan soil united states of america )2021-08-05v4No1 / 1383
309amnoncommon rhizosphere, germany, plantago lanceolata, ribwort plantain2018-04-05v4No1 / 1386
821sheryoCommon in soil of switchgrass field at 10-25cm depth, Michigan USA (common depth (soil) 10-25cm, kellogg biological station, mesic type hapludalf, kalamazoo loam, panicum virgatum, state of michigan, soil, united states of america)2021-08-02v4No1 / 1387
1008amnoncommon ph 7-8, jinxiang county, garlic, allium sativum, fertilized soil, farm, china, rhizosphere2023-01-26v4No1 / 1393
600sheryoCommon in unammended soil after 82 days (common depth (soil) 0-5cm, state of new york, soil, united states of america, coarse-loamy soil, ph 6, day 82)2020-03-27v4No1 / 1395
420amnonhigh freq. in soil of vegetable in plastic tunnel (common soil, ph>7, ph 7-8, agricultural feature, farm, shanghai proper, clay loam, npk fertilizer, greenhouse soil, cultivated environment, china)2018-12-02v4No1 / 1396
824sheryoCommon in soil after 0-9 years of grazing exclusion at 10-20cm depth, Ningxia china (common depth 10-20cm, 0-9 years of grazing exclusion, yunwushan national natural grassland protection zone, ningxia province, calci-orthic aridisol, haplic calcisol, grazing exclusion, china, soil)2021-08-08v4No1 / 1397
422amnoncommon soil, paddy field soil, oryza sativa, hunan province, hubei province, china, cultivated environment2018-12-02v4No1 / 1399
76amnoncommon in non-seleniferous soil (common soil, rhizosphere, united states of america, non-seleniferous, state of florida)2017-02-28v4No1 / 1414
40amnoncommon soil, field soil, nicotiana tabacum, rhizosphere, china2016-12-09v4No1 / 1420
462amnon high in rhizosphere compared to soil in united states of america state of tennessee populus tree cultivated environment 2019-01-12v4No1 / 1428
309amnoncommon rhizosphere, germany, geranium pratense, meadow geranium2018-04-05v4No1 / 1434
571amnoncommon depth (soil) 0-20cm, china, soil, mangrove swamp, marine sediment, zhejiang province, futian national nature reserve, mangrove, kandelia candel2019-12-16v4No1 / 1435
76amnoncommon in seleniferous soil (common soil, rhizosphere, united states of america, selenium, seleniferous, woodland area)2017-02-28v4No1 / 1438
444amnoncommon rhizosphere, fragaria x ananassa, strawberry, greenhouse soil, farm, yellow brown soil, nanjing city prefecture, age 1 year, china, cultivated environment2019-01-07v4No1 / 1439
783sheryocommon in desert soil in mongolia under water addition treatment (common 100% above ambient precipitation, water addition, ph 7.85, luvic gypsisols, cambic arenosols, china, mongolia, dengkou county, ulan buh desert, bajada, sandy desert, soil)2021-05-11v4No1 / 1442
821sheryoCommon in soil of miscanthus field at 0-10cm depth, Michigan USA (common depth (soil) 0-10cm, miscanthus, restored prairie, united states of america, state of michigan, kellogg biological station, mesic type hapludalf, kalamazoo loam, soil)2021-07-28v4No1 / 1447
414amnon high in ph>6 compared to ph<6 npk fertilizer in soil heilongjiang province agricultural feature triticum aestivum glycine max zea mays black soil mollisol china 2018-11-26v4No1 / 1451
266amnoncommon in soil from JAM garden (common soil, united states of america, state of idaho, ph 5.5)2017-12-18v4No1 / 1456
686sheryoCommon in vanilla field soil infected with Fusarium oxysporum, fertilized with chemical fertilizer and had high Fusarium cumulative disease incidence (common ph 7.6, wanning city, pot expreiment, vanilla planifolia, soil from vanilla field, fusarium oxysporum f. sp. vanillae, chemical fertilization n,p,k, high fusarium cumulative disease incidence )2028-03-08v4No1 / 1456
271amnoncommon depth (soil) 0-20cm, rhizosphere, glycine max, soybean, china2018-01-09v4No1 / 1459
