Search result for sequence:
TACAGAGGGTGCGAGCGTTAATCGGATTTACTGGGCGTAAAGCGTGCGTAGGCGGCTTTTTAAGTCGGATGTGAAATCCCCGAGCTTAACTTGGGAATTGCATTCGATACTGGGAAGCTAGAGTATGGGAGAGGATGGTAGAATTCCAGG
common ontology terms
term enrichment score
TermScore
united states of america0.296791
skin0.278721
china0.158810
water0.151138
costa rica0.124095
homo sapiens0.115684
research facility0.111266
fresh water0.109312
whole body0.095427
feces0.093092
digestive system0.092854
panama0.090129
larval stage0.088795
river0.086768
frog0.086393
intestine0.081466
state of florida0.080557
brazil0.075517
adult0.071305
sea water0.070623
body proper0.068919
snake0.066152
pacific ocean0.061856
germany0.061412
ant0.061002
southern united states0.061002
soil0.058347
female0.055907
leaf0.054814
air0.052747
bird0.052747
farm0.050244
mucus0.048862
ocean0.047791
canada0.046102
beetle0.044843
state of california0.044266
depth 10 cm0.043860
food (fermented)0.043700
amphibian larval stage0.040495
salamandra salamandra0.040495
atlantic ocean0.040250
reforestation0.040089
shaanxi province0.040089
robinia pseudoacacia0.040089
duodenum0.039929
rhizosphere0.039656
pond0.039301
loess plateau0.039301
stomach0.039139
united kingdom0.037113
silt loam0.037113
koshi river0.035794
fire salamander0.035794
cambridgeshire0.035794
nepal0.035165
newt0.035165
new york city0.034858
infant0.034086
child0.031809
butterfly0.031710
spring water0.031461
ethiopia0.031461
LOWER IN feces0.030973
pair of nares0.030735
zebra fish0.027366
danio rerio0.027273
stream0.027273
state of tennessee0.027211
philippine sea0.027088
culicoides <genus>0.027088
biting midge0.027088
filtered 2.7um0.027088
late timepoint0.027088
ensete ventricosum0.027088
ethiopian banana0.027088
30 years0.027088
LOWER IN soil0.026906
nectar0.026726
flower0.026030
sediment0.025896
toad0.022805
rana catesbeiana0.022805
bullfrog0.022805
coral0.022762
foodon product type0.022762
bulgaria0.022676
balkan mountains0.022676
detritivorous beetle0.022676
bon portage island0.022676
oceanodroma leucorhoa0.022676
seabird0.022676
sand fly0.022676
days 30-600.022676
anaerobic fermentation0.022676
hawaii0.022548
tree0.022548
free floating0.022422
autumn0.022359
LOWER IN caecum0.022321
Fraction of dbbact annotations with this term covered by the query
TermScore
zebra fish0.800000
mississippi river0.750000
butterfly0.666667
beetle0.666667
oreochromis niloticus0.666667
danio rerio0.666667
river0.666667
stream0.666667
amphibian larval stage0.666667
salamandra salamandra0.666667
dendropsophus minutus0.666667
toad0.666667
snake0.666667
rana catesbeiana0.666667
bullfrog0.666667
capsicum annuum0.666667
state of idaho0.666667
osteopilus septentrionalis0.666667
salamander0.666667
arm0.666667
venezuela0.666667
amerindian0.666667
debris0.666667
frog0.625000
skin0.606061
coral0.600000
panama0.600000
foodon product type0.600000
state of tennessee0.600000
costa rica0.571429
mucus0.571429
atlantic ocean0.555556
skh-1 hairless mouse0.500000
ant0.500000
pseudomyrmex spinicola0.500000
pseudomyrmex cubaensis0.500000
skeleton0.500000
turbinaria reniformis0.500000
organic material0.500000
forest biome0.500000
larval stage0.500000
heliconius erato0.500000
tropical and subtropical moist broadleaf forest biome0.500000
caterpillar0.500000
frass0.500000
psychotria suerrensis0.500000
linepithema humile0.500000
argentine ant0.500000
ants0.500000
odontomachus0.500000
onthophagus taurus0.500000
bulgaria0.500000
balkan mountains0.500000
detritivorous beetle0.500000
nile tilapia0.500000
pheidole0.500000
tropical grassland biome0.500000
nanger granti0.500000
gazelle0.500000
pseudomyrmex elongatus0.500000
koshi river0.500000
bottlenosed dolphin0.500000
pseudomyrmex nigropilosus0.500000
pseudomyrmex pallidus0.500000
hirundo rustica0.500000
barn swallow0.500000
fungus growing ant0.500000
atta colombica0.500000
pseudomyrmex nigrocinctus0.500000
air0.500000
outdoor0.500000
fire salamander0.500000
anoplophora glabripennis0.500000
indoor0.500000
office0.500000
lesser treefrog0.500000
lesser foam frog0.500000
scinax perereca0.500000
bufo bufo0.500000
common toad0.500000
ruellia terminalis0.500000
stachytarpheta frantzii0.500000
purple porterweed0.500000
chlosyne gaudialis0.500000
onthophagus similis0.500000
tributary0.500000
pantherophis obsoletus0.500000
southern united states0.500000
black rat snake0.500000
arboreal snake0.500000
skin under eye0.500000
LOWER IN conjunctiva0.500000
human0.500000
skin of face0.500000
skin under eyes0.500000
bon portage island0.500000
bird0.500000
oceanodroma leucorhoa0.500000
seabird0.500000
brood patch0.500000
Fraction of annotations for the query sequences containing the term
TermScore
united states of america0.352668
skin0.180974
china0.132251
homo sapiens0.120650
water0.102088
feces0.097448
research facility0.092807
adult0.085847
costa rica0.069606
fresh water0.062645
whole body0.055684
digestive system0.053364
female0.048724
larval stage0.048724
panama0.048724
intestine0.046404
river0.046404
frog0.046404
brazil0.044084
state of florida0.044084
sea water0.041763
soil0.041763
body proper0.039443
germany0.034803
snake0.034803
pacific ocean0.034803
ant0.032483
southern united states0.032483
leaf0.030162
farm0.027842
air0.027842
bird0.027842
ocean0.025522
state of california0.025522
canada0.025522
mucus0.025522
stomach0.023202
beetle0.023202
depth 10 cm0.023202
food (fermented)0.023202
rhizosphere0.023202
amphibian larval stage0.020882
salamandra salamandra0.020882
duodenum0.020882
united kingdom0.020882
atlantic ocean0.020882
pond0.020882
silt loam0.020882
reforestation0.020882
shaanxi province0.020882
loess plateau0.020882
robinia pseudoacacia0.020882
infant0.018561
new york city0.018561
nepal0.018561
koshi river0.018561
fire salamander0.018561
cambridgeshire0.018561
newt0.018561
child0.018561
butterfly0.016241
spring water0.016241
pair of nares0.016241
ethiopia0.016241
LOWER IN feces0.016241
nectar0.013921
flower0.013921
danio rerio0.013921
zebra fish0.013921
stream0.013921
philippine sea0.013921
culicoides <genus>0.013921
biting midge0.013921
filtered 2.7um0.013921
