Search result for sequence:
TACAGAGGGTGCGAGCGTTAATCGGATTTACTGGGCGTAAAGCGTGCGTAGGCGGCTGATTAAGTCGGATGTGAAATCCCTGAGCTTAACTTAGGAATTGCATTCGATACTGGTCAGCTAGAGTATGGGAGAGGATGGTAGAATTCCAGG
common ontology terms
term enrichment score
TermScore
water0.294831
fresh water0.275591
skin0.274226
river0.266667
united states of america0.137171
intestine0.130233
china0.119195
frog0.105263
germany0.100418
koshi river0.096386
nepal0.091954
beetle0.091954
homo sapiens0.089862
brazil0.088889
research facility0.088050
depth 10 cm0.087912
filtered 2.7um0.087227
salamandra salamandra0.087227
whole body0.080808
pond0.077922
adult0.067568
wastewater treatment plant0.063830
larval stage0.063492
filtered 0.2um0.063492
southern united states0.062500
fire salamander0.062500
spring water0.062500
mississippi river0.062500
belgium0.061856
free floating0.061538
state of florida0.061538
snake0.060606
amphibian larval stage0.060606
digestive system0.058252
fish0.058252
sea water0.057143
city0.055556
kingdom of spain0.054795
leaf0.054545
toad0.051282
particle0.051282
carnivorous beetle0.050633
poland0.050633
raba river0.050633
tributary0.050633
ensete ventricosum0.050633
ethiopian banana0.050633
days 30-600.050633
anaerobic fermentation0.050633
detritivorous beetle0.050633
bulgaria0.050633
depth 1m0.050633
downstream0.050633
particle bound0.049383
mucus0.049383
autumn0.048980
costa rica0.048780
pair of nares0.048583
air0.048583
ethiopia0.048193
late timepoint0.048193
LOWER IN feces0.048193
united kingdom0.047619
summer0.045977
food (fermented)0.043956
pacific ocean0.043478
australia0.043011
state of california0.042553
lithobates catesbeianus0.038462
bumble bee0.038462
queen0.038462
hibernation0.038462
LOWER IN pond0.038462
amphibia0.038462
balkan mountains0.038462
estuary0.038462
estuary water0.038462
bilbao0.038462
philippine sea0.038462
jiulong river0.038462
fujian province0.038462
effluent0.038462
populus0.038462
lower mississippi river0.038462
LOWER IN upstream0.038462
pond water0.038095
rana catesbeiana0.037736
bullfrog0.037736
bombus terrestris0.037736
stream0.037736
foot0.037736
depth 0.5m0.037736
french republic0.037383
surface water0.036697
pig0.036697
sus scrofa0.036697
duodenum0.036697
midgut0.036364
state of tennessee0.036364
tree0.036364
Fraction of dbbact annotations with this term covered by the query
TermScore
pond1.500000
wastewater treatment plant0.750000
river0.666667
filtered 0.2um0.666667
filtered 2.7um0.666667
toad0.666667
salamandra salamandra0.666667
LOWER IN nasopharynx0.666667
particle0.666667
fresh water0.526316
koshi river0.500000
carnivorous beetle0.500000
poland0.500000
raba river0.500000
bembidion varicolor0.500000
lesser treefrog0.500000
tributary0.500000
lithobates catesbeianus0.500000
paederus limnophilus0.500000
turtle farm0.500000
rhinella icterica0.500000
yellow cururu toad0.500000
bumble bee0.500000
queen0.500000
hibernation0.500000
southern united states0.500000
carphophis amoenus0.500000
worm snake0.500000
fossorial snake0.500000
inguinal region0.500000
sebum0.500000
fire salamander0.500000
age < 3 months0.500000
leptodactylus latrans0.500000
lesser foam frog0.500000
eriocheir sinensis0.500000
stachytarpheta frantzii0.500000
purple porterweed0.500000
cadmium0.500000
paederidus ruficollis0.500000
agave0.500000
agave deserti0.500000
bronchial brush0.500000
LOWER IN sputum0.500000
LOWER IN induced sputum0.500000
chile0.500000
eupsophus vertebralis0.500000
coluber constrictor0.500000
eastern racer snake0.500000
state of rhode island0.500000
fish sauce0.500000
LOWER IN non hibernating0.500000
LOWER IN acute respiratory illness0.500000
ensete ventricosum0.500000
ethiopian banana0.500000
days 30-600.500000
anaerobic fermentation0.500000
ensete ventricosum var. maze0.500000
LOWER IN ensete ventricosum var. ketishe0.500000
cambridgeshire0.500000
lissotriton vulgaris0.500000
ganzi tibetan autonomous prefecture0.500000
LOWER IN oral wash0.500000
LOWER IN pond0.500000
aquatic snake0.500000
nerodia sipedon0.500000
northern water snake0.500000
swan goose0.500000
termite0.500000
reticulitermes flaviceps0.500000