837sheryoCommon in agricultural field at depths 0-40cm, shaanxi, China (common depth 0-40cm, agricultural field, zea mays, triticum aestivum, silt loam, china, loess plateau, shaanxi province, soil)2021-09-26v4No1 / 1470
824sheryoCommon in soil after 27-35 years of grazing exclusion at 10-20cm depth, Ningxia china (common depth 10-20cm, 27-35 years of grazing exclusion, yunwushan national natural grassland protection zone, ningxia province, calci-orthic aridisol, haplic calcisol, grazing exclusion, china, soil)2021-08-08v4No1 / 1477
760sheryoCommon in rhizosphere soil of rice plants with NPK fertilization in a long term fertilization experiment (common npk fertilization, npk fertilizer, ph 5.9, china, soil, qiyang county, hunan province, quaternary red clay, oryza sativa, rhizosphere)2021-04-06v4No1 / 1491
760sheryoCommon in rhizosphere soil of rice plants without fertilization in a long term fertilization experiment (common ph 5.9, china, soil, qiyang county, hunan province, quaternary red clay, no fertilization, oryza sativa, rhizosphere)2021-04-06v4No1 / 1506
309amnoncommon rhizosphere, germany, festuca rubra, red fescue grass2018-04-05v4No1 / 1510
145amnoncommon soil, rhizosphere, oryza sativa, rice, united states of america, ph 5.62017-04-19v4No1 / 1515
901amnoncommon sediment surface, depth (sediment) 0cm, taihu lake, depth (water) 20-100cm, taihu national park, china, lake sediment2022-04-25v4No1 / 1550
309amnoncommon rhizosphere, germany, galium mollugo, hedge bedstraw2018-04-05v4No1 / 1599
665amnon high in inlet compared to outlet in late time points engineered wetland benthic biomat state of california water treatment pond microbial biomat biomat united states of america 2020-09-23v4No1 / 1629
608sheryoCommon in wheat field in China, amended and unamended biochar, unamended with nitrogen fertilizer (common triticum aestivum l. cv., xiaoyan no. 22, china, silty clay, soil)2020-04-20v4No1 / 1643
462amnon high in depth (soil) 0-30 cm depth (soil) 0-20cm silt loam compared to detph 30-75cm silt clay loam in soil united states of america state of tennessee cultivated environment 2019-01-12v4No1 / 1648
821sheryoCommon in soil of continuous corn field at 10-25cm depth, Michigan USA (common depth (soil) 10-25cm, united states of america, state of michigan, kellogg biological station, mesic type hapludalf, kalamazoo loam, continuous corn, corn, soil)2021-07-28v4No1 / 1649
824sheryoCommon in soil after 27-35 years of grazing exclusion at 0-10cm depth, Ningxia china (common yunwushan national natural grassland protection zone, ningxia province, calci-orthic aridisol, haplic calcisol, 27-35 years of grazing exclusion, grazing exclusion, china, depth (soil) 0-10cm, soil)2021-08-08v4No1 / 1659
686sheryoCommon in vanilla field soil infected with Fusarium oxysporum, fertilized with fungal bio-fertilizer and had low Fusarium cumulative disease incidence (common trichoderma guizhouense njau 4742, fungal enriched bio-fertilizer, fusarium oxysporum f. sp. vanillae, soil from vanilla field, vanilla planifolia, pot expreiment, wanning city, ph 7.6, low fusarium cumulative disease incidence )2028-03-08v4No1 / 1661
760sheryoCommon in rhizosphere soil of rice plants with manure fertilization in a long term fertilization experiment (common manure fertilization, manured soil, ph 5.9, china, soil, qiyang county, hunan province, quaternary red clay, oryza sativa, rhizosphere)2021-04-06v4No1 / 1670
608sheryoCommon in wheat field in China, amended and unamended biochar, amended with nitrogen fertilizer (common triticum aestivum l. cv., xiaoyan no. 22, china, silty clay, soil, urea enriched soil)2020-04-20v4No1 / 1682
821sheryoHigher at 10-25cm depth compared to 25-50cm depth in soil in Michigan USA ( high in depth (soil) 10-25cm compared to depth (soil) 25-50cm in restored prairie corn miscanthus panicum virgatum kellogg biological station mesic type hapludalf kalamazoo loam state of michigan soil united states of america )2021-08-05v4No1 / 1704