state of tennessee0.013921
late timepoint0.013921
ensete ventricosum0.013921
ethiopian banana0.013921
sediment0.013921
LOWER IN soil0.013921
30 years0.013921
LOWER IN control0.011601
nasal cavity0.011601
coral0.011601
hawaii0.011601
forest ecosystem0.011601
bulgaria0.011601
balkan mountains0.011601
detritivorous beetle0.011601
state of texas0.011601
free floating0.011601
toad0.011601
bon portage island0.011601
oceanodroma leucorhoa0.011601
seabird0.011601
surface water0.011601
rana catesbeiana0.011601
bullfrog0.011601
french republic0.011601
age0.011601
Exp. ID User ID Description Date Region Flag Sequences
176amnonhigh freq. in skin of hairless mice (dominant united states of america, female, research facility, dorsum, mus musculus, skin, mouse, skh-1 hairless mouse)2017-07-29v4No1 / 1
408amnon high in stomach compared to larval stage in united states of america costa rica ant pseudomyrmex spinicola 2018-11-22v4No1 / 5
408amnondominant united states of america, stomach, costa rica, ant, pseudomyrmex cubaensis2018-11-22v4No1 / 5
779amnon high in ulcerative colitis compared to control in feces homo sapiens adult guangzhou city prefecture china 2021-04-28v4No1 / 5
227amnonhigher in infants with respiratory illness compared to healthy controls ( high in respiratory system disease compared to control in homo sapiens nasal cavity nasopharynx infant kingdom of the netherlands )2017-10-30v4No1 / 6
418amnoncommon ocean, skeleton, coral, turbinaria reniformis2018-12-02v4No1 / 6
28amnonhigh freq. in leaves in hawaii (dominant organic material, forest biome, leaf, hawaii, whole plant, forest ecosystem)2016-12-05v4No1 / 7
118amnondominant feces, larval stage, panama, butterfly, heliconius erato, tropical and subtropical moist broadleaf forest biome, caterpillar, frass, forest ecosystem2017-04-11v4No1 / 7
501amnondominant nectar, costa rica, flower, psychotria suerrensis2019-03-08v4No1 / 7
182amnoncommon united states of america, body proper, linepithema humile, argentine ant2017-08-15v4No1 / 8
184amnondominant digestive system, peru, ants, odontomachus2017-08-15v4No1 / 8
408amnoncommon united states of america, stomach, costa rica, crematogaster, ant2018-11-22v4No1 / 8
515amnondominant feces, onthophagus taurus, bulgaria, balkan mountains, whole body, beetle, detritivorous beetle2019-04-18v4No1 / 8
108amnondominant united states of america, research facility, caecum, oreochromis niloticus, state of texas, nile tilapia2017-04-07v4No1 / 9
408amnondominant united states of america, stomach, costa rica, ant, pheidole2018-11-22v4No1 / 9
58amnondominant homo sapiens, conjunctiva, new york city2017-02-02v4No1 / 10
78amnondominant feces, tropical grassland biome, kenya, nanger granti, gazelle2017-03-01v4No1 / 10
117amnondominant united states of america, research facility, larval stage, intestine, danio rerio, zebra fish2017-04-10v4No1 / 10
408amnoncommon united states of america, larval stage, costa rica, ant, pseudomyrmex elongatus2018-11-22v4No1 / 10
408amnoncommon united states of america, stomach, costa rica, ant, pseudomyrmex cubaensis2018-11-22v4No1 / 10
497amnondominant feces, farm, gallus gallus, austria, chicken, age 4 weeks, broiler chicken2019-03-04v4No1 / 10
534amnondominant river, water, fresh water, nepal, free floating, depth 10 cm, filtered 0.2um, koshi river2019-07-22v4No1 / 10
79amnondominant united states of america, skin, tursiops truncatus, bottlenosed dolphin2017-03-03v4No1 / 10
152amnonhigh in blanks compares to dust/nose samples (contamination)2017-05-04v4No1 / 10
408amnoncommon united states of america, stomach, costa rica, ant, pseudomyrmex spinicola2018-11-22v4No1 / 11
408amnoncommon united states of america, stomach, costa rica, ant, pseudomyrmex nigropilosus2018-11-22v4No1 / 11
408amnoncommon united states of america, larval stage, costa rica, ant, pseudomyrmex pallidus2018-11-22v4No1 / 11
408amnondominant united states of america, larval stage, costa rica, ant, pseudomyrmex pallidus2018-11-22v4No1 / 11
108amnoncommon united states of america, research facility, caecum, oreochromis niloticus, state of texas, nile tilapia2017-04-07v4No1 / 12
118amnoncommon feces, larval stage, panama, butterfly, heliconius erato, tropical and subtropical moist broadleaf forest biome, caterpillar, frass, forest ecosystem2017-04-11v4No1 / 12
161amnonhigh freq. in barn swallows in colorado (dominant feces, united states of america, state of colorado, hirundo rustica, barn swallow)2017-07-12v4No1 / 12
397amnondominant digestive system, intestine, panama, fungus growing ant, atta colombica2018-11-14v4No1 / 12
408amnoncommon united states of america, stomach, costa rica, ant, pseudomyrmex nigrocinctus2018-11-22v4No1 / 12
460amnonhigh freq. in outdoor air (dominant united states of america, air, state of california, outdoor)2019-01-12v4No1 / 12
149amnondominant stream, larval stage, intestine, amphibian larval stage, germany, salamandra salamandra, fire salamander2017-04-24v4No1 / 13
243amnondominant digestive system, united states of america, beetle, anoplophora glabripennis2017-11-15v4No1 / 13
408amnondominant united states of america, stomach, costa rica, crematogaster, ant2018-11-22v4No1 / 13
460amnonhigh freq. in occupied office air (dominant united states of america, air, state of california, indoor, office)2019-01-12v4No1 / 13
492amnondominant skin, adult, brazil, frog, dendropsophus minutus, lesser treefrog2019-02-27v4No1 / 13
492amnondominant skin, adult, brazil, frog, lesser foam frog, scinax perereca2019-02-27v4No1 / 13
492amnondominant skin, adult, germany, toad, bufo bufo, common toad2019-02-27v4No1 / 13
501amnondominant nectar, costa rica, flower, ruellia terminalis2019-03-08v4No1 / 13
501amnondominant nectar, costa rica, flower, stachytarpheta frantzii, purple porterweed2019-03-08v4No1 / 13
501amnoncommon digestive system, costa rica, butterfly, chlosyne gaudialis2019-03-09v4No1 / 13
515amnondominant feces, bulgaria, balkan mountains, whole body, beetle, detritivorous beetle, onthophagus similis2019-04-18v4No1 / 13
