Search result for sequence:
TACAGAGGGTGCGAGCGTTAATCGGATTTACTGGGCGTAAAGCGTGCGTAGGCGGCTTTTTAAGTCGGATGTGAAATCCCCGAGCTTAACTTGGGAATTGCATTCGATACTGGGAAGCTAGAGTATGGGAGAGGATGGTAGAATTCCAGG
common ontology terms
term enrichment score
TermScore
skin0.324195
united states of america0.319227
water0.148497
china0.147760
costa rica0.146699
homo sapiens0.143576
research facility0.121488
digestive system0.107956
feces0.106273
larval stage0.104218
frog0.102041
river0.101523
intestine0.098401
fresh water0.097800
adult0.091429
sea water0.078264
snake0.077620
brazil0.076692
pacific ocean0.072289
ant0.071429
southern united states0.071429
germany0.066225
leaf0.064171
air0.062176
state of florida0.061538
mucus0.057819
ocean0.055932
beetle0.052770
bird0.052425
depth 10 cm0.052083
food (fermented)0.051195
rhizosphere0.048900
canada0.048847
pond0.048649
salamandra salamandra0.047682
amphibian larval stage0.047682
atlantic ocean0.047569
duodenum0.047344
whole body0.047120
state of california0.046802
stomach0.046620
united kingdom0.044499
koshi river0.042105
fire salamander0.042105
cambridgeshire0.042105
nepal0.041237
newt0.041237
infant0.040733
farm0.040541
child0.039604
butterfly0.037383
ethiopia0.037037
pair of nares0.036697
new york city0.035714
zebra fish0.032301
panama0.032172
danio rerio0.032172
stream0.032172
filtered 2.7um0.032172
state of tennessee0.032086
LOWER IN soil0.032000
philippine sea0.031915
late timepoint0.031915
ensete ventricosum0.031915
ethiopian banana0.031915
LOWER IN feces0.031662
nectar0.031414
sediment0.030644
flower0.030457
soil0.028143
toad0.026918
rana catesbeiana0.026918
bullfrog0.026918
coral0.026858
foodon product type0.026858
hawaii0.026738
detritivorous beetle0.026738
bulgaria0.026738
balkan mountains0.026738
oceanodroma leucorhoa0.026738
seabird0.026738
bon portage island0.026738
days 30-600.026738
anaerobic fermentation0.026738
autumn0.026649
french republic0.026619
free floating0.026560
tree0.026560
mexico0.026560
nasal cavity0.026385
texas0.026042
cultivated environment0.026042
city0.025957
forest ecosystem0.025873
age0.025790
desert0.025063
mississippi river0.021661
oreochromis niloticus0.021622
osteopilus septentrionalis0.021622
lesser foam frog0.021505
Fraction of dbbact annotations with this term covered by the query
TermScore
canada2.000000
pond1.500000
zebra fish0.800000
skin0.760000
mississippi river0.750000
frog0.714286
costa rica0.666667
butterfly0.666667
panama0.666667
beetle0.666667
oreochromis niloticus0.666667
danio rerio0.666667
river0.666667
salamandra salamandra0.666667
amphibian larval stage0.666667
stream0.666667
dendropsophus minutus0.666667
toad0.666667
snake0.666667
rana catesbeiana0.666667
bullfrog0.666667
filtered 2.7um0.666667
mucus0.666667
capsicum annuum0.666667
jejunum0.666667
leaf endosphere0.666667
osteopilus septentrionalis0.666667
salamander0.666667
arm0.666667
venezuela0.666667
amerindian0.666667
debris0.666667
male0.666667
atlantic ocean0.625000
coral0.600000
foodon product type0.600000
state of tennessee0.600000
bird0.571429
duodenum0.555556
air0.545455
LOWER IN soil0.545455
larval stage0.538462
skh-1 hairless mouse0.500000
dorsum0.500000
ant0.500000
pseudomyrmex spinicola0.500000
pseudomyrmex cubaensis0.500000
turbinaria reniformis0.500000
skeleton0.500000
hawaii0.500000
organic material0.500000
forest biome0.500000
heliconius erato0.500000
tropical and subtropical moist broadleaf forest biome0.500000
caterpillar0.500000
frass0.500000
psychotria suerrensis0.500000
linepithema humile0.500000
argentine ant0.500000
ants0.500000
odontomachus0.500000
whole body0.500000
detritivorous beetle0.500000
bulgaria0.500000
balkan mountains0.500000
onthophagus taurus0.500000
nile tilapia0.500000
pheidole0.500000
nanger granti0.500000
kenya0.500000
tropical grassland biome0.500000
gazelle0.500000
tursiops truncatus0.500000
bottlenosed dolphin0.500000
pseudomyrmex elongatus0.500000
depth 10 cm0.500000
koshi river0.500000
pseudomyrmex nigropilosus0.500000
pseudomyrmex pallidus0.500000
hirundo rustica0.500000
colorado0.500000
barn swallow0.500000
fungus growing ant0.500000
atta colombica0.500000
pseudomyrmex nigrocinctus0.500000
outdoor0.500000
fire salamander0.500000
anoplophora glabripennis0.500000
indoor0.500000
office0.500000
lesser treefrog0.500000
lesser foam frog0.500000
scinax perereca0.500000
bufo bufo0.500000
common toad0.500000
ruellia terminalis0.500000
stachytarpheta frantzii0.500000
purple porterweed0.500000
chlosyne gaudialis0.500000
onthophagus similis0.500000
Fraction of annotations for the query sequences containing the term
TermScore
united states of america0.365385
skin0.206044
homo sapiens0.129121
china0.104396
feces0.098901
water0.098901
research facility0.096154
adult0.087912
costa rica0.082418
digestive system0.063187
larval stage0.057692
intestine0.054945
river0.054945
fresh water0.054945
frog0.054945
brazil0.046703
sea water0.046703
snake0.041209
pacific ocean0.041209
ant0.038462
southern united states0.038462
leaf0.035714
germany0.035714
air0.032967
state of florida0.032967
ocean0.030220
mucus0.030220
stomach0.027473
beetle0.027473
depth 10 cm0.027473
state of california0.027473
bird0.027473
food (fermented)0.027473
rhizosphere0.027473
whole body0.024725
salamandra salamandra0.024725
amphibian larval stage0.024725
canada0.024725
duodenum0.024725
united kingdom0.024725
atlantic ocean0.024725
pond0.024725
infant0.021978
farm0.021978
koshi river0.021978
nepal0.021978
fire salamander0.021978
newt0.021978
cambridgeshire0.021978
child0.021978
butterfly0.019231
new york city0.019231
pair of nares0.019231
ethiopia0.019231
panama0.016484
flower0.016484
nectar0.016484
zebra fish0.016484
danio rerio0.016484
stream0.016484
philippine sea0.016484
filtered 2.7um0.016484
state of tennessee0.016484
late timepoint0.016484
ensete ventricosum0.016484
ethiopian banana0.016484
LOWER IN feces0.016484
sediment0.016484
soil0.016484
LOWER IN soil0.016484
nasal cavity0.013736
coral0.013736
hawaii0.013736
forest ecosystem0.013736
detritivorous beetle0.013736
bulgaria0.013736
balkan mountains0.013736
texas0.013736
free floating0.013736
toad0.013736
oceanodroma leucorhoa0.013736
seabird0.013736
bon portage island0.013736
rana catesbeiana0.013736
bullfrog0.013736
french republic0.013736
age0.013736
foodon product type0.013736
tree0.013736
mexico0.013736
desert0.013736
days 30-600.013736
anaerobic fermentation0.013736
city0.013736
autumn0.013736
cultivated environment0.013736
oreochromis niloticus0.010989
filtered 0.2um0.010989
lesser foam frog0.010989
tributary0.010989
Exp. ID User ID Description Date Region Flag Sequences
176amnonhigh freq. in skin of hairless mice (highfreq mouse, mus musculus, skin, female, skh-1 hairless mouse, dorsum, research facility, united states of america)2017-07-29v4No1 / 1
408amnon high in stomach compared to larval stage in ant costa rica united states of america pseudomyrmex spinicola 2018-11-22v4No1 / 5