686sheryoCommon in vanilla field soil infected with Fusarium oxysporum, fertilized with bacterial bio-fertilizer and had low Fusarium cumulative disease incidence (common fusarium oxysporum f. sp. vanillae, soil from vanilla field, vanilla planifolia, pot expreiment, wanning city, ph 7.6, bacterial enriched bio-fertilizer, bacillus amyloliquefaciens w19, low fusarium cumulative disease incidence )2028-03-08v4No1 / 1726
686sheryoCommon in vanilla field soil infected with Fusarium oxysporum, fertilized with organic fertilizer and had high Fusarium cumulative disease incidence (common organic fertilizer- chicken manure compost, ph 7.6, wanning city, pot expreiment, vanilla planifolia, soil from vanilla field, fusarium oxysporum f. sp. vanillae, high fusarium cumulative disease incidence )2028-03-08v4No1 / 1765
536amnon high in aquatic snake compared to terrestrial snake in snake skin united states of america southern united states 2019-07-28v4No1 / 1772
309amnoncommon rhizosphere, germany, veronica chamaedrys, germander speedwell2018-04-05v4No1 / 1788
353amnonlower in captive compared to wild caught Lissotriton vulgaris newts skin ( high in wild compared to research facility in newt adult skin cambridgeshire triturus cristatus united kingdom )2018-07-30v4No1 / 1834
156amnoncommon soil, rhizosphere, brassica, brassica oleracea, china2017-07-27v4No1 / 1885
296amnoncommon depth (soil) 0-20cm, soil, north china plain, agricultural feature, wheat, winter, ph>4, ph<5, china2018-02-11v4No1 / 1886
901amnon high in rhizosphere compared to bulk sediment in depth (sediment) 0-20cm taihu lake depth (water) 20-100cm taihu national park china lake sediment 2022-04-25v4No1 / 1892
263amnonlower in heat stressed soil (65C) compared to control ( high in control compared to heat stressed soil in soil israel sandy loam soil negev desert ph 7-8 irrigated research facility )2017-12-11v4No1 / 1893
824sheryoCommon in soil after 0-9 years of grazing exclusion at 0-10cm depth, Ningxia china (common depth (soil) 0-10cm, 0-9 years of grazing exclusion, yunwushan national natural grassland protection zone, ningxia province, calci-orthic aridisol, haplic calcisol, grazing exclusion, china, soil)2021-08-08v4No1 / 1903
155amnoncommon in soil tightly bound to wheat root (common triticum aestivum, wheat, soil, root, china)2017-07-02v4No1 / 1977
101amnoncommon state of new york, vitis vinifera, united states of america, merlot, grapevine, rhizosphere2017-04-03v4No1 / 1980
821sheryoCommon in soil of switchgrass field at 0-10cm depth, Michigan USA (common kellogg biological station, mesic type hapludalf, kalamazoo loam, panicum virgatum, depth (soil) 0-10cm, state of michigan, soil, united states of america)2021-08-02v4No1 / 2067
175amnoncommon in heavy metal contaminated soils in china (common soil, heavy metal, ph 7-9, china)2017-07-29v4No1 / 2133
296amnoncommon depth (soil) 0-20cm, soil, north china plain, agricultural feature, wheat, winter, ph>7, ph<8, china2018-02-11v4No1 / 2160
353amnonlower in captive compared to wild caught Lissotriton vulgaris newts skin ( high in wild compared to research facility in newt adult skin cambridgeshire lissotriton vulgaris united kingdom )2018-07-30v4No1 / 2162
296amnoncommon depth (soil) 0-20cm, soil, north china plain, agricultural feature, wheat, winter, ph>6, ph<7, china2018-02-11v4No1 / 2223
166amnoncommon in river sediment (5cm) with mussels (common united states of america, river, sediment, freshwater biome, mississippi river, depth 5cm, upper mississippi river, mussel, unionidae)2017-07-18v4No1 / 2254
296amnoncommon in wheat field soil (common soil, north china plain, depth 5cm, agricultural feature, wheat, winter, china)2018-02-11v4No1 / 2341
155amnoncommon in soil loosely bound to wheat root (common triticum aestivum, wheat, soil, rhizosphere, china)2017-07-02v4No1 / 2425