534amnondominant river, tributary, water, fresh water, nepal, free floating, depth 10 cm, filtered 0.2um, koshi river2019-07-22v4No1 / 13
536amnondominant united states of america, skin, pantherophis obsoletus, snake, southern united states, black rat snake, arboreal snake2019-07-28v4No1 / 13
58amnon high in skin skin under eye compared to conjunctiva in new york city human 2017-02-02v4No1 / 14
58amnondominant homo sapiens, skin of face, new york city, skin under eyes2017-02-02v4No1 / 14
229amnoncommon in sinuses from chronic rhinosinositis patients (common homo sapiens, paranasal sinus, sinusoidal space, australia, sinusitis)2017-10-31v4No1 / 14
237amnondominant canada, bon portage island, bird, oceanodroma leucorhoa, seabird, brood patch2017-11-07v4No1 / 14
304amnoncandidate contaminants - higher in blanks (contamination)2018-03-12v4No1 / 14
342amnondominant water, surface water, sea water, pacific ocean, philippine sea2018-05-28v4No1 / 14
397amnoncommon digestive system, intestine, panama, fungus growing ant, mycocepurus smithii2018-11-14v4No1 / 14
536amnondominant united states of america, skin, snake, southern united states, aquatic snake, nerodia sipedon, northern water snake2019-07-28v4No1 / 14
58amnondominant homo sapiens, new york city, contact lens2017-02-02v4No1 / 15
342amnondominant water, sea water, pacific ocean, philippine sea, depth 150m2018-05-28v4No1 / 15
342amnondominant water, sea water, pacific ocean, philippine sea, depth 300m2018-05-28v4No1 / 15
406amnondominant feces, united states of america, zoological garden, switzerland, diceros bicornis, black rhinoceros2018-11-21v4No1 / 15
515amnondominant feces, bulgaria, balkan mountains, whole body, beetle, detritivorous beetle, aphodius haemorrhoidalis2019-04-18v4No1 / 15
674amnondominant female, body proper, panama, whole body, culicoides <genus>, biting midge, culicoides helicaniae2020-09-28v4No1 / 15
674amnondominant female, body proper, whole body, panama, culex declarator, mosquito2020-09-28v4No1 / 15
779amnon high in crohn's disease compared to control in feces homo sapiens adult guangzhou city prefecture china 2021-04-28v4No1 / 15
79amnoncommon united states of america, skin, tursiops truncatus, bottlenosed dolphin2017-03-03v4No1 / 15
51amnondominant homo sapiens, united states of america, biopsy site, biopsy2017-01-19v4No1 / 16
118amnonhigh freq. in wild butterfly (dominant body proper, adult, panama, butterfly, heliconius erato, whole body, tropical and subtropical moist broadleaf forest biome, forest ecosystem)2017-04-11v4No1 / 16
492amnondominant skin, adult, rana catesbeiana, bullfrog, frog, lithobates catesbeianus, japan2019-02-27v4No1 / 16
492amnondominant skin, adult, brazil, rana catesbeiana, bullfrog, frog, lithobates catesbeianus2019-02-27v4No1 / 16
501amnoncommon nectar, costa rica, flower, psychotria suerrensis2019-03-08v4No1 / 16
534amnondominant river, tributary, water, fresh water, nepal, depth 10 cm, filtered 2.7um, particle bound, koshi river2019-07-22v4No1 / 16
534amnondominant river, water, fresh water, nepal, depth 10 cm, filtered 2.7um, particle bound, koshi river2019-07-22v4No1 / 16
612amnondominant united states of america, water, fresh water, state of florida, spring water, location 32020-04-22v4No1 / 16
692amnoncommon brazil, fermented beverage, curitiba microregion, fermented milk2028-03-16v4No1 / 16
79amnondominant united states of america, skin, stenella attenuata2017-03-03v4No1 / 16
68amnonfound in some aphid samples (prevalence <=0.1) (other cinara)2017-02-20v4No1 / 17
237amnondominant uropygial gland, canada, bon portage island, bird, oceanodroma leucorhoa, seabird2017-11-07v4No1 / 17
351amnondominant united states of america, research facility, coelomic fluid, state of florida, eagle harbor, lytechinus variegatus, sea urchin2018-07-30v4No1 / 17
352amnonhigh freq. in duodenal biopsies (dominant homo sapiens, small intestine, duodenum, new delhi, india)2018-07-30v4No1 / 17
353amnonhigh freq. in captive Triturus cristatus newts skin (dominant research facility, skin, adult, cambridgeshire, newt, triturus cristatus, united kingdom)2018-07-30v4No1 / 17
460amnoncommon in occupied office air (common united states of america, air, state of california, indoor, office)2019-01-12v4No1 / 17
492amnondominant skin, adult, brazil, frog, leptodactylus latrans, lesser foam frog2019-02-27v4No1 / 17
501amnoncommon digestive system, costa rica, butterfly, dulcedo polita2019-03-08v4No1 / 17
501amnoncommon digestive system, costa rica, butterfly, heliconius sara, sara longwing butterfly2019-03-09v4No1 / 17
674amnondominant female, body proper, whole body, panama, culex coronator, mosquito2020-09-28v4No1 / 17
149amnondominant mucus, larval stage, amphibian larval stage, skin, germany, salamandra salamandra, fire salamander2017-04-24v4No1 / 18
418amnoncommon ocean, mucus, coral, isopora palifera2018-12-02v4No1 / 18
492amnondominant skin, adult, brazil, rhinella icterica, toad, yellow cururu toad2019-02-27v4No1 / 18
536amnondominant united states of america, skin, snake, southern united states, thamnophis sirtalis, common garter snake2019-07-28v4No1 / 18
280amnon high in coral reef eunicella labiata gorgonian coral coral compared to marine water body saline water sea water in atlantic ocean portuguese republic depth 20m 2018-01-25v4No1 / 19
431amnonhigh freq. in midgut of hibernating bumble bees (dominant research facility, midgut, belgium, bombus terrestris, bumble bee, queen, hibernation)2018-12-16v4No1 / 19
489amnondominant feces, french republic, anal swab, myotis myotis, bat, greater mouse eared bat2019-02-25v4No1 / 19
612amnondominant united states of america, water, fresh water, state of florida, spring water, location 42020-04-22v4No1 / 19
184amnoncommon digestive system, peru, ants, odontomachus2017-08-15v4No1 / 20
227amnoncommon in baby nasopharynx age <= 1 day (common homo sapiens, nasal cavity, nasopharynx, age, infant, kingdom of the netherlands, age <= 24 hours)2017-10-30v4No1 / 20