wood diet0.500000
LOWER IN mulch diet0.500000
bufo bufo0.500000
common toad0.500000
amphibia0.500000
rhaebo haematiticus0.500000
truando toad0.500000
ensete ventricosum var. gena0.500000
craugastor fitzingeri0.500000
common rain frog0.500000
hong kong0.500000
detritivorous beetle0.500000
bulgaria0.500000
balkan mountains0.500000
aphodius haemorrhoidalis0.500000
low income0.500000
sewer0.500000
estuary0.500000
estuary water0.500000
salinity >20 ppt0.500000
bilbao0.500000
coastal water0.500000
chitin beads0.500000
subway0.500000
craugastor bransfordii0.500000
bransford’s litter frog0.500000
scinax fuscovarius0.500000
onthophagus ruficapillus0.500000
england0.500000
common carp0.500000
Fraction of annotations for the query sequences containing the term
TermScore
water0.273333
united states of america0.246667
skin0.206667
fresh water0.186667
river0.166667
china0.140000
homo sapiens0.120000
adult0.100000
research facility0.093333
intestine0.080000
brazil0.066667
frog0.060000
germany0.060000
depth 10 cm0.053333
koshi river0.053333
nepal0.053333
whole body0.053333
beetle0.053333
feces0.053333
filtered 2.7um0.046667
salamandra salamandra0.046667
digestive system0.040000
larval stage0.040000
pond0.040000
sea water0.040000
state of florida0.040000
free floating0.033333
filtered 0.2um0.033333
belgium0.033333
snake0.033333
southern united states0.033333
fish0.033333
fire salamander0.033333
amphibian larval stage0.033333
leaf0.033333
city0.033333
wastewater treatment plant0.033333
kingdom of spain0.033333
spring water0.033333
mississippi river0.033333
carnivorous beetle0.026667
poland0.026667
raba river0.026667
tributary0.026667
particle bound0.026667
toad0.026667
costa rica0.026667
state of california0.026667
mucus0.026667
pair of nares0.026667
australia0.026667
ethiopia0.026667
ensete ventricosum0.026667
ethiopian banana0.026667
late timepoint0.026667
days 30-600.026667
anaerobic fermentation0.026667
food (fermented)0.026667
united kingdom0.026667
summer0.026667
air0.026667
detritivorous beetle0.026667
bulgaria0.026667
LOWER IN feces0.026667
pacific ocean0.026667
autumn0.026667
depth 1m0.026667
particle0.026667
downstream0.026667
rana catesbeiana0.020000
lithobates catesbeianus0.020000
bullfrog0.020000
farm0.020000
pond water0.020000
bombus terrestris0.020000
bumble bee0.020000
midgut0.020000
queen0.020000
hibernation0.020000
desert0.020000
stream0.020000
control0.020000
LOWER IN pond0.020000
LOWER IN winter0.020000
amphibia0.020000
french republic0.020000
balkan mountains0.020000
estuary0.020000
estuary water0.020000
bilbao0.020000
surface water0.020000
foot0.020000
pig0.020000
sus scrofa0.020000
philippine sea0.020000
depth 0.5m0.020000
jiulong river0.020000
fujian province0.020000
duodenum0.020000
effluent0.020000
Exp. ID User ID Description Date Region Flag Sequences
534amnondominant river, water, fresh water, depth 10 cm, koshi river, nepal, free floating, filtered 0.2um2019-07-22v4No1 / 10
515amnondominant carnivorous beetle, river, poland, raba river, whole body, beetle, bembidion varicolor2019-04-18v4No1 / 12
492amnondominant brazil, skin, frog, dendropsophus minutus, lesser treefrog, adult2019-02-27v4No1 / 13
534amnondominant river, water, fresh water, depth 10 cm, koshi river, tributary, nepal, free floating, filtered 0.2um2019-07-22v4No1 / 13
492amnondominant skin, adult, rana catesbeiana, lithobates catesbeianus, bullfrog, brazil, frog2019-02-27v4No1 / 16
515amnoncommon poland, whole body, beetle, carnivorous beetle, river, raba river, paederus limnophilus2019-04-18v4No1 / 16
534amnondominant river, water, fresh water, depth 10 cm, koshi river, tributary, nepal, particle bound, filtered 2.7um2019-07-22v4No1 / 16
534amnondominant river, water, fresh water, depth 10 cm, koshi river, nepal, particle bound, filtered 2.7um2019-07-22v4No1 / 16
590amnoncommon in turtle pond water (dominant china, turtle farm, farm, hainan autonomous prefecture, pond water, water)2020-02-10v4No1 / 16
116amnondominant research facility, litopenaeus vannamei, pacific white shrimp, intestine, south china sea, china2017-04-10v4No1 / 17