408amnonhighfreq ant, costa rica, united states of america, pseudomyrmex cubaensis, stomach2018-11-22v4No1 / 5
227amnonhigher in infants with respiratory illness compared to healthy controls ( high in respiratory system disease compared to control in kingdom of the netherlands infant nasopharynx nasal cavity homo sapiens )2017-10-30v4No1 / 6
418amnoncommon coral, ocean, turbinaria reniformis, skeleton2018-12-02v4No1 / 6
28amnonhigh freq. in leaves in hawaii (highfreq hawaii, organic material, forest biome, whole plant, leaf, forest ecosystem)2016-12-05v4No1 / 7
118amnonhighfreq butterfly, heliconius erato, panama, tropical and subtropical moist broadleaf forest biome, feces, larval stage, caterpillar, frass, forest ecosystem2017-04-11v4No1 / 7
501amnonhighfreq costa rica, flower, nectar, psychotria suerrensis2019-03-08v4No1 / 7
182amnoncommon linepithema humile, argentine ant, body proper, united states of america2017-08-15v4No1 / 8
184amnonhighfreq peru, digestive system, ants, odontomachus2017-08-15v4No1 / 8
408amnoncommon ant, costa rica, united states of america, crematogaster, stomach2018-11-22v4No1 / 8
515amnonhighfreq whole body, beetle, detritivorous beetle, feces, bulgaria, balkan mountains, onthophagus taurus2019-04-18v4No1 / 8
108amnonhighfreq research facility, texas, united states of america, caecum, oreochromis niloticus, nile tilapia2017-04-07v4No1 / 9
408amnonhighfreq ant, costa rica, united states of america, pheidole, stomach2018-11-22v4No1 / 9
58amnonhighfreq homo sapiens, new york city, conjunctiva2017-02-02v4No1 / 10
78amnonhighfreq nanger granti, kenya, feces, tropical grassland biome, gazelle2017-03-01v4No1 / 10
79amnonhighfreq skin, united states of america, tursiops truncatus, bottlenosed dolphin2017-03-03v4No1 / 10
117amnonhighfreq zebra fish, danio rerio, research facility, larval stage, united states of america, intestine2017-04-10v4No1 / 10
152amnonhigh in blanks compares to dust/nose samples (contamination)2017-05-04v4No1 / 10
408amnoncommon ant, costa rica, united states of america, pseudomyrmex elongatus, larval stage2018-11-22v4No1 / 10
408amnoncommon ant, costa rica, united states of america, pseudomyrmex cubaensis, stomach2018-11-22v4No1 / 10
497amnonhighfreq chicken, gallus gallus, broiler chicken, austria, farm, feces, age 4 weeks2019-03-04v4No1 / 10
534amnonhighfreq river, water, fresh water, depth 10 cm, koshi river, nepal, free floating, filtered 0.2um2019-07-22v4No1 / 10
408amnoncommon ant, costa rica, united states of america, pseudomyrmex spinicola, stomach2018-11-22v4No1 / 11
408amnoncommon ant, costa rica, united states of america, pseudomyrmex nigropilosus, stomach2018-11-22v4No1 / 11
408amnoncommon ant, costa rica, united states of america, larval stage, pseudomyrmex pallidus2018-11-22v4No1 / 11
408amnonhighfreq ant, costa rica, united states of america, larval stage, pseudomyrmex pallidus2018-11-22v4No1 / 11
108amnoncommon research facility, texas, united states of america, caecum, oreochromis niloticus, nile tilapia2017-04-07v4No1 / 12
118amnoncommon butterfly, heliconius erato, panama, tropical and subtropical moist broadleaf forest biome, feces, larval stage, caterpillar, frass, forest ecosystem2017-04-11v4No1 / 12
161amnonhigh freq. in barn swallows in colorado (highfreq hirundo rustica, feces, united states of america, colorado, barn swallow)2017-07-12v4No1 / 12
397amnonhighfreq panama, digestive system, intestine, fungus growing ant, atta colombica2018-11-14v4No1 / 12
408amnoncommon ant, costa rica, united states of america, pseudomyrmex nigrocinctus, stomach2018-11-22v4No1 / 12
460amnonhigh freq. in outdoor air (highfreq air, united states of america, state of california, outdoor)2019-01-12v4No1 / 12
149amnonhighfreq salamandra salamandra, fire salamander, germany, larval stage, amphibian larval stage, intestine, stream2017-04-24v4No1 / 13
243amnonhighfreq beetle, anoplophora glabripennis, digestive system, united states of america2017-11-15v4No1 / 13
408amnonhighfreq ant, costa rica, united states of america, crematogaster, stomach2018-11-22v4No1 / 13
460amnonhigh freq. in occupied office air (highfreq air, united states of america, state of california, indoor, office)2019-01-12v4No1 / 13
492amnonhighfreq brazil, skin, frog, dendropsophus minutus, lesser treefrog, adult2019-02-27v4No1 / 13
492amnonhighfreq brazil, skin, adult, lesser foam frog, scinax perereca, frog2019-02-27v4No1 / 13
492amnonhighfreq skin, adult, germany, bufo bufo, toad, common toad2019-02-27v4No1 / 13
501amnonhighfreq costa rica, flower, nectar, ruellia terminalis2019-03-08v4No1 / 13
501amnonhighfreq costa rica, flower, nectar, stachytarpheta frantzii, purple porterweed2019-03-08v4No1 / 13
501amnoncommon costa rica, butterfly, digestive system, chlosyne gaudialis2019-03-09v4No1 / 13
515amnonhighfreq whole body, beetle, detritivorous beetle, feces, bulgaria, balkan mountains, onthophagus similis2019-04-18v4No1 / 13
534amnonhighfreq river, water, fresh water, depth 10 cm, koshi river, tributary, nepal, free floating, filtered 0.2um2019-07-22v4No1 / 13
536amnonhighfreq snake, skin, united states of america, southern united states, pantherophis obsoletus, black rat snake, arboreal snake2019-07-28v4No1 / 13
58amnon high in skin skin under eye compared to conjunctiva in human new york city 2017-02-02v4No1 / 14
58amnonhighfreq homo sapiens, new york city, skin of face, skin under eyes2017-02-02v4No1 / 14
229amnoncommon in sinuses from chronic rhinosinositis patients (common homo sapiens, paranasal sinus, sinusoidal space, australia, sinusitis)2017-10-31v4No1 / 14
237amnonhighfreq bird, oceanodroma leucorhoa, seabird, canada, bon portage island, brood patch2017-11-07v4No1 / 14
304amnoncandidate contaminants - higher in blanks (contamination)2018-03-12v4No1 / 14
342amnonhighfreq water, pacific ocean, philippine sea, surface water, sea water2018-05-28v4No1 / 14
397amnoncommon panama, digestive system, intestine, fungus growing ant, mycocepurus smithii2018-11-14v4No1 / 14
536amnonhighfreq snake, skin, united states of america, southern united states, aquatic snake, nerodia sipedon, northern water snake2019-07-28v4No1 / 14
58amnonhighfreq homo sapiens, new york city, contact lens2017-02-02v4No1 / 15
79amnoncommon skin, united states of america, tursiops truncatus, bottlenosed dolphin2017-03-03v4No1 / 15
342amnonhighfreq water, pacific ocean, philippine sea, depth 150m, sea water2018-05-28v4No1 / 15
342amnonhighfreq water, pacific ocean, philippine sea, depth 300m, sea water2018-05-28v4No1 / 15
406amnonhighfreq feces, zoological garden, diceros bicornis, black rhinoceros, united states of america, switzerland2018-11-21v4No1 / 15
515amnonhighfreq whole body, beetle, detritivorous beetle, feces, bulgaria, balkan mountains, aphodius haemorrhoidalis2019-04-18v4No1 / 15
51amnonhighfreq homo sapiens, biopsy site, biopsy, united states of america2017-01-19v4No1 / 16