353amnonhigh freq. in captive Lissotriton vulgaris newts skin (dominant research facility, skin, adult, cambridgeshire, newt, lissotriton vulgaris, united kingdom)2018-07-30v4No1 / 20
536amnondominant united states of america, skin, snake, southern united states, coluber constrictor, eastern racer snake2019-07-28v4No1 / 20
58amnoncommon homo sapiens, skin of face, new york city, skin under eyes2017-02-02v4No1 / 21
149amnondominant pond, larval stage, intestine, amphibian larval stage, germany, salamandra salamandra, fire salamander2017-04-24v4No1 / 21
460amnoncommon in outdoor air (common united states of america, air, state of california, outdoor)2019-01-12v4No1 / 21
501amnoncommon nectar, costa rica, flower, psiguria triphylla2019-03-08v4No1 / 21
536amnondominant united states of america, skin, snake, southern united states, diadophis punctatus, ringneck snake, fossorial snake2019-07-28v4No1 / 21
674amnondominant female, body proper, panama, whole body, culicoides <genus>, culicoides batesi, biting midge2020-09-28v4No1 / 21
759amnondominant feces, united states of america, research facility, rattus norvegicus, commonwealth of massachusetts, rat, city of boston2021-04-06v4No1 / 21
408amnoncommon united states of america, larval stage, costa rica, ant, pseudomyrmex spinicola2018-11-22v4No1 / 22
674amnondominant female, body proper, panama, whole body, lutzomyia gomezi, sand fly2020-09-28v4No1 / 22
674amnondominant female, body proper, whole body, panama, psychodopygus panamensis, sand fly2020-09-28v4No1 / 22
795amnondominant research facility, gallus gallus, chicken, uterine tube infundibulum, adult organism, china, age 90 weeks2021-06-08v4No1 / 22
58amnoncommon homo sapiens, new york city, contact lens2017-02-02v4No1 / 23
74amnoncommon united states of america, capsicum annuum, foodon product type2017-02-27v4No1 / 23
399amnondominant feces, united states of america, state of tennessee, zoological garden, panthera leo, lion2018-11-16v4No1 / 23
408amnoncommon united states of america, larval stage, costa rica, ant, pseudomyrmex simplex2018-11-22v4No1 / 23
492amnoncommon skin, adult, brazil, rana catesbeiana, bullfrog, frog, lithobates catesbeianus2019-02-27v4No1 / 23
489amnoncommon feces, french republic, anal swab, myotis myotis, bat, greater mouse eared bat2019-02-25v4No1 / 24
35amnoncommon homo sapiens, hospital, dense settlement biome, breast milk, tanzania2016-12-06v4No1 / 25
501amnoncommon costa rica, tree, dipteryx oleifera, botanical fruit food product2019-03-08v4No1 / 25
674amnondominant female, body proper, whole body, culicoides <genus>, panama, culicoides foxi, biting midge2020-09-28v4No1 / 25
311amnoncommon united states of america, allium cepa, state of rhode island, onion, foodon product type2018-04-09v4No1 / 26
499amnoncommon digestive system, pond, intestine, brazil, ranatra, water stick-insect2019-03-05v4No1 / 26
536amnoncommon united states of america, skin, snake, southern united states, diadophis punctatus, ringneck snake, fossorial snake2019-07-28v4No1 / 26
74amnoncommon united states of america, squash, foodon product type2017-02-27v4No1 / 27
674amnoncommon female, body proper, panama, whole body, lutzomyia gomezi, sand fly2020-09-28v4No1 / 27
674amnoncommon female, body proper, whole body, panama, nyssomyia trapidoi, sand fly2020-09-28v4No1 / 27
58amnoncommon homo sapiens, conjunctiva, new york city2017-02-02v4No1 / 28
397amnoncommon digestive system, intestine, panama, fungus growing ant, myrmicocrypta ednaella2018-11-14v4No1 / 28
710amnonsuspected contaminant (common in blanks) (contamination)2028-05-20v4No1 / 28
26amnoncommon in combined swab of inguinal region and axilla (common homo sapiens, united states of america, sebum, axilla, inguinal region)2016-12-05v4No1 / 29
193amnonlower in nares of people working in dairy farms ( high in control compared to farm bos taurus in homo sapiens united states of america pair of nares )2017-09-05v4No1 / 29
90amnonincreases during douchi fermentation ( high in timepoint late timepoint compared to early timepoint in douchi food (fermented) china )2017-03-08v4No1 / 30
492amnoncommon skin, adult, brazil, frog, lesser foam frog, scinax perereca2019-02-27v4No1 / 30
149amnoncommon pond, larval stage, intestine, amphibian larval stage, germany, salamandra salamandra, fire salamander2017-04-24v4No1 / 31
233amnon high in age age < 3 months compared to age > 3 months infant stage in feces homo sapiens united states of america infant 2017-11-05v4No1 / 31
492amnoncommon skin, adult, brazil, frog, dendropsophus minutus, lesser treefrog2019-02-27v4No1 / 31
674amnoncommon female, body proper, whole body, panama, culex coronator, mosquito2020-09-28v4No1 / 31
26amnoncommon united states of america, mucus, pair of nares, canis lupus familiaris2016-12-05v4No1 / 32
490amnonobserved in amniotic fluid and buffer and water controls (contamination)2019-02-25v4No1 / 32
492amnoncommon skin, adult, brazil, frog, leptodactylus latrans, lesser foam frog2019-02-27v4No1 / 34
674amnoncommon female, body proper, panama, whole body, psychodopygus panamensis, sand fly2020-09-28v4No1 / 34
240amnonhigher in infants age<1 year compared to 1-3 years in baby feces ( high in age under-1-year-old human stage compared to 1-year-old human stage in feces homo sapiens infant finland )2017-11-12v4No1 / 35
536amnoncommon united states of america, skin, snake, southern united states, fossorial snake, carphophis amoenus, worm snake2019-07-28v4No1 / 35
539amnoncommon ethiopia, early timepoint, ensete ventricosum, ethiopian banana, days 1-15, aerobic fermentation, food (fermented)2019-07-31v4No1 / 35
79amnoncommon united states of america, skin, steno bredanensis, rough-toothed dolphin2017-03-03v4No1 / 35
51amnoncommon homo sapiens, united states of america, biopsy site, biopsy2017-01-19v4No1 / 36
674amnoncommon female, body proper, whole body, culicoides <genus>, panama, biting midge, culicoides helicaniae2020-09-28v4No1 / 36
674amnoncommon female, body proper, whole body, panama, culex declarator, mosquito2020-09-28v4No1 / 36
79amnondominant united states of america, skin, delphinus delphis2017-03-03v4No1 / 36