492amnondominant brazil, skin, adult, rhinella icterica, toad, yellow cururu toad2019-02-27v4No1 / 18
431amnonhigh freq. in midgut of hibernating bumble bees (dominant bombus terrestris, bumble bee, midgut, research facility, queen, belgium, hibernation)2018-12-16v4No1 / 19
536amnondominant snake, skin, united states of america, southern united states, carphophis amoenus, worm snake, fossorial snake2019-07-28v4No1 / 20
377amnondominant salamandra salamandra, salamander, skin, germany2018-09-12v4No1 / 21
492amnoncommon skin, adult, brazil, rana catesbeiana, bullfrog, lithobates catesbeianus, frog2019-02-27v4No1 / 23
35amnoncommon tanzania, dense settlement biome, hospital, breast milk, homo sapiens2016-12-06v4No1 / 25
267amnoncommon fish, digestive system, oreochromis niloticus, research facility, china2017-12-24v4No1 / 28
26amnoncommon in combined swab of inguinal region and axilla (common homo sapiens, united states of america, inguinal region, axilla, sebum)2016-12-05v4No1 / 29
149amnoncommon salamandra salamandra, fire salamander, germany, larval stage, amphibian larval stage, intestine, pond2017-04-24v4No1 / 31
233amnon high in age age < 3 months compared to age > 3 months in feces homo sapiens infant united states of america 2017-11-05v4No1 / 31
492amnoncommon brazil, skin, adult, leptodactylus latrans, frog, lesser foam frog2019-02-27v4No1 / 34
50amnoncommon in mitten crab gills (common gill, eriocheir sinensis, china)2017-01-19v4No1 / 37
501amnoncommon costa rica, flower, nectar, stachytarpheta frantzii, purple porterweed2019-03-08v4No1 / 40
112amnoncommon danio rerio, zebra fish, intestine, research facility, china2017-04-09v4No1 / 41
117amnoncommon zebra fish, danio rerio, research facility, larval stage, united states of america, intestine2017-04-10v4No1 / 41
267amnonhigher in gut of fish in water with cadmium contamination compared to control ( high in cadmium compared to control in fish digestive system oreochromis niloticus research facility china )2017-12-24v4No1 / 41
50amnoncommon in mitten crab intestine (common intestine, eriocheir sinensis, china)2017-01-19v4No1 / 45
515amnoncommon poland, whole body, beetle, carnivorous beetle, river, raba river, paederidus ruficollis2019-04-18v4No1 / 45
360amnoncommon agave, agave deserti, leaf, leaf endosphere, desert, state of california2018-08-20v4No1 / 48
149amnoncommon salamandra salamandra, fire salamander, germany, larval stage, amphibian larval stage, skin, mucus2017-04-24v4No1 / 49
354amnon high in bronchus bronchial epithelium bronchial brush compared to sputum induced sputum in homo sapiens united states of america adult 2018-07-30v4No1 / 55
492amnoncommon skin, adult, chile, eupsophus vertebralis, frog2019-02-27v4No1 / 55
431amnoncommon in midgut of hibernating bumble bees (common research facility, midgut, belgium, bombus terrestris, bumble bee, queen, hibernation)2018-12-16v4No1 / 57
116amnoncommon research facility, litopenaeus vannamei, pacific white shrimp, intestine, south china sea, china2017-04-10v4No1 / 58
149amnoncommon salamandra salamandra, fire salamander, germany, larval stage, amphibian larval stage, intestine, stream2017-04-24v4No1 / 60
536amnoncommon snake, skin, united states of america, southern united states, coluber constrictor, eastern racer snake2019-07-28v4No1 / 64
311amnoncommon united states of america, state of rhode island, fish sauce, foodon product type2018-04-09v4No1 / 68
26amnoncommon united states of america, homo sapiens, pair of nares, mucus2016-12-05v4No1 / 73
431amnonhigher in midgut of hibernating bumble bees compared to non-hibernating ( high in hibernation compared to non hibernating in bombus terrestris bumble bee midgut research facility queen belgium )2018-12-16v4No1 / 77
133amnonhigher in healthy babies (<1yr) compared to acute respiratory illness ( high in control compared to acute respiratory illness respiratory system disease in homo sapiens infant nasopharynx australia )2017-04-16v4No1 / 80