79amnonhighfreq skin, united states of america, stenella attenuata2017-03-03v4No1 / 16
118amnonhigh freq. in wild butterfly (highfreq butterfly, heliconius erato, panama, whole body, adult, body proper, tropical and subtropical moist broadleaf forest biome, forest ecosystem)2017-04-11v4No1 / 16
492amnonhighfreq skin, adult, rana catesbeiana, bullfrog, lithobates catesbeianus, frog, japan2019-02-27v4No1 / 16
492amnonhighfreq skin, adult, rana catesbeiana, lithobates catesbeianus, bullfrog, brazil, frog2019-02-27v4No1 / 16
501amnoncommon costa rica, flower, nectar, psychotria suerrensis2019-03-08v4No1 / 16
534amnonhighfreq river, water, fresh water, depth 10 cm, koshi river, tributary, nepal, particle bound, filtered 2.7um2019-07-22v4No1 / 16
534amnonhighfreq river, water, fresh water, depth 10 cm, koshi river, nepal, particle bound, filtered 2.7um2019-07-22v4No1 / 16
68amnonfound in some aphid samples (prevalence <=0.1) (other cinara)2017-02-20v4No1 / 17
237amnonhighfreq bird, oceanodroma leucorhoa, seabird, canada, bon portage island, uropygial gland2017-11-07v4No1 / 17
351amnonhighfreq sea urchin, lytechinus variegatus, coelomic fluid, research facility, eagle harbor, state of florida, united states of america2018-07-30v4No1 / 17
352amnonhigh freq. in duodenal biopsies (highfreq homo sapiens, new delhi, duodenum, small intestine, india)2018-07-30v4No1 / 17
353amnonhigh freq. in captive Triturus cristatus newts skin (highfreq newt, adult, skin, cambridgeshire, triturus cristatus, research facility, united kingdom)2018-07-30v4No1 / 17
460amnoncommon in occupied office air (common air, united states of america, state of california, indoor, office)2019-01-12v4No1 / 17
492amnonhighfreq brazil, skin, adult, leptodactylus latrans, frog, lesser foam frog2019-02-27v4No1 / 17
501amnoncommon costa rica, butterfly, digestive system, dulcedo polita2019-03-08v4No1 / 17
501amnoncommon costa rica, butterfly, digestive system, heliconius sara, sara longwing butterfly2019-03-09v4No1 / 17
149amnonhighfreq salamandra salamandra, fire salamander, germany, larval stage, amphibian larval stage, skin, mucus2017-04-24v4No1 / 18
418amnoncommon coral, ocean, isopora palifera, mucus2018-12-02v4No1 / 18
492amnonhighfreq brazil, skin, adult, rhinella icterica, toad, yellow cururu toad2019-02-27v4No1 / 18
536amnonhighfreq snake, skin, united states of america, southern united states, thamnophis sirtalis, common garter snake2019-07-28v4No1 / 18
280amnon high in eunicella labiata coral reef gorgonian coral coral compared to saline water sea water marine water body in atlantic ocean depth 20m portuguese republic 2018-01-25v4No1 / 19
431amnonhigh freq. in midgut of hibernating bumble bees (highfreq bombus terrestris, bumble bee, midgut, research facility, queen, belgium, hibernation)2018-12-16v4No1 / 19
489amnonhighfreq feces, anal swab, myotis myotis, bat, greater mouse eared bat, french republic2019-02-25v4No1 / 19
184amnoncommon peru, digestive system, ants, odontomachus2017-08-15v4No1 / 20
227amnoncommon in baby nasopharynx age <= 1 day (common homo sapiens, nasal cavity, nasopharynx, age, infant, kingdom of the netherlands, age <= 24 hours)2017-10-30v4No1 / 20
353amnonhigh freq. in captive Lissotriton vulgaris newts skin (highfreq newt, adult, skin, cambridgeshire, research facility, lissotriton vulgaris, united kingdom)2018-07-30v4No1 / 20
536amnonhighfreq snake, skin, united states of america, southern united states, coluber constrictor, eastern racer snake2019-07-28v4No1 / 20
58amnoncommon homo sapiens, new york city, skin of face, skin under eyes2017-02-02v4No1 / 21
149amnonhighfreq salamandra salamandra, fire salamander, germany, larval stage, amphibian larval stage, intestine, pond2017-04-24v4No1 / 21
460amnoncommon in outdoor air (common air, united states of america, state of california, outdoor)2019-01-12v4No1 / 21
501amnoncommon costa rica, psiguria triphylla, flower, nectar2019-03-08v4No1 / 21
536amnonhighfreq snake, skin, united states of america, southern united states, diadophis punctatus, ringneck snake, fossorial snake2019-07-28v4No1 / 21
408amnoncommon ant, costa rica, united states of america, pseudomyrmex spinicola, larval stage2018-11-22v4No1 / 22
58amnoncommon homo sapiens, new york city, contact lens2017-02-02v4No1 / 23
74amnoncommon capsicum annuum, united states of america, foodon product type2017-02-27v4No1 / 23
399amnonhighfreq feces, united states of america, zoological garden, panthera leo, lion, state of tennessee2018-11-16v4No1 / 23
408amnoncommon ant, costa rica, united states of america, larval stage, pseudomyrmex simplex2018-11-22v4No1 / 23
492amnoncommon skin, adult, brazil, rana catesbeiana, bullfrog, lithobates catesbeianus, frog2019-02-27v4No1 / 23
489amnoncommon feces, anal swab, myotis myotis, bat, greater mouse eared bat, french republic2019-02-25v4No1 / 24
35amnoncommon tanzania, dense settlement biome, hospital, breast milk, homo sapiens2016-12-06v4No1 / 25
501amnoncommon costa rica, dipteryx oleifera, tree, botanical fruit food product2019-03-08v4No1 / 25
311amnoncommon united states of america, state of rhode island, allium cepa, onion, foodon product type2018-04-09v4No1 / 26
499amnoncommon ranatra, water stick-insect, brazil, pond, digestive system, intestine2019-03-05v4No1 / 26
536amnoncommon snake, skin, united states of america, southern united states, diadophis punctatus, ringneck snake, fossorial snake2019-07-28v4No1 / 26
74amnoncommon squash, united states of america, foodon product type2017-02-27v4No1 / 27
58amnoncommon homo sapiens, new york city, conjunctiva2017-02-02v4No1 / 28
397amnoncommon panama, digestive system, intestine, fungus growing ant, myrmicocrypta ednaella2018-11-14v4No1 / 28
26amnoncommon in combined swab of inguinal region and axilla (common homo sapiens, united states of america, inguinal region, axilla, sebum)2016-12-05v4No1 / 29
193amnonlower in nares of people working in dairy farms ( high in control compared to bos taurus farm in homo sapiens united states of america pair of nares )2017-09-05v4No1 / 29
90amnonincreases during douchi fermentation ( high in timepoint late timepoint compared to early timepoint in douchi china food (fermented) )2017-03-08v4No1 / 30
492amnoncommon brazil, skin, adult, lesser foam frog, scinax perereca, frog2019-02-27v4No1 / 30
149amnoncommon salamandra salamandra, fire salamander, germany, larval stage, amphibian larval stage, intestine, pond2017-04-24v4No1 / 31
233amnon high in age age < 3 months compared to age > 3 months in feces homo sapiens infant united states of america 2017-11-05v4No1 / 31
492amnoncommon brazil, skin, frog, dendropsophus minutus, lesser treefrog, adult2019-02-27v4No1 / 31
26amnoncommon canis lupus familiaris, united states of america, pair of nares, mucus2016-12-05v4No1 / 32
490amnonobserved in amniotic fluid and buffer and water controls (contamination)2019-02-25v4No1 / 32