50amnoncommon in mitten crab gills (common gill, eriocheir sinensis, china)2017-01-19v4No1 / 37
243amnoncommon digestive system, united states of america, beetle, anoplophora glabripennis2017-11-15v4No1 / 38
33amnoncommon homo sapiens, sputum, lung, bronchial epithelium, vancouver2016-12-06v4No1 / 40
501amnoncommon nectar, costa rica, flower, stachytarpheta frantzii, purple porterweed2019-03-08v4No1 / 40
79amnoncommon united states of america, skin, peponocephala electra2017-03-03v4No1 / 40
79amnoncommon united states of america, skin, stenella attenuata2017-03-03v4No1 / 40
28amnoncommon in various trees in hawaii (common organic material, forest biome, leaf, hawaii, whole plant, forest ecosystem)2016-12-05v4No1 / 41
51amnoncommon feces, homo sapiens, united states of america2017-01-19v4No1 / 41
102amnonhigher in cheeks compared to teeth, saliva ( high in cheek compared to saliva dentition in homo sapiens united states of america atlanta mouth )2017-04-03v4No1 / 41
112amnoncommon research facility, intestine, danio rerio, zebra fish, china2017-04-09v4No1 / 41
117amnoncommon united states of america, research facility, larval stage, intestine, danio rerio, zebra fish2017-04-10v4No1 / 41
267amnonhigher in gut of fish in water with cadmium contamination compared to control ( high in cadmium compared to control in digestive system research facility oreochromis niloticus fish china )2017-12-24v4No1 / 41
14amnon high in stomach duodenum jejunum ileum compared to feces caecum transverse colon left colon right colon in united states of america gastrointestinal system mus musculus 2016-11-08v4No1 / 42
79amnoncommon united states of america, skin, globicephala macrorhynchus, short finned pilot whale2017-03-03v4No1 / 42
587amnoncommon israel, food product type, vigna radiata, producer c1, mung bean sprouts2020-02-10v3No1 / 42
547amnon high in high salt concentration compared to low salt concentration in capsicum annuum sichuan province red pepper sauce food (fermented) china 2019-08-15v4No1 / 43
113amnoncommon united states of america, research facility, larval stage, intestine, danio rerio, zebra fish2017-04-10v4No1 / 45
302amnoncommon in feces of canary pet birds (common feces, mexico, bird, pet, serinus canaria, canary)2018-03-05v4No1 / 47
360amnoncommon desert, leaf, state of california, agave, agave deserti, leaf endosphere2018-08-20v4No1 / 48
674amnoncommon female, body proper, panama, whole body, culicoides <genus>, culicoides batesi, biting midge2020-09-28v4No1 / 48
149amnoncommon mucus, larval stage, amphibian larval stage, skin, germany, salamandra salamandra, fire salamander2017-04-24v4No1 / 49
547amnoncommon capsicum annuum, sichuan province, red pepper sauce, food (fermented), china2019-08-15v4No1 / 49
674amnoncommon female, body proper, whole body, culicoides <genus>, panama, culicoides foxi, biting midge2020-09-28v4No1 / 49
79amnoncommon united states of america, skin, harbor seal, phoca vitulina2017-03-03v4No1 / 49
662amnoncommon in cucumber surface (common surface, fruit, cucumis sativus, israel, cucumber, neve yaar)2020-09-22v3No1 / 49
416amnon high in fasting compared to wood diet in united states of america research facility colon termite reticulitermes flaviceps 2018-11-30v4No1 / 52
661amnoncommon farm, lung, china, maojian district, andrias davidianus, chinese giant salamander, age 3 years2020-09-20v4No1 / 53
437amnoncommon united states of america, research facility, intestine, juvenile organism, danio rerio, state of oregon, zebra fish, fish, age 21 days2018-12-26v4No1 / 54
354amnon high in bronchus bronchial epithelium bronchial brush compared to sputum induced sputum in homo sapiens united states of america adult 2018-07-30v4No1 / 55
492amnoncommon skin, adult, chile, frog, eupsophus vertebralis2019-02-27v4No1 / 55
63amnoncommon in skin in american gut (common homo sapiens, skin)2017-02-15v4No1 / 56
237amnoncommon canada, bon portage island, bird, oceanodroma leucorhoa, seabird, brood patch2017-11-07v4No1 / 57
431amnoncommon in midgut of hibernating bumble bees (common research facility, midgut, belgium, bombus terrestris, bumble bee, queen, hibernation)2018-12-16v4No1 / 57
116amnoncommon research facility, intestine, litopenaeus vannamei, south china sea, pacific white shrimp, china2017-04-10v4No1 / 58
237amnoncommon uropygial gland, canada, bon portage island, bird, oceanodroma leucorhoa, seabird2017-11-07v4No1 / 58
67amnoncommon in wet processing of coffee beans (common coffea arabica, ecuador, wet processing)2017-02-19v4No1 / 59
338amnon high in larval stage tadpole amphibian larval stage compared to adult in skin andrias japonicus japanese giant salamander japan 2018-05-21v4No1 / 59
149amnoncommon stream, larval stage, intestine, amphibian larval stage, germany, salamandra salamandra, fire salamander2017-04-24v4No1 / 60
90amnoncommon douchi, food (fermented), china2017-03-08v4No1 / 61
199amnonlower in bathroom shower compared to kitchen sink ( high in kitchen sink compared to bathroom shower tile building wall in united states of america building urban biome )2017-10-01v4No1 / 61
374amnoncommon skin, costa rica, frog, amphibia, oophaga pumilio, strawberry poison frog2018-09-09v4No1 / 61
819amnoncommon homo sapiens, female, skin, adult, skin of cheek, china, dalian city prefecture, age 25-45 years2021-07-12v1No1 / 61
549amnoncommon puerto rico, isla palominos, coral, acropora cervicornis2019-08-17v4No1 / 62
302amnoncommon in feces of Cockatiel pet birds (common feces, mexico, bird, pet, nymphicus hollandicus, cockatiel)2018-03-05v4No1 / 63
501amnonhigher in nectar feeding butterflies compared to fruit feeding ( high in nectar feeding compared to fruit feeding in digestive system costa rica butterfly )2019-03-09v4No1 / 64
536amnoncommon united states of america, skin, snake, southern united states, coluber constrictor, eastern racer snake2019-07-28v4No1 / 64
558amnon high in duodenum compared to caecum in united states of america state of wyoming bird centrocercus urophasianus greater sage-grouse 2019-09-20v4No1 / 64