534amnoncommon river, water, fresh water, depth 10 cm, koshi river, tributary, nepal, free floating, filtered 0.2um2019-07-22v4No1 / 80
539amnon high in ensete ventricosum var. maze compared to ensete ventricosum var. ketishe in ethiopia ensete ventricosum ethiopian banana late timepoint days 30-60 anaerobic fermentation food (fermented) 2019-07-31v4No1 / 84
26amnon high in pair of nares mucus compared to saliva mouth in united states of america felis catus 2016-12-05v4No1 / 86
109amnoncommon usa, water, drinking water, site c2017-04-08v4No1 / 86
277amnon high in pair of nares nasal cavity compared to nasopharynx in homo sapiens belgium adult 2018-01-23v4No1 / 86
353amnoncommon in captive Lissotriton vulgaris newts skin (common newt, adult, skin, cambridgeshire, research facility, lissotriton vulgaris, united kingdom)2018-07-30v4No1 / 86
382amnoncommon water, hot spring, geothermal field, ganzi tibetan autonomous prefecture, china, high temperature environment2018-10-22v4No1 / 89
354amnon high in bronchus bronchial brush bronchial epithelium compared to saliva oral wash in homo sapiens united states of america adult 2018-07-30v4No1 / 94
492amnoncommon brazil, skin, adult, rhinella icterica, toad, yellow cururu toad2019-02-27v4No1 / 95
377amnoncommon salamandra salamandra, salamander, skin, germany2018-09-12v4No1 / 106
149amnon high in stream compared to pond in salamandra salamandra fire salamander germany larval stage amphibian larval stage intestine 2017-04-24v4No1 / 107
353amnonhigher in captive compared to wild caught Lissotriton vulgaris newts skin ( high in research facility compared to wild in newt adult skin cambridgeshire lissotriton vulgaris united kingdom )2018-07-30v4No1 / 110
536amnoncommon snake, skin, united states of america, southern united states, aquatic snake, nerodia sipedon, northern water snake2019-07-28v4No1 / 111
417amnon high in mongolia summer compared to winter china in anser cygnoides swan goose bird feces 2018-12-01v4No1 / 114
416amnon high in wood diet compared to mulch diet in termite reticulitermes flaviceps colon research facility united states of america 2018-11-30v4No1 / 115
492amnoncommon skin, adult, germany, bufo bufo, toad, common toad2019-02-27v4No1 / 115
149amnonhigher in larvae transferred to stream compared to pond ( high in stream compared to pond in salamandra salamandra fire salamander germany larval stage amphibian larval stage skin mucus )2017-04-24v4No1 / 117
374amnoncommon skin, costa rica, amphibia, rhaebo haematiticus, truando toad, toad2018-09-09v4No1 / 121
539amnon high in ensete ventricosum var. gena compared to ensete ventricosum var. ketishe in ethiopia ensete ventricosum ethiopian banana late timepoint days 30-60 anaerobic fermentation food (fermented) 2019-07-31v4No1 / 123
590amnoncommon in turtle pond water (common china, turtle farm, farm, hainan autonomous prefecture, pond water, water)2020-02-10v4No1 / 127
374amnoncommon skin, costa rica, amphibia, craugastor fitzingeri, common rain frog, frog2018-09-09v4No1 / 136
29amnoncommon brassica oleracea, french republic, seed2016-12-05v4No1 / 146
475amnoncommon in air next to subway stations in hong kong (common air, hong kong, city)2019-01-20v4No1 / 147
515amnoncommon whole body, beetle, detritivorous beetle, feces, bulgaria, balkan mountains, aphodius haemorrhoidalis2019-04-18v4No1 / 147
53amnonhigher in sewer and wastewater influent comapred to feces in low income south america ( high in sewer wastewater treatment plant compared to feces in south america city low income )2017-01-21v4No1 / 148
510amnoncommon kingdom of spain, water, estuary, estuary water, saline water, salinity >20 ppt, bilbao2019-03-20v4No1 / 158
461amnonhigher in early compared to late timepoints in chitin beads incubated in ocean water ( high in early timepoints compared to late timepoints in water atlantic ocean surface water coastal water united states of america commonwealth of massachusetts chitin beads sea water )2019-01-12v4No1 / 160
475amnoncommon in air in subway train in hong kong (common air, hong kong, city, subway)2019-01-20v4No1 / 161