492amnoncommon brazil, skin, adult, leptodactylus latrans, frog, lesser foam frog2019-02-27v4No1 / 34
79amnoncommon skin, united states of america, steno bredanensis, rough-toothed dolphin2017-03-03v4No1 / 35
240amnonhigher in infants age<1 year compared to 1-3 years in baby feces ( high in age age < 1 year compared to age > 1 year in homo sapiens feces infant finland )2017-11-12v4No1 / 35
536amnoncommon snake, skin, united states of america, southern united states, carphophis amoenus, worm snake, fossorial snake2019-07-28v4No1 / 35
539amnoncommon ethiopia, ensete ventricosum, ethiopian banana, early timepoint, aerobic fermentation, days 1-15, food (fermented)2019-07-31v4No1 / 35
79amnonhighfreq skin, united states of america, delphinus delphis2017-03-03v4No1 / 36
50amnoncommon in mitten crab gills (common gill, eriocheir sinensis, china)2017-01-19v4No1 / 37
51amnoncommon homo sapiens, biopsy site, biopsy, united states of america2017-01-19v4No1 / 38
243amnoncommon beetle, anoplophora glabripennis, digestive system, united states of america2017-11-15v4No1 / 38
33amnoncommon homo sapiens, sputum, lung, bronchial epithelium, vancouver2016-12-06v4No1 / 40
79amnoncommon peponocephala electra, skin, united states of america2017-03-03v4No1 / 40
79amnoncommon skin, united states of america, stenella attenuata2017-03-03v4No1 / 40
501amnoncommon costa rica, flower, nectar, stachytarpheta frantzii, purple porterweed2019-03-08v4No1 / 40
28amnoncommon in various trees in hawaii (common hawaii, organic material, forest biome, whole plant, leaf, forest ecosystem)2016-12-05v4No1 / 41
102amnonhigher in cheeks compared to teeth, saliva ( high in cheek compared to saliva dentition in homo sapiens atlanta united states of america mouth )2017-04-03v4No1 / 41
112amnoncommon danio rerio, zebra fish, intestine, research facility, china2017-04-09v4No1 / 41
117amnoncommon zebra fish, danio rerio, research facility, larval stage, united states of america, intestine2017-04-10v4No1 / 41
267amnonhigher in gut of fish in water with cadmium contamination compared to control ( high in cadmium compared to control in fish digestive system oreochromis niloticus research facility china )2017-12-24v4No1 / 41
14amnon high in stomach duodenum jejunum ileum compared to caecum right colon transverse colon left colon feces in mus musculus united states of america gastrointestinal system 2016-11-08v4No1 / 42
51amnoncommon feces, homo sapiens, united states of america2017-01-19v4No1 / 42
79amnoncommon skin, united states of america, globicephala macrorhynchus, short finned pilot whale2017-03-03v4No1 / 42
547amnon high in high salt concentration compared to low salt concentration in red pepper sauce capsicum annuum sichuan province china food (fermented) 2019-08-15v4No1 / 43
113amnoncommon danio rerio, zebra fish, research facility, united states of america, intestine, larval stage2017-04-10v4No1 / 45
302amnoncommon in feces of canary pet birds (common bird, mexico, feces, pet, serinus canaria, canary)2018-03-05v4No1 / 47
360amnoncommon agave, agave deserti, leaf, leaf endosphere, desert, state of california2018-08-20v4No1 / 48
79amnoncommon skin, united states of america, harbor seal, phoca vitulina2017-03-03v4No1 / 49
149amnoncommon salamandra salamandra, fire salamander, germany, larval stage, amphibian larval stage, skin, mucus2017-04-24v4No1 / 49
547amnoncommon red pepper sauce, capsicum annuum, sichuan province, china, food (fermented)2019-08-15v4No1 / 49
416amnon high in fasting compared to wood diet in termite reticulitermes flaviceps colon research facility united states of america 2018-11-30v4No1 / 52
437amnoncommon fish, zebra fish, danio rerio, juvenile organism, age 21 days, intestine, research facility, united states of america, state of oregon2018-12-26v4No1 / 54
354amnon high in bronchus bronchial epithelium bronchial brush compared to sputum induced sputum in homo sapiens united states of america adult 2018-07-30v4No1 / 55
492amnoncommon skin, adult, chile, eupsophus vertebralis, frog2019-02-27v4No1 / 55
63amnoncommon in skin in american gut (common homo sapiens, skin)2017-02-15v4No1 / 56
237amnoncommon canada, bon portage island, bird, oceanodroma leucorhoa, seabird, brood patch2017-11-07v4No1 / 57
431amnoncommon in midgut of hibernating bumble bees (common research facility, midgut, belgium, bombus terrestris, bumble bee, queen, hibernation)2018-12-16v4No1 / 57
116amnoncommon research facility, litopenaeus vannamei, pacific white shrimp, intestine, south china sea, china2017-04-10v4No1 / 58
237amnoncommon bird, oceanodroma leucorhoa, seabird, canada, bon portage island, uropygial gland2017-11-07v4No1 / 58
67amnoncommon in wet processing of coffee beans (common coffea arabica, ecuador, wet processing)2017-02-19v4No1 / 59
338amnon high in amphibian larval stage larval stage tadpole compared to adult in andrias japonicus japanese giant salamander skin japan 2018-05-21v4No1 / 59
149amnoncommon salamandra salamandra, fire salamander, germany, larval stage, amphibian larval stage, intestine, stream2017-04-24v4No1 / 60
90amnoncommon douchi, china, food (fermented)2017-03-08v4No1 / 61
199amnonlower in bathroom shower compared to kitchen sink ( high in kitchen sink compared to bathroom shower tile building wall in building urban biome united states of america )2017-10-01v4No1 / 61
374amnoncommon skin, costa rica, amphibia, oophaga pumilio, strawberry poison frog, frog2018-09-09v4No1 / 61
549amnoncommon acropora cervicornis, coral, puerto rico, isla palominos2019-08-17v4No1 / 62
302amnoncommon in feces of Cockatiel pet birds (common bird, mexico, feces, pet, nymphicus hollandicus, cockatiel)2018-03-05v4No1 / 63
501amnonhigher in nectar feeding butterflies compared to fruit feeding ( high in nectar feeding compared to fruit feeding in costa rica butterfly digestive system )2019-03-09v4No1 / 64
536amnoncommon snake, skin, united states of america, southern united states, coluber constrictor, eastern racer snake2019-07-28v4No1 / 64
558amnon high in duodenum compared to caecum in bird centrocercus urophasianus greater sage-grouse united states of america state of wyoming 2019-09-20v4No1 / 64
539amnon high in ensete ventricosum var. gena compared to ensete ventricosum var. maze in ethiopia ensete ventricosum ethiopian banana late timepoint days 30-60 anaerobic fermentation food (fermented) 2019-07-31v4No1 / 65
28amnoncommon hawaii, feces, terrestrial biome, achatinella mustelina, environmental system determined by an organism2016-12-05v4No1 / 71
389amnoncommon pig, sus scrofa, united states of america, state of michigan, farm, skin, nipple, adult2018-11-04v4No1 / 72
26amnoncommon united states of america, homo sapiens, pair of nares, mucus2016-12-05v4No1 / 73
322amnoncommon frog, osteopilus septentrionalis, united states of america, state of florida, research facility, adult, digestive system2018-04-23v4No1 / 76