539amnon high in ensete ventricosum var. gena compared to ensete ventricosum var. maze in ethiopia late timepoint ensete ventricosum ethiopian banana days 30-60 anaerobic fermentation food (fermented) 2019-07-31v4No1 / 65
28amnoncommon feces, terrestrial biome, hawaii, achatinella mustelina, environmental system determined by an organism2016-12-05v4No1 / 71
645amnon high in cloaca compared to feces in state of idaho bird captive gymnogyps californianus california condor 2020-09-03v4No1 / 71
389amnoncommon united states of america, farm, nipple, skin, adult, sus scrofa, state of michigan, pig2018-11-04v4No1 / 72
26amnoncommon homo sapiens, united states of america, mucus, pair of nares2016-12-05v4No1 / 73
719amnoncommon united states of america, research facility, dentition, mus musculus, state of georgia, mouse, charles river laboratories, icr/cd-1 mice2028-05-23v4No1 / 75
322amnoncommon digestive system, united states of america, research facility, adult, state of florida, frog, osteopilus septentrionalis2018-04-23v4No1 / 76
431amnonhigher in midgut of hibernating bumble bees compared to non-hibernating ( high in hibernation compared to non hibernating in research facility midgut belgium bombus terrestris bumble bee queen )2018-12-16v4No1 / 77
407amnon high in wet season compared to dry season in feces costa rica monkey wild cebus capucinus white-faced capuchin 2018-11-21v4No1 / 79
26amnoncommon united states of america, mucus, pair of nares, felis catus2016-12-05v4No1 / 80
108amnon high in caecum compared to colon in united states of america research facility oreochromis niloticus state of texas nile tilapia 2017-04-07v4No1 / 80
534amnoncommon river, tributary, water, fresh water, nepal, free floating, depth 10 cm, filtered 0.2um, koshi river2019-07-22v4No1 / 80
136amnoncommon ocean, sea water, atlantic ocean, sargasso sea, trichodesmium2017-04-17v4No1 / 81
269amnonpeaks at 2 weeks in refrigeration of yao meat ( high in middle timepoint two weeks compared to late timepoint fresh food spoilage in foodon product type china )2018-01-09v4No1 / 83
353amnoncommon in captive Triturus cristatus newts skin (common research facility, skin, adult, cambridgeshire, newt, triturus cristatus, united kingdom)2018-07-30v4No1 / 84
515amnoncommon poland, whole body, plant, beetle, nida basin, herbivorous beetle, centricnemus leucogrammus2019-04-18v4No1 / 84
539amnon high in ensete ventricosum var. maze compared to ensete ventricosum var. ketishe in ethiopia late timepoint ensete ventricosum ethiopian banana days 30-60 anaerobic fermentation food (fermented) 2019-07-31v4No1 / 84
227amnonhiger in first 24hrs compared to later timepoints in baby nasopharynx ( high in age age <=24 hours compared to age >= 7 days in homo sapiens nasal cavity nasopharynx infant kingdom of the netherlands )2017-10-30v4No1 / 85
26amnon high in mucus pair of nares compared to saliva mouth in united states of america felis catus 2016-12-05v4No1 / 86
109amnoncommon united states of america, water, drinking water, site c2017-04-08v4No1 / 86
353amnoncommon in captive Lissotriton vulgaris newts skin (common research facility, skin, adult, cambridgeshire, newt, lissotriton vulgaris, united kingdom)2018-07-30v4No1 / 86
513amnoncommon city, waste water, hospital, xinxiang city prefecture, china2019-03-25v4No1 / 86
79amnoncommon united states of america, skin, balaenoptera borealis, sei whale2017-03-03v4No1 / 90
354amnon high in bronchus bronchial epithelium bronchial brush compared to saliva oral wash in homo sapiens united states of america adult 2018-07-30v4No1 / 94
471amnoncommon digestive system, united states of america, research facility, adult, state of florida, frog, osteopilus septentrionalis2019-01-14v4No1 / 94
427amnonlower in salamanders kept at 20C compared to 10C ( high in temp 10c compared to temp 20c in feces united states of america commonwealth of virginia salamander eastern red backed salamander plethodon cinereus )2018-12-08v4No1 / 95
492amnoncommon skin, adult, brazil, rhinella icterica, toad, yellow cururu toad2019-02-27v4No1 / 95
770amnon high in penis male organism compared to vagina female organism in macaca mulatta age > 1 year cayo santiago puerto rico indian rhesus macaque 2021-04-19v4No1 / 95
99amnoncommon united states of america, mucus, skin, commonwealth of virginia, rana catesbeiana, bullfrog2017-04-02v4No1 / 99
645amnoncommon cloaca, state of idaho, bird, captive, gymnogyps californianus, california condor2020-09-03v4No1 / 99
196amnonlower in water compared to biofilm ( high in biofilm compared to water in united states of america drinking water )2017-09-12v4No1 / 100
483amnoncommon united states of america, research facility, larval stage, hawaii, pearl harbor, hydroides elegans, tubeworm2019-02-13v4No1 / 100
536amnoncommon united states of america, skin, snake, southern united states, fossorial snake, storeria dekayi, ground snake2019-07-28v4No1 / 101
499amnoncommon digestive system, pond, intestine, tadpole, brazil, frog, dendropsophus minutus2019-03-05v4No1 / 102
425amnon high in madagascar antananarivo compared to central african republic bangui in homo sapiens duodenum child africa 2018-12-08v4No1 / 103
168amnoncommon in mud from chinese liquor fermentation pit (common mud, ph 5, fermentation pit mud, china)2017-07-18v4No1 / 104
515amnoncommon feces, bulgaria, balkan mountains, whole body, beetle, detritivorous beetle, onthophagus similis2019-04-18v4No1 / 104
377amnoncommon skin, germany, salamandra salamandra, salamander2018-09-12v4No1 / 106
149amnon high in stream compared to pond in larval stage intestine amphibian larval stage germany salamandra salamandra fire salamander 2017-04-24v4No1 / 107
353amnonhigher in captive compared to wild caught Lissotriton vulgaris newts skin ( high in research facility compared to wild in skin adult cambridgeshire newt lissotriton vulgaris united kingdom )2018-07-30v4No1 / 110
536amnoncommon united states of america, skin, snake, southern united states, thamnophis sirtalis, common garter snake2019-07-28v4No1 / 110