539amnoncommon ethiopia, ensete ventricosum, ethiopian banana, late timepoint, days 30-60, anaerobic fermentation, food (fermented)2019-07-31v4No1 / 161
232amnoncoomon in foot of healthy controls (common homo sapiens, skin, australia, foot)2017-11-05v4No1 / 166
106amnoncommon homo sapiens, dentition, germany, subgingival plaque, mouth2017-04-05v4No1 / 167
374amnoncommon skin, costa rica, amphibia, craugastor bransfordii, bransford’s litter frog, frog2018-09-09v4No1 / 171
534amnoncommon river, water, fresh water, depth 10 cm, koshi river, nepal, free floating, filtered 0.2um2019-07-22v4No1 / 172
499amnoncommon brazil, pond, digestive system, intestine, scinax fuscovarius, frog, tadpole2019-03-05v4No1 / 176
515amnoncommon whole body, beetle, detritivorous beetle, feces, bulgaria, balkan mountains, onthophagus ruficapillus2019-04-18v4No1 / 178
396amnon high in common carp cyprinus carpio compared to rainbow trout oncorhynchus mykiss in fish england intestine digestive system 2018-11-14v4No1 / 184
567amnon high in anterior naris pair of nares compared to nasopharynx in homo sapiens adult belgium 2019-12-05v4No1 / 186
402amnon high in zone 1 compared to zone 2,3 in sediment soil mine tailing alkaline mine tailing guangxi zhuang autonomous region china 2018-11-18v4No1 / 189
109amnon high in water treatment plant compared to distribution system in usa water drinking water site c 2017-04-08v4No1 / 193
534amnoncommon river, water, fresh water, depth 10 cm, koshi river, tributary, nepal, particle bound, filtered 2.7um2019-07-22v4No1 / 193
371amnoncommon homo sapiens, skin, amerindian, hunter gatherer, venezuela2018-09-06v4No1 / 195
388amnon high in age 6-10 weeks compared to age 12-19 weeks in pig sus scrofa tonsil farm united states of america state of michigan 2018-11-03v4No1 / 210
360amnon high in summer compared to spring in desert mexico state of california soil rhizosphere 2018-08-21v4No1 / 214
499amnoncommon brazil, pond, water, pond water, fresh water2019-03-05v4No1 / 228
342amnoncommon water, pacific ocean, philippine sea, surface water, sea water2018-05-28v4No1 / 236
492amnoncommon skin, adult, rana catesbeiana, bullfrog, lithobates catesbeianus, frog, japan2019-02-27v4No1 / 236
536amnoncommon snake, skin, united states of america, southern united states, agkistrodon contortrix, copperhead snake2019-07-28v4No1 / 236
438amnonhigher in students and soldiers age 19-24 compared to older adults ( high in age 19-24 soldiers compared to adult age 30-50 age 60-79 age >94 in homo sapiens feces china )2018-12-30v4No1 / 238
351amnoncommon sea urchin, lytechinus variegatus, coelomic fluid, research facility, eagle harbor, state of florida, united states of america2018-07-30v4No1 / 249
253amnoncommon in clouds in puy de dome mountain in france (common cloud, french republic, air, autumn)2017-11-22v4No1 / 267
499amnoncommon brazil, pond, digestive system, intestine, astyanax paranae, fish, astyanax2019-03-05v4No1 / 273
315amnoncommon in frog pond water (common hunan province, jiangxi province, water, fresh water, pond, china)2018-04-10v4No1 / 274
160amnoncommon in river water upstream of WTP effluent in spring in china (common river, water, spring, china)2017-07-12v4No1 / 278
237amnonlower in burrow soil compared to bird ( high in oceanodroma leucorhoa bird seabird compared to soil burrow in canada bon portage island )2017-11-07v4No1 / 298
499amnoncommon brazil, pond, poecilia reticulata, digestive system, intestine, fish, guppy2019-03-05v4No1 / 308
515amnoncommon carnivorous beetle, river, poland, raba river, whole body, beetle, bembidion varicolor2019-04-18v4No1 / 308
534amnoncommon river, water, fresh water, depth 10 cm, koshi river, nepal, particle bound, filtered 2.7um2019-07-22v4No1 / 315
510amnoncommon kingdom of spain, water, estuary, estuary water, fresh water, salinity <5 ppt, bilbao2019-03-20v4No1 / 317
461amnoncommon water, atlantic ocean, surface water, coastal water, united states of america, commonwealth of massachusetts, sea water2019-01-12v4No1 / 322