431amnonhigher in midgut of hibernating bumble bees compared to non-hibernating ( high in hibernation compared to non hibernating in bombus terrestris bumble bee midgut research facility queen belgium )2018-12-16v4No1 / 77
407amnon high in wet season compared to dry season in costa rica feces monkey cebus capucinus white-faced capuchin wild 2018-11-21v4No1 / 79
26amnoncommon united states of america, felis catus, mucus, pair of nares2016-12-05v4No1 / 80
108amnon high in caecum compared to colon in research facility texas united states of america oreochromis niloticus nile tilapia 2017-04-07v4No1 / 80
534amnoncommon river, water, fresh water, depth 10 cm, koshi river, tributary, nepal, free floating, filtered 0.2um2019-07-22v4No1 / 80
136amnoncommon sea water, trichodesmium, ocean, sargasso sea, atlantic ocean2017-04-17v4No1 / 81
269amnonpeaks at 2 weeks in refrigeration of yao meat ( high in middle timepoint two weeks compared to fresh food spoilage late timepoint in china foodon product type )2018-01-09v4No1 / 83
353amnoncommon in captive Triturus cristatus newts skin (common newt, adult, skin, cambridgeshire, triturus cristatus, research facility, united kingdom)2018-07-30v4No1 / 84
515amnoncommon poland, whole body, beetle, plant, nida basin, herbivorous beetle, centricnemus leucogrammus2019-04-18v4No1 / 84
539amnon high in ensete ventricosum var. maze compared to ensete ventricosum var. ketishe in ethiopia ensete ventricosum ethiopian banana late timepoint days 30-60 anaerobic fermentation food (fermented) 2019-07-31v4No1 / 84
227amnonhiger in first 24hrs compared to later timepoints in baby nasopharynx ( high in age age <=24 hours compared to age >= 7 days in homo sapiens nasopharynx nasal cavity infant kingdom of the netherlands )2017-10-30v4No1 / 85
26amnon high in pair of nares mucus compared to saliva mouth in united states of america felis catus 2016-12-05v4No1 / 86
109amnoncommon usa, water, drinking water, site c2017-04-08v4No1 / 86
353amnoncommon in captive Lissotriton vulgaris newts skin (common newt, adult, skin, cambridgeshire, research facility, lissotriton vulgaris, united kingdom)2018-07-30v4No1 / 86
513amnoncommon waste water, hospital, city, xinxiang city prefecture, china2019-03-25v4No1 / 86
79amnoncommon skin, united states of america, balaenoptera borealis, sei whale2017-03-03v4No1 / 90
354amnon high in bronchus bronchial brush bronchial epithelium compared to saliva oral wash in homo sapiens united states of america adult 2018-07-30v4No1 / 94
471amnoncommon digestive system, frog, osteopilus septentrionalis, research facility, united states of america, adult, state of florida2019-01-14v4No1 / 94
427amnonlower in salamanders kept at 20C compared to 10C ( high in temp 10c compared to temp 20c in united states of america eastern red backed salamander plethodon cinereus salamander feces commonwealth of virginia )2018-12-08v4No1 / 95
492amnoncommon brazil, skin, adult, rhinella icterica, toad, yellow cururu toad2019-02-27v4No1 / 95
99amnoncommon commonwealth of virginia, united states of america, skin, mucus, rana catesbeiana, bullfrog2017-04-02v4No1 / 99
196amnonlower in water compared to biofilm ( high in biofilm compared to water in drinking water united states of america )2017-09-12v4No1 / 100
483amnoncommon larval stage, hawaii, pearl harbor, research facility, hydroides elegans, tubeworm, united states of america2019-02-13v4No1 / 100
536amnoncommon snake, skin, united states of america, southern united states, fossorial snake, storeria dekayi, ground snake2019-07-28v4No1 / 101
499amnoncommon brazil, pond, digestive system, intestine, dendropsophus minutus, frog, tadpole2019-03-05v4No1 / 102
425amnon high in antananarivo madagascar compared to central african republic bangui in homo sapiens africa child duodenum 2018-12-08v4No1 / 103
168amnoncommon in mud from chinese liquor fermentation pit (common mud, ph 5, fermentation pit mud, china)2017-07-18v4No1 / 104
515amnoncommon whole body, beetle, detritivorous beetle, feces, bulgaria, balkan mountains, onthophagus similis2019-04-18v4No1 / 104
377amnoncommon salamandra salamandra, salamander, skin, germany2018-09-12v4No1 / 106
149amnon high in stream compared to pond in salamandra salamandra fire salamander germany larval stage amphibian larval stage intestine 2017-04-24v4No1 / 107
353amnonhigher in captive compared to wild caught Lissotriton vulgaris newts skin ( high in research facility compared to wild in newt adult skin cambridgeshire lissotriton vulgaris united kingdom )2018-07-30v4No1 / 110
536amnoncommon snake, skin, united states of america, southern united states, thamnophis sirtalis, common garter snake2019-07-28v4No1 / 110
536amnoncommon snake, skin, united states of america, southern united states, aquatic snake, nerodia sipedon, northern water snake2019-07-28v4No1 / 111
388amnoncommon pig, sus scrofa, tonsil, farm, united states of america, state of michigan, age 6-10 weeks2018-11-03v4No1 / 112
79amnoncommon skin, united states of america, delphinus delphis2017-03-03v4No1 / 113
269amnoncommon in fresh yao meat food (common china, foodon product type)2018-01-09v4No1 / 113
416amnon high in wood diet compared to mulch diet in termite reticulitermes flaviceps colon research facility united states of america 2018-11-30v4No1 / 115
492amnoncommon skin, adult, germany, bufo bufo, toad, common toad2019-02-27v4No1 / 115
536amnoncommon snake, skin, united states of america, southern united states, agkistrodon piscivorus, aquatic snake2019-07-28v4No1 / 115
195amnoncommon in boston subway surfaces (common city, urban biome, train, boston)2017-09-07v4No1 / 116
48amnonhigher in 3 months compared to 1 week in infant hypopharynx ( high in age age 3 months compared to age 1 week in homo sapiens kingdom of denmark hypopharynx infant )2017-01-19v4No1 / 117
149amnonhigher in larvae transferred to stream compared to pond ( high in stream compared to pond in salamandra salamandra fire salamander germany larval stage amphibian larval stage skin mucus )2017-04-24v4No1 / 117
410amnonlower in feces compared to rectal biopsies in children with treatment naive uc ( high in rectum biopsy biopsy site compared to feces in homo sapiens child united states of america ulcerative colitis )2018-11-22v4No1 / 118
352amnoncommon in duodenal biopsies (common homo sapiens, new delhi, duodenum, small intestine, india)2018-07-30v4No1 / 121
374amnoncommon skin, costa rica, amphibia, rhaebo haematiticus, truando toad, toad2018-09-09v4No1 / 121
323amnoncommon freq. in shark teeth (common atlantic ocean, south florida, state of florida, united states of america, shark, dentition)2018-04-24v4No1 / 123
425amnoncommon homo sapiens, africa, child, duodenum, antananarivo, madagascar2018-12-08v4No1 / 123