740amnoncommon cloaca, ecuador, galapagos islands, alimentary part of gastrointestinal system, amblyrhynchus cristatus, cloacal swab, marine iguana2021-02-08v4No1 / 110
536amnoncommon united states of america, skin, snake, southern united states, aquatic snake, nerodia sipedon, northern water snake2019-07-28v4No1 / 111
388amnoncommon united states of america, farm, tonsil, sus scrofa, state of michigan, pig, age 6-10 weeks2018-11-03v4No1 / 112
269amnoncommon in fresh yao meat food (common foodon product type, china)2018-01-09v4No1 / 113
79amnoncommon united states of america, skin, delphinus delphis2017-03-03v4No1 / 113
416amnon high in wood diet compared to mulch diet in united states of america research facility colon termite reticulitermes flaviceps 2018-11-30v4No1 / 115
492amnoncommon skin, adult, germany, toad, bufo bufo, common toad2019-02-27v4No1 / 115
536amnoncommon united states of america, skin, snake, southern united states, agkistrodon piscivorus, aquatic snake2019-07-28v4No1 / 115
48amnonhigher in 3 months compared to 1 week in infant hypopharynx ( high in age 3-month-old human stage compared to age 1 week 1-month-old human stage in homo sapiens hypopharynx infant kingdom of denmark )2017-01-19v4No1 / 116
195amnoncommon in boston subway surfaces (common city, urban biome, boston, train)2017-09-07v4No1 / 116
149amnonhigher in larvae transferred to stream compared to pond ( high in stream compared to pond in mucus larval stage amphibian larval stage skin germany salamandra salamandra fire salamander )2017-04-24v4No1 / 117
410amnonlower in feces compared to rectal biopsies in children with treatment naive uc ( high in rectum biopsy site biopsy compared to feces in homo sapiens united states of america child ulcerative colitis )2018-11-22v4No1 / 118
352amnoncommon in duodenal biopsies (common homo sapiens, small intestine, duodenum, new delhi, india)2018-07-30v4No1 / 121
374amnoncommon skin, costa rica, amphibia, rhaebo haematiticus, truando toad, toad2018-09-09v4No1 / 121
718amnon high in hypolimnion compared to epilimnion in united states of america state of wisconsin polymictic lake bog lake freshwater lake "forestry bog" lake ph 4.5-5 2028-05-23v4No1 / 121
323amnoncommon freq. in shark teeth (common united states of america, dentition, atlantic ocean, state of florida, south florida, shark)2018-04-24v4No1 / 123
425amnoncommon homo sapiens, duodenum, child, africa, madagascar, antananarivo2018-12-08v4No1 / 123
539amnon high in ensete ventricosum var. gena compared to ensete ventricosum var. ketishe in ethiopia late timepoint ensete ventricosum ethiopian banana days 30-60 anaerobic fermentation food (fermented) 2019-07-31v4No1 / 123
590amnoncommon in turtle pond water (common farm, water, pond water, china, hainan autonomous prefecture, turtle farm)2020-02-10v4No1 / 127
113amnon high in larval stage compared to adult in united states of america research facility intestine danio rerio zebra fish 2017-04-10v4No1 / 128
280amnoncommon coral reef, atlantic ocean, portuguese republic, depth 20m, eunicella labiata, gorgonian coral, coral2018-01-25v4No1 / 128
199amnoncommon in kitchen sink (common united states of america, building, urban biome, kitchen, sink)2017-10-01v4No1 / 130
108amnoncommon united states of america, research facility, colon, state of texas, anaxyrus terrestris, southern toad2017-04-07v4No1 / 132
417amnon high in winter china compared to mongolia summer in feces anser cygnoides bird swan goose 2018-12-01v4No1 / 132
176amnoncommon in skin of hairless mice (common united states of america, female, research facility, dorsum, mus musculus, skin, mouse, skh-1 hairless mouse)2017-07-29v4No1 / 133
353amnonhigher in captive compared to wild caught Lissotriton vulgaris newts skin ( high in research facility compared to wild in skin adult cambridgeshire newt triturus cristatus united kingdom )2018-07-30v4No1 / 135
374amnoncommon skin, costa rica, frog, amphibia, craugastor fitzingeri, common rain frog2018-09-09v4No1 / 136
615amnon high in stem upper stem stem surface compared to leaf leaf surface in brazil greenhouse exosphere campinas saccharum sugarcane 2020-04-27v4No1 / 143
291amnoncommon nasal cavity, pair of nares, canis lupus familiaris, germany, dog2018-02-01v4No1 / 144
29amnoncommon brassica oleracea, french republic, seed2016-12-05v4No1 / 146
241amnonhigher in babies from russia compared to estonia ( high in russia compared to estonia in feces homo sapiens infant age < 3 years )2017-11-13v4No1 / 146
85amnoncommon digestive system, sea water, litopenaeus vannamei, shenzhen city prefecture, pacific white shrimp, china2017-03-06v4No1 / 147
475amnoncommon in air next to subway stations in hong kong (common city, air, hong kong)2019-01-20v4No1 / 147
108amnon high in colon compared to caecum in united states of america research facility state of texas quail coturnix coturnix 2017-04-07v4No1 / 157
515amnoncommon poland, whole body, plant, beetle, nida basin, herbivorous beetle, crioceris duodecimpunctata2019-04-18v4No1 / 157
461amnonhigher in early compared to late timepoints in chitin beads incubated in ocean water ( high in early timepoints compared to late timepoints in united states of america water surface water sea water coastal water atlantic ocean commonwealth of massachusetts chitin beads )2019-01-12v4No1 / 160
209amnoncommon in whale blow condensate (common respiratory airway, north america, megaptera novaeangliae, humpback whale, exhaled air condensate, whale blow)2017-10-15v4No1 / 161
475amnoncommon in air in subway train in hong kong (common city, air, hong kong, subway)2019-01-20v4No1 / 161
539amnoncommon ethiopia, late timepoint, ensete ventricosum, ethiopian banana, days 30-60, anaerobic fermentation, food (fermented)2019-07-31v4No1 / 161
121amnonhigh in diarrhea compared to recovery period ( high in diarrhea compared to control in feces homo sapiens adult bangladesh )2017-04-13v4No1 / 162
322amnon high in adult compared to tadpole in digestive system united states of america research facility state of florida frog osteopilus septentrionalis 2018-04-23v4No1 / 163
