Search result for sequence:
TACAGAGGGTGCGAACGTTGCTCGGATTTACTGGGCGTAAAGCGCGTGTAGGCGGATAGGAAAGTCGGTTGTGAAATCCCTGGGCTCAACCTAGGAACTGCATCCGAAACTGCCTGTCTTGAGTAATGGAGAGGGTGGCGGAATTCCCGG
common ontology terms
Fraction of dbbact annotations with this term covered by the query
TermScore
shrimp farm0.500000
danzhou xinyinggang nature reserve0.500000
kandelia candel0.500000
dongzhaigang national nature reserve0.500000
mudflat0.500000
futian national nature reserve0.500000
leizhou nature reserve0.500000
shenzhen futian national nature reserve0.500000
spartina alterniflora0.333333
hainan autonomous prefecture0.333333
mangrove0.333333
guangdong province0.333333
mangrove swamp0.250000
zhejiang province0.166667
depth 0-20cm0.142857
saline water0.125000
marine sediment0.071429
sediment0.043478
farm0.035714
water0.020000
china0.018868
soil0.015873
Fraction of annotations for the query sequences containing the term
TermScore
china1.000000
soil0.833333
mangrove swamp0.833333
marine sediment0.833333
depth 0-20cm0.833333
mangrove0.333333
kandelia candel0.333333
guangdong province0.333333
spartina alterniflora0.250000
hainan autonomous prefecture0.250000
mudflat0.250000
zhejiang province0.250000
futian national nature reserve0.250000
farm0.166667
shrimp farm0.166667
dongzhaigang national nature reserve0.166667
leizhou nature reserve0.166667
shenzhen futian national nature reserve0.166667
water0.083333
saline water0.083333
sediment0.083333
danzhou xinyinggang nature reserve0.083333
Exp. ID User ID Description Date Region Flag Sequences
478amnoncommon farm, shrimp farm, water, saline water, china2019-02-19v4No1 / 799
478amnoncommon farm, shrimp farm, sediment, china2019-02-19v4No1 / 1085
571amnoncommon china, soil, mangrove swamp, marine sediment, depth 0-20cm, spartina alterniflora, hainan autonomous prefecture, danzhou xinyinggang nature reserve2019-12-16v4No1 / 1169
571amnoncommon china, soil, mangrove swamp, marine sediment, depth 0-20cm, mangrove, kandelia candel, hainan autonomous prefecture, dongzhaigang national nature reserve2019-12-16v4No1 / 1351
571amnoncommon china, soil, mangrove swamp, marine sediment, depth 0-20cm, hainan autonomous prefecture, dongzhaigang national nature reserve, mudflat2019-12-16v4No1 / 1422
571amnoncommon china, soil, mangrove swamp, marine sediment, depth 0-20cm, zhejiang province, futian national nature reserve, mangrove, kandelia candel2019-12-16v4No1 / 1435
571amnoncommon china, soil, mangrove swamp, marine sediment, depth 0-20cm, guangdong province, leizhou nature reserve, spartina alterniflora2019-12-16v4No1 / 1437
571amnoncommon china, soil, mangrove swamp, marine sediment, depth 0-20cm, guangdong province, leizhou nature reserve, mangrove, kandelia candel2019-12-16v4No1 / 1523
571amnoncommon china, soil, mangrove swamp, marine sediment, depth 0-20cm, zhejiang province, futian national nature reserve, mudflat2019-12-16v4No1 / 1587
571amnoncommon china, soil, mangrove swamp, marine sediment, depth 0-20cm, guangdong province, shenzhen futian national nature reserve, mangrove, kandelia candel2019-12-16v4No1 / 1593
571amnoncommon china, soil, mangrove swamp, marine sediment, depth 0-20cm, mudflat, guangdong province, shenzhen futian national nature reserve2019-12-16v4No1 / 1649
571amnoncommon china, soil, mangrove swamp, marine sediment, depth 0-20cm, zhejiang province, spartina alterniflora, futian national nature reserve2019-12-16v4No1 / 1747

Problems / suggestions? Please email info AT dbbact DOT org