539amnon high in ensete ventricosum var. gena compared to ensete ventricosum var. ketishe in ethiopia ensete ventricosum ethiopian banana late timepoint days 30-60 anaerobic fermentation food (fermented) 2019-07-31v4No1 / 123
113amnon high in larval stage compared to adult in danio rerio zebra fish research facility united states of america intestine 2017-04-10v4No1 / 128
280amnoncommon atlantic ocean, depth 20m, portuguese republic, eunicella labiata, gorgonian coral, coral, coral reef2018-01-25v4No1 / 128
199amnoncommon in kitchen sink (common building, urban biome, united states of america, kitchen, sink)2017-10-01v4No1 / 130
108amnoncommon research facility, texas, united states of america, colon, anaxyrus terrestris, southern toad2017-04-07v4No1 / 132
417amnon high in winter china compared to mongolia summer in anser cygnoides swan goose bird feces 2018-12-01v4No1 / 132
176amnoncommon in skin of hairless mice (common mouse, mus musculus, skin, female, skh-1 hairless mouse, dorsum, research facility, united states of america)2017-07-29v4No1 / 133
353amnonhigher in captive compared to wild caught Lissotriton vulgaris newts skin ( high in research facility compared to wild in newt adult skin cambridgeshire triturus cristatus united kingdom )2018-07-30v4No1 / 135
374amnoncommon skin, costa rica, amphibia, craugastor fitzingeri, common rain frog, frog2018-09-09v4No1 / 136
291amnoncommon canis lupus familiaris, dog, pair of nares, nasal cavity, germany2018-02-01v4No1 / 144
29amnoncommon brassica oleracea, french republic, seed2016-12-05v4No1 / 146
241amnonhigher in babies from russia compared to estonia ( high in russia compared to estonia in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 146
85amnoncommon litopenaeus vannamei, pacific white shrimp, shenzhen city prefecture, digestive system, china, sea water2017-03-06v4No1 / 147
475amnoncommon in air next to subway stations in hong kong (common air, hong kong, city)2019-01-20v4No1 / 147
108amnon high in colon compared to caecum in research facility texas united states of america coturnix coturnix common quail 2017-04-07v4No1 / 157
515amnoncommon poland, whole body, beetle, plant, nida basin, herbivorous beetle, crioceris duodecimpunctata2019-04-18v4No1 / 157
461amnonhigher in early compared to late timepoints in chitin beads incubated in ocean water ( high in early timepoints compared to late timepoints in water atlantic ocean surface water coastal water united states of america commonwealth of massachusetts chitin beads sea water )2019-01-12v4No1 / 160
209amnoncommon in whale blow condensate (common north america, megaptera novaeangliae, humpback whale, respiratory airway, exhaled air condensate, whale blow)2017-10-15v4No1 / 161
475amnoncommon in air in subway train in hong kong (common air, hong kong, city, subway)2019-01-20v4No1 / 161
539amnoncommon ethiopia, ensete ventricosum, ethiopian banana, late timepoint, days 30-60, anaerobic fermentation, food (fermented)2019-07-31v4No1 / 161
121amnonhigh in diarrhea compared to recovery period ( high in diarrhea compared to control in homo sapiens feces bangladesh adult )2017-04-13v4No1 / 162
322amnon high in adult compared to tadpole in frog osteopilus septentrionalis united states of america state of florida research facility digestive system 2018-04-23v4No1 / 163
486amnoncommon pacific ocean, ocean, sediment, carbonate, lithified carbonate blocks, depth 500-1000m, hydrate ridge, state of oregon, oil seep, active methane seep2019-02-19v4No1 / 163
232amnoncoomon in foot of healthy controls (common homo sapiens, skin, australia, foot)2017-11-05v4No1 / 166
106amnoncommon homo sapiens, dentition, germany, subgingival plaque, mouth2017-04-05v4No1 / 167
323amnoncommon in shark cloaca (common atlantic ocean, south florida, state of florida, united states of america, shark, anal canal)2018-04-24v4No1 / 167
374amnoncommon skin, costa rica, amphibia, craugastor bransfordii, bransford’s litter frog, frog2018-09-09v4No1 / 171
534amnoncommon river, water, fresh water, depth 10 cm, koshi river, nepal, free floating, filtered 0.2um2019-07-22v4No1 / 172
99amnoncommon commonwealth of virginia, united states of america, skin, mucus, anaxyrus americanus, american toad2017-04-02v4No1 / 176
403amnon high in winter compared to summer in air kingdom of spain pyrenees autumn 2018-11-18v4No1 / 176
499amnoncommon brazil, pond, digestive system, intestine, scinax fuscovarius, frog, tadpole2019-03-05v4No1 / 176
530amnoncommon snake, deinagkistrodon acutus, pit viper, feces, snake farm, farm, adula, hunan province, china2019-07-21v4No1 / 178
536amnoncommon snake, skin, united states of america, southern united states, pantherophis obsoletus, black rat snake, arboreal snake2019-07-28v4No1 / 184
402amnon high in zone 1 compared to zone 2,3 in sediment soil mine tailing alkaline mine tailing guangxi zhuang autonomous region china 2018-11-18v4No1 / 189
75amnoncommon homo sapiens, skin, arm, venezuela, amerindian, hunter gatherer2017-02-27v4No1 / 191
80amnon high in dry forest compared to tropical moist broadleaf forest biome in feces alouatta pigra howler monkey central america state of florida 2017-03-03v4No1 / 193
109amnon high in water treatment plant compared to distribution system in usa water drinking water site c 2017-04-08v4No1 / 193
534amnoncommon river, water, fresh water, depth 10 cm, koshi river, tributary, nepal, particle bound, filtered 2.7um2019-07-22v4No1 / 193
170amnoncommon river, water, fresh water, depth 10 cm, united states of america, stream2017-07-24v4No1 / 194
371amnoncommon homo sapiens, skin, amerindian, hunter gatherer, venezuela2018-09-06v4No1 / 195
371amnonlower in skin of amerindians compared to western visitors ( high in united states of america city compared to amerindian hunter gatherer venezuela in homo sapiens skin )2018-09-06v4No1 / 195
6amnoncommon urine, female, homo sapiens, pregnancy, state of tennessee2016-10-13v4No1 / 201
360amnoncommon agave, desert, leaf, leaf surface, mexico, guanajuato, agave tequiliana, cultivated environment2018-08-21v4No1 / 210
388amnon high in age 6-10 weeks compared to age 12-19 weeks in pig sus scrofa tonsil farm united states of america state of michigan 2018-11-03v4No1 / 210
323amnoncommon in shark skin (common atlantic ocean, south florida, state of florida, united states of america, shark, skin)2018-04-24v4No1 / 213
511amnoncommon snow, depth 0-5cm, lapland, finland, sweden, kingdom of norway2019-03-20v4No1 / 213
138amnoncommon in ocean water depth 5m (common ocean, pacific ocean, depth 5m, sea water)2017-04-18v4No1 / 214
360amnon high in summer compared to spring in desert mexico state of california soil rhizosphere 2018-08-21v4No1 / 214
545amnoncommon atlantic ocean, ocean, biofilm, debris, depth 200-2000 m2019-08-04v4No1 / 227
499amnoncommon brazil, pond, water, pond water, fresh water2019-03-05v4No1 / 228