101amnoncommon state of new york, vitis vinifera, united states of america, merlot, grapevine, soil2017-04-03v4No1 / 2537
155amnoncommon in bulk soil in wheat field (common triticum aestivum, wheat, soil, bulk soil, china)2017-07-02v4No1 / 2594
296amnoncommon depth (soil) 0-20cm, soil, north china plain, agricultural feature, wheat, winter, ph>8, china2018-02-11v4No1 / 2646
357amnon high in ph>4.5 compared to ph<4.5 in soil topsoil depth (soil) 0-10cm moist tropical forest woodland area forest ecosystem 2018-08-18v4No1 / 2773
271amnoncommon depth (soil) 0-20cm, soil, china2018-01-09v4No1 / 2856
166amnoncommon in river sediment (5cm) without mussels (common freshwater biome, river, united states of america, sediment, mississippi river, depth 5cm, upper mississippi river)2017-07-18v4No1 / 2877
837sheryoHigher in soil of agricultural feild compared to after 20 years reforestation with Black locust trees , shaanxi, China ( high in triticum aestivum zea mays agricultural field compared to 20 years robinia pseudoacacia reforestation in silt loam china loess plateau shaanxi province soil )2021-09-26v4No1 / 2892
837sheryoHigher in soil of agricultural feild compared to after 30 years reforestation with Black locust trees , shaanxi, China ( high in triticum aestivum zea mays agricultural field compared to robinia pseudoacacia 30 years reforestation in silt loam china loess plateau shaanxi province soil )2021-09-27v4No1 / 2927
155amnonlower in tightly bound root soil compared to loose soil and bulk soil ( high in bulk soil compared to root in triticum aestivum wheat soil china )2017-07-02v4No1 / 2933
837sheryoHigher in soil in agricultural feild compared after 10 years reforestation with Black locust trees, shaanxi, China ( high in triticum aestivum zea mays agricultural field compared to 10 years reforestation robinia pseudoacacia in silt loam china loess plateau shaanxi province soil )2021-09-26v4No1 / 2994
422amnon high in ph 7-8 compared to ph 5-6 in soil paddy field soil oryza sativa heilongjiang province cultivated environment china 2018-12-04v4No1 / 3267
296amnoncommon depth (soil) 0-20cm, soil, north china plain, agricultural feature, wheat, winter, ph>5, ph<6, china2018-02-11v4No1 / 3508
103amnonhigher in particle bound fraction compared to free floating bacteria in mississippi river ( high in particles compared to free floating in river united states of america mississippi river fresh water aquatic biome )2017-04-05v4No1 / 3559
462amnon high in rhizosphere compared to root in united states of america state of tennessee populus tree cultivated environment 2019-01-13v4No1 / 4630
271amnon high in soil compared to rhizosphere glycine max soybean in depth (soil) 0-20cm china 2018-01-09v4No1 / 4853
837sheryoHigher in soil after 30 years compared to 10 years of reforestation with Black locust trees, shaanxi, China ( high in 30 years compared to 10 years in robinia pseudoacacia reforestation silt loam china loess plateau shaanxi province soil )2021-09-27v4No1 / 5245
837sheryoHigher in soil after 20 years compared to 10 years of reforestation with Black locust trees, shaanxi, China ( high in 20 years compared to 10 years in robinia pseudoacacia reforestation silt loam china loess plateau shaanxi province soil )2021-09-27v4No1 / 5270
266amnon high in root compared to leaf in brassicaceae boechera stricta plant united states of america state of idaho 2017-12-19v4No1 / 5886
171amnonlower in roots compared to rhizosphere soil in rice ( high in rhizosphere soil compared to root in united states of america state of california oryza sativa rice )2017-07-25v4No1 / 7628
271amnon high in soil rhizosphere compared to root structure root in depth (soil) 0-20cm glycine max soybean china 2018-01-09v4No1 / 7954

Problems / suggestions? Please email info AT dbbact DOT org