342amnoncommon water, pacific ocean, philippine sea, depth 300m, sea water2018-05-28v4No1 / 323
311amnoncommon in floor of kimchi production facility (common united states of america, state of rhode island, floor, food processing factory)2018-04-09v4No1 / 324
61amnoncommon canis lupus familiaris, skin, research facility, united states of america, inguinal region2017-02-05v4No1 / 328
338amnonlower in wild salamanders compared to zoo grown salamanders ( high in zoological garden zoo compared to pond area designated as a nature reserve in skin andrias japonicus japanese giant salamander japan )2018-05-21v4No1 / 334
254amnoncommon river, water, fresh water, depth 0.5m, jiulong river, fujian province, china2017-11-23v4No1 / 347
620amnon high in gorilla gorilla compared to pan troglodytes troglodytes chimpanzee in nouabale-ndoki national park republic of congo wild feces 2020-05-06v4No1 / 351
337amnonlower in manhattan compared to queens in feces of house mice from new york city ( high in queens region compared to manhatten region in united states of america city mus musculus new york city mouse house mice )2018-05-18v4No1 / 362
620amnon high in nouabale-ndoki national park wild republic of congo compared to zoological garden united states of america in gorilla gorilla gorilla feces 2020-05-06v4No1 / 368
160amnoncommon in river water upstream of WTP effluent in autumn in china (common river, water, autumn, china)2017-07-12v4No1 / 376
29amnon high in seed compared to seedling in brassica oleracea french republic 2016-12-05v4No1 / 379
256amnoncommon sus scrofa, pig, duodenum, jejunum, ileum, united kingdom2017-11-26v4No1 / 380
612amnoncommon state of florida, united states of america, spring water, water, fresh water, location 52020-04-22v4No1 / 383
256amnonhigher in small intestine compared to colon in pigs ( high in duodenum jejunum ileum compared to caecum right colon left colon in sus scrofa pig united kingdom )2017-11-26v4No1 / 387
342amnoncommon water, pacific ocean, philippine sea, depth 150m, sea water2018-05-28v4No1 / 397
612amnoncommon state of florida, united states of america, spring water, water, fresh water, location 32020-04-22v4No1 / 420
53amnonlower in wastewater plant effluent compared to influent and sewer in south america ( high in sewage influent compared to effluent in south america wastewater treatment plant city )2017-01-21v4No1 / 440
160amnoncommon in wastewater treatment plant effluent in autumn in china (common autumn, wastewater treatment plant, effluent, china)2017-07-12v4No1 / 469
28amnon high in whole plant leaf compared to feces achatinella mustelina in hawaii 2016-12-05v4No1 / 471
315amnonhigher in frog pond water compared to frog gut ( high in water fresh water compared to digestive system colon frog quasipaa spinosa giant spiny frog in jiangxi province hunan province china )2018-04-10v4No1 / 505
539amnon high in days 30-60 anaerobic fermentation late timepoint compared to days 1-15 aerobic fermentation early timepoint in ethiopia ensete ventricosum ethiopian banana food (fermented) 2019-07-31v4No1 / 510
612amnoncommon state of florida, united states of america, spring water, water, fresh water, location 12020-04-22v4No1 / 518
515amnoncommon whole body, beetle, detritivorous beetle, feces, bulgaria, balkan mountains, onthophagus taurus2019-04-18v4No1 / 533
462amnon high in populus deltoides compared to populus trichocarpa x deltoides in united states of america state of tennessee populus tree leaf cultivated environment 2019-01-13v4No1 / 559
443amnoncommon mississippi river, water, river, fresh water, depth 1m, united states of america, particle, filtered 2.7um, downstream, lower mississippi river2019-01-07v4No1 / 568
254amnon high in summer wet season autumn compared to winter dry season in river water fresh water depth 0.5m jiulong river fujian province china 2017-11-23v4No1 / 571
160amnoncommon in wastewater treatment plant effluent in spring in china (common wastewater treatment plant, effluent, spring, china)2017-07-12v4No1 / 573