331amnon high in dry season compared to wet season in feces monkey theropithecus gelada ethiopia 2018-05-13v4No1 / 232
349amnoncommon rattus, rat, feces, research facility, sprague dawley, male, china2018-07-29v4No1 / 235
342amnoncommon water, pacific ocean, philippine sea, surface water, sea water2018-05-28v4No1 / 236
492amnoncommon skin, adult, rana catesbeiana, bullfrog, lithobates catesbeianus, frog, japan2019-02-27v4No1 / 236
536amnoncommon snake, skin, united states of america, southern united states, agkistrodon contortrix, copperhead snake2019-07-28v4No1 / 236
438amnonhigher in students and soldiers age 19-24 compared to older adults ( high in age 19-24 soldiers compared to adult age 30-50 age 60-79 age >94 in homo sapiens feces china )2018-12-30v4No1 / 238
548amnoncommon minas gerais state, campos rupestres, brazil, vellozia epidendroides, leaf, leaf endosphere2019-08-17v4No1 / 243
161amnoncommon in barn swallows in colorado (common hirundo rustica, feces, united states of america, colorado, barn swallow)2017-07-12v4No1 / 245
351amnoncommon sea urchin, lytechinus variegatus, coelomic fluid, research facility, eagle harbor, state of florida, united states of america2018-07-30v4No1 / 249
304amnoncommon united states of america, state of california, beach, pacific ocean, air, aerosol, monterey bay2018-03-12v4No1 / 263
253amnoncommon in clouds in puy de dome mountain in france (common cloud, french republic, air, autumn)2017-11-22v4No1 / 267
499amnoncommon brazil, pond, digestive system, intestine, astyanax paranae, fish, astyanax2019-03-05v4No1 / 273
315amnoncommon in frog pond water (common hunan province, jiangxi province, water, fresh water, pond, china)2018-04-10v4No1 / 274
160amnoncommon in river water upstream of WTP effluent in spring in china (common river, water, spring, china)2017-07-12v4No1 / 278
355amnoncommon canada, province of british columbia, calvert island, pacific ocean, ocean, alga, cryptosiphonia woodii, cryptosiphonia2018-08-01v4No1 / 281
423amnoncommon bank vole, myodes glareolus, ukraine, skin2018-12-05v4No1 / 291
37amnoncommon in plastic leaf plants (in field next to tomato plants) (common maryland county, leaf)2016-12-09v4No1 / 298
237amnonlower in burrow soil compared to bird ( high in oceanodroma leucorhoa bird seabird compared to soil burrow in canada bon portage island )2017-11-07v4No1 / 298
78amnon high in male compared to female in nanger granti kenya feces tropical grassland biome gazelle 2017-03-01v4No1 / 304
241amnonhigher in babies from russia compared to finland ( high in russia compared to finland in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 306
499amnoncommon brazil, pond, poecilia reticulata, digestive system, intestine, fish, guppy2019-03-05v4No1 / 308
515amnoncommon carnivorous beetle, river, poland, raba river, whole body, beetle, bembidion varicolor2019-04-18v4No1 / 308
534amnoncommon river, water, fresh water, depth 10 cm, koshi river, nepal, particle bound, filtered 2.7um2019-07-22v4No1 / 315
461amnoncommon water, atlantic ocean, surface water, coastal water, united states of america, commonwealth of massachusetts, sea water2019-01-12v4No1 / 322
342amnoncommon water, pacific ocean, philippine sea, depth 300m, sea water2018-05-28v4No1 / 323
311amnoncommon in floor of kimchi production facility (common united states of america, state of rhode island, floor, food processing factory)2018-04-09v4No1 / 324
471amnon high in adult compared to tadpole in digestive system frog osteopilus septentrionalis research facility united states of america state of florida 2019-01-14v4No1 / 328
338amnonlower in wild salamanders compared to zoo grown salamanders ( high in zoological garden zoo compared to pond area designated as a nature reserve in skin andrias japonicus japanese giant salamander japan )2018-05-21v4No1 / 334
351amnoncommon in artificial sea water where sea urchins were grown (common sea urchin, lytechinus variegatus, research facility, state of florida, united states of america, artificial seawater, sea water)2018-07-30v4No1 / 338
254amnoncommon river, water, fresh water, depth 0.5m, jiulong river, fujian province, china2017-11-23v4No1 / 347
209amnonhigher in whale blow condensate compared to ocean water ( high in whale blow exhaled air condensate respiratory airway megaptera novaeangliae humpback whale compared to sea water ocean depth 25cm in north america )2017-10-15v4No1 / 359
341amnonhigher in fresh drinking water compared to week old water ( high in fresh water compared to stagnant water in water drinking water united states of america tap water state of illinois )2018-05-28v4No1 / 365
174amnonhigher farther away from glacier terminus ( high in top of glacier compared to terminus of glacier in alaska united states of america denali national park and preserve glacier surface debris )2017-07-27v4No1 / 369
486amnoncommon pacific ocean, ocean, sediment, carbonate, lithified carbonate blocks, depth 500-1000m, hydrate ridge, state of oregon, low activity methane seep2019-02-19v4No1 / 371
62amnoncommon homo sapiens, feces, united states of america, obsolete_juvenile stage, child2017-02-13v4No1 / 373
160amnoncommon in river water upstream of WTP effluent in autumn in china (common river, water, autumn, china)2017-07-12v4No1 / 376
29amnon high in seed compared to seedling in brassica oleracea french republic 2016-12-05v4No1 / 379
256amnonhigher in small intestine compared to colon in pigs ( high in duodenum jejunum ileum compared to caecum right colon left colon in sus scrofa pig united kingdom )2017-11-26v4No1 / 387
170amnonhigher in low turbidity river water ( high in low turbidity turbidity compared to high turbidity in river water fresh water depth 10 cm united states of america stream )2017-07-24v4No1 / 395
342amnoncommon water, pacific ocean, philippine sea, depth 150m, sea water2018-05-28v4No1 / 397
558amnon high in gizzard compared to crop in bird centrocercus urophasianus greater sage-grouse united states of america state of wyoming 2019-09-20v4No1 / 408
353amnoncommon in wild Lissotriton vulgaris newts skin (common newt, adult, skin, lissotriton vulgaris, cambridgeshire, united kingdom)2018-07-30v4No1 / 418
62amnoncommon homo sapiens, feces, obsolete_juvenile stage, child, egypt2017-02-13v4No1 / 422
504amnoncommon nan'ao island, sediment, marine sediment, china2019-03-14v4No1 / 437
99amnoncommon commonwealth of virginia, united states of america, skin, mucus, pseudacris crucifer, peeper2017-04-02v4No1 / 438
504amnoncommon nan'ao island, water, sea water, china2019-03-14v4No1 / 452
353amnoncommon in wild Triturus cristatus newts skin (common newt, adult, skin, cambridgeshire, triturus cristatus, united kingdom)2018-07-30v4No1 / 456
504amnon high in water sea water compared to sediment marine sediment in nan'ao island china 2019-03-14v4No1 / 462
160amnoncommon in wastewater treatment plant effluent in autumn in china (common autumn, wastewater treatment plant, effluent, china)2017-07-12v4No1 / 469