254amnon high in summer wet season compared to winter dry season autumn in river water fresh water depth 0.5m jiulong river fujian province china 2017-11-23v4No1 / 581
510amnon high in fresh water salinity <5 ppt compared to saline water salinity >20 ppt in kingdom of spain water estuary estuary water bilbao 2019-03-20v4No1 / 592
612amnoncommon state of florida, united states of america, spring water, water, fresh water, location 22020-04-22v4No1 / 596
425amnon high in duodenum compared to feces in homo sapiens africa child 2018-12-08v4No1 / 622
459amnoncommon in surface in aquaculture biofilter sand (common water, fresh water, fish farm, biofilter, sand, united states of america, state of wisconsin, surface)2019-01-12v4No1 / 622
360amnonhigher in leaf surface compared to soil in agave plants ( high in leaf leaf surface compared to soil in desert state of california mexico guanajuato agave )2018-08-21v4No1 / 645
443amnonhigher in lower mississippi river (downstream) compared to upper mississippi river ( high in downstream lower mississippi river compared to upstream higher mississippi river in mississippi river water river fresh water depth 1m united states of america free floating filtered 0.2um )2019-01-07v4No1 / 652
200amnoncommon in river downstream of wastewater treatment plant (common river, fresh water, water, united states of america, wastewater treatment plant, effluent)2017-10-01v4No1 / 655
612amnoncommon state of florida, united states of america, spring water, water, fresh water, location 42020-04-22v4No1 / 655
232amnonlower in diabetec patient foot skin compared to healthy controls ( high in control compared to diabetes mellitus in homo sapiens skin australia foot )2017-11-05v4No1 / 708
206amnoncommon in air from israel particles <10um size (common air, dust, israel, size < 10um, clear day)2017-10-04v4No1 / 765
232amnonlower in diabetec foot ulcers compared to non-ulcer skin in diabetic patients ( high in control compared to wound ulcer in homo sapiens skin australia foot diabetes mellitus )2017-11-05v4No1 / 836
517amnon high in skin arm forearm compared to feces in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 836
462amnon high in leaf compared to stem in united states of america state of tennessee populus tree cultivated environment 2019-01-13v4No1 / 890
517amnon high in skin arm forearm compared to mouth mucosa mouth in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 1014
103amnon high in downstream compared to upstream in river united states of america mississippi river fresh water aquatic biome particle 2017-04-05v4No1 / 1032
252amnoncommon in river rock biofilm (common kingdom of spain, biofilm, river, rock, epilithic)2017-11-22v4No1 / 1081
252amnoncommon in river sand biofilm (common river, biofilm, kingdom of spain, sand)2017-11-22v4No1 / 1181
443amnonhigher in lower mississippi river (downstream) compared to upper mississippi river ( high in lower mississippi river downstream compared to upper mississippi river upstream in mississippi river water river fresh water depth 1m united states of america particle filtered 2.7um )2019-01-07v4No1 / 1418
515amnon high in detritivorous beetle bulgaria compared to herbivorous beetle poland in whole body beetle 2019-04-19v4No1 / 1543
473amnon high in depth 50-100m compared to depth 5-50m in water saline water pacific ocean state of california monterey bay sea water 2019-01-16v4No1 / 1656
536amnon high in aquatic snake compared to terrestrial snake in snake skin united states of america southern united states 2019-07-28v4No1 / 1772
101amnon high in root compared to rhizosphere in vitis vinifera united states of america merlot grapevine new york 2017-04-03v4No1 / 2075
443amnon high in particle filtered 2.7um compared to free floating filtered 0.2um in water river fresh water depth 1m united states of america mississippi river 2019-01-07v4No1 / 2266
462amnon high in rhizosphere compared to root in united states of america state of tennessee populus tree cultivated environment 2019-01-13v4No1 / 4630

Problems / suggestions? Please email info AT dbbact DOT org