28amnon high in whole plant leaf compared to feces achatinella mustelina in hawaii 2016-12-05v4No1 / 471
315amnonhigher in frog pond water compared to frog gut ( high in water fresh water compared to digestive system colon frog quasipaa spinosa giant spiny frog in jiangxi province hunan province china )2018-04-10v4No1 / 505
539amnon high in days 30-60 anaerobic fermentation late timepoint compared to days 1-15 aerobic fermentation early timepoint in ethiopia ensete ventricosum ethiopian banana food (fermented) 2019-07-31v4No1 / 510
304amnoncommon united states of america, state of california, beach, pacific ocean, air, aerosol, santa cruz province2018-03-12v4No1 / 518
515amnoncommon whole body, beetle, detritivorous beetle, feces, bulgaria, balkan mountains, onthophagus taurus2019-04-18v4No1 / 533
352amnon high in small intestine duodenum compared to feces in homo sapiens new delhi india 2018-07-30v4No1 / 545
462amnon high in populus deltoides compared to populus trichocarpa x deltoides in united states of america state of tennessee populus tree leaf cultivated environment 2019-01-13v4No1 / 559
138amnoncommon in ocean water depth 1000m (common sea water, ocean, pacific ocean, depth 1000m)2017-04-18v4No1 / 566
443amnoncommon mississippi river, water, river, fresh water, depth 1m, united states of america, particle, filtered 2.7um, downstream, lower mississippi river2019-01-07v4No1 / 568
254amnon high in summer wet season autumn compared to winter dry season in river water fresh water depth 0.5m jiulong river fujian province china 2017-11-23v4No1 / 571
160amnoncommon in wastewater treatment plant effluent in spring in china (common wastewater treatment plant, effluent, spring, china)2017-07-12v4No1 / 573
254amnon high in summer wet season compared to winter dry season autumn in river water fresh water depth 0.5m jiulong river fujian province china 2017-11-23v4No1 / 581
138amnoncommon in ocean water depth 150-500m (common sea water, ocean, pacific ocean, depth 150-500m)2017-04-18v4No1 / 582
146amnon high in rhizosphere compared to soil in united states of america solanum lycopersicum tomato slit loam ph 6 2017-04-20v4No1 / 590
406amnoncommon feces, zoological garden, diceros bicornis, black rhinoceros, united states of america, switzerland2018-11-21v4No1 / 600
425amnon high in duodenum compared to feces in homo sapiens africa child 2018-12-08v4No1 / 622
360amnonhigher in leaf surface compared to soil in agave plants ( high in leaf leaf surface compared to soil in desert state of california mexico guanajuato agave )2018-08-21v4No1 / 645
360amnoncommon agave, desert, state of california, agave deserti, leaf, leaf surface2018-08-21v4No1 / 649
103amnonlower in particle bound fraction compared to free floating bacteria in mississippi river ( high in free floating compared to particle in river united states of america mississippi river fresh water aquatic biome )2017-04-05v4No1 / 653
175amnonhigher in summer compared to winter in heavy metal contaminated soils in china ( high in summer compared to winter in soil heavy metal china )2017-07-29v4No1 / 658
138amnoncommon in ocean water depth 2000-4000m (common sea water, ocean, pacific ocean, depth 2000-4000m)2017-04-18v4No1 / 674
271amnon high in rhizosphere glycine max soybean compared to soil in depth 0-20cm china 2018-01-09v4No1 / 750
206amnoncommon in air from israel particles <10um size (common air, dust, israel, size < 10um, clear day)2017-10-04v4No1 / 765
384amnon high in pair of nares nasal cavity compared to oral cavity saliva mouth in equus caballus horse canada farm 2018-10-22v4No1 / 791
478amnoncommon farm, shrimp farm, water, saline water, china2019-02-19v4No1 / 799
232amnonlower in diabetec foot ulcers compared to non-ulcer skin in diabetic patients ( high in control compared to wound ulcer in homo sapiens skin australia foot diabetes mellitus )2017-11-05v4No1 / 836
517amnon high in skin arm forearm compared to feces in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 836
265amnoncommon canada, province of quebec, soilwater, water2017-12-11v4No1 / 841
266amnoncommon in roots in JAM garden (common brassicaceae, boechera stricta, plant, united states of america, state of idaho, root)2017-12-19v4No1 / 843
462amnon high in leaf compared to stem in united states of america state of tennessee populus tree cultivated environment 2019-01-13v4No1 / 890
146amnoncommon united states of america, solanum lycopersicum, tomato, slit loam soil, ph 6, rhizosphere2017-04-20v4No1 / 894
206amnoncommon in dust storm air from israel particles <10um size (common israel, air, size < 10um, dust, dust storm)2017-10-04v4No1 / 902
37amnonlower in tomato plant leaves compared to plastic control ( high in control compared to solanum lycopersicum in maryland county leaf )2016-12-09v4No1 / 950
517amnon high in skin arm forearm compared to mouth mucosa mouth in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 1014
478amnoncommon farm, shrimp farm, sediment, china2019-02-19v4No1 / 1085
266amnon high in leaf compared to root in brassicaceae boechera stricta plant united states of america state of idaho 2017-12-19v4No1 / 1175
98amnoncommon citrus, rhizosphere, gainesville, fl, root, state of florida2017-04-01v4No1 / 1371
443amnonhigher in lower mississippi river (downstream) compared to upper mississippi river ( high in lower mississippi river downstream compared to upper mississippi river upstream in mississippi river water river fresh water depth 1m united states of america particle filtered 2.7um )2019-01-07v4No1 / 1418
40amnoncommon soil, field soil, nicotiana tabacum, rhizosphere, china2016-12-09v4No1 / 1420
462amnon high in rhizosphere compared to soil in united states of america state of tennessee populus tree cultivated environment 2019-01-12v4No1 / 1428
271amnoncommon rhizosphere, glycine max, depth 0-20cm, soybean, china2018-01-09v4No1 / 1459
4amnoncommon periplaneta americana, digestive system, united states of america2016-10-13v4No1 / 1637
101amnon high in root compared to rhizosphere in vitis vinifera united states of america merlot grapevine new york 2017-04-03v4No1 / 2075
271amnoncommon depth 0-20cm, soil, china2018-01-09v4No1 / 2856
166amnoncommon in river sediment (5cm) without mussels (common freshwater biome, river, united states of america, sediment, mississippi river, depth 5cm, upper mississippi river)2017-07-18v4No1 / 2877
265amnon high in soilwater water compared to soil in canada province of quebec 2017-12-11v4No1 / 3277
462amnon high in rhizosphere compared to root in united states of america state of tennessee populus tree cultivated environment 2019-01-13v4No1 / 4630
271amnon high in soil rhizosphere compared to root structure root in depth 0-20cm glycine max soybean china 2018-01-09v4No1 / 7954

Problems / suggestions? Please email info AT dbbact DOT org