486amnoncommon ocean, sediment, oil seep, pacific ocean, state of oregon, depth 500-1000m, carbonate, lithified carbonate blocks, hydrate ridge, active methane seep2019-02-19v4No1 / 163
232amnoncoomon in foot of healthy controls (common homo sapiens, skin, foot, australia)2017-11-05v4No1 / 166
106amnoncommon homo sapiens, dentition, germany, subgingival plaque, mouth2017-04-05v4No1 / 167
323amnoncommon in shark cloaca (common united states of america, anal canal, atlantic ocean, state of florida, south florida, shark)2018-04-24v4No1 / 167
374amnoncommon skin, costa rica, frog, amphibia, craugastor bransfordii, bransford’s litter frog2018-09-09v4No1 / 171
534amnoncommon river, water, fresh water, nepal, free floating, depth 10 cm, filtered 0.2um, koshi river2019-07-22v4No1 / 172
99amnoncommon united states of america, mucus, skin, commonwealth of virginia, anaxyrus americanus, american toad2017-04-02v4No1 / 176
403amnon high in winter compared to summer in air kingdom of spain pyrenees autumn 2018-11-18v4No1 / 176
499amnoncommon digestive system, pond, intestine, tadpole, brazil, frog, scinax fuscovarius2019-03-05v4No1 / 176
530amnoncommon feces, farm, hunan province, adula, snake, deinagkistrodon acutus, pit viper, snake farm, china2019-07-21v4No1 / 178
718amnoncommon united states of america, state of wisconsin, meromictic lake, epilimnion, bog lake, freshwater lake, "hells kitchen" lake2028-05-23v4No1 / 179
536amnoncommon united states of america, skin, pantherophis obsoletus, snake, southern united states, black rat snake, arboreal snake2019-07-28v4No1 / 184
402amnon high in zone 1 compared to zone 2,3 in mine tailing sediment soil guangxi zhuang autonomous region alkaline mine tailing china 2018-11-18v4No1 / 189
75amnoncommon homo sapiens, arm, skin, venezuela, amerindian, hunter gatherer2017-02-27v4No1 / 190
80amnon high in dry forest compared to tropical moist broadleaf forest biome in feces state of florida central america alouatta pigra howler monkey 2017-03-03v4No1 / 193
109amnon high in water treatment plant compared to distribution system in united states of america water drinking water site c 2017-04-08v4No1 / 193
534amnoncommon river, tributary, water, fresh water, nepal, depth 10 cm, filtered 2.7um, particle bound, koshi river2019-07-22v4No1 / 193
170amnoncommon united states of america, river, stream, water, fresh water, depth 10 cm2017-07-24v4No1 / 194
371amnoncommon homo sapiens, skin, venezuela, amerindian, hunter gatherer2018-09-06v4No1 / 195
371amnonlower in skin of amerindians compared to western visitors ( high in united states of america city compared to venezuela amerindian hunter gatherer in homo sapiens skin )2018-09-06v4No1 / 195
600sheryoIncearses after 12 days of stover ammendment in soil ( high in day 12 compared to day 1 in united states of america soil state of new york depth 0-5cm ph 6 coarse-loamy soil stover ammendment soil )2020-03-27v4No1 / 196
620amnoncommon feces, gorilla gorilla, wild, republic of congo, nouabale-ndoki national park2020-05-06v4No1 / 196
6amnoncommon homo sapiens, urine, female, pregnancy, state of tennessee2016-10-13v4No1 / 201
360amnoncommon desert, leaf, mexico, guanajuato, agave, agave tequiliana, leaf surface, cultivated environment2018-08-21v4No1 / 210
388amnon high in age 6-10 weeks compared to age 12-19 weeks in united states of america farm tonsil sus scrofa state of michigan pig 2018-11-03v4No1 / 210
323amnoncommon in shark skin (common united states of america, skin, atlantic ocean, state of florida, south florida, shark)2018-04-24v4No1 / 213
511amnoncommon kingdom of norway, sweden, finland, lapland, depth 0-5cm, snow2019-03-20v4No1 / 213
138amnoncommon in ocean water depth 5m (common ocean, sea water, pacific ocean, depth 5m)2017-04-18v4No1 / 214
360amnon high in summer compared to spring in desert soil rhizosphere state of california mexico 2018-08-21v4No1 / 214
699amnon high in kingdom of spain mediterranean sea italy compared to united states of america atlantic ocean brazil in harbor clavelina oblonga sea squirts inner tunic 2028-04-01v4No1 / 216
545amnoncommon ocean, biofilm, atlantic ocean, debris, depth 200-2000 m2019-08-04v4No1 / 227
499amnoncommon pond, water, fresh water, pond water, brazil2019-03-05v4No1 / 228
331amnon high in dry season compared to wet season in feces ethiopia monkey theropithecus gelada 2018-05-13v4No1 / 232
349amnoncommon feces, research facility, sprague dawley, rattus, male, rat, china2018-07-29v4No1 / 235
342amnoncommon water, surface water, sea water, pacific ocean, philippine sea2018-05-28v4No1 / 236
492amnoncommon skin, adult, rana catesbeiana, bullfrog, frog, lithobates catesbeianus, japan2019-02-27v4No1 / 236
536amnoncommon united states of america, skin, snake, southern united states, agkistrodon contortrix, copperhead snake2019-07-28v4No1 / 236
438amnonhigher in students and soldiers age 19-24 compared to older adults ( high in soldiers young adult stage compared to adult age >94 65-79 year-old human stage fourth decade human stage fifth decade human stage ninth decade human stage tenth decade human stage in feces homo sapiens china )2018-12-30v4No1 / 238
548amnoncommon leaf, brazil, minas gerais state, leaf endosphere, campos rupestres, vellozia epidendroides2019-08-17v4No1 / 243
161amnoncommon in barn swallows in colorado (common feces, united states of america, state of colorado, hirundo rustica, barn swallow)2017-07-12v4No1 / 245
351amnoncommon united states of america, research facility, coelomic fluid, state of florida, eagle harbor, lytechinus variegatus, sea urchin2018-07-30v4No1 / 249
304amnoncommon united states of america, beach, air, aerosol, state of california, pacific ocean, monterey bay2018-03-12v4No1 / 263
253amnoncommon in clouds in puy de dome mountain in france (common air, french republic, autumn, cloud)2017-11-22v4No1 / 267
499amnoncommon digestive system, pond, intestine, brazil, fish, astyanax paranae, astyanax2019-03-05v4No1 / 273
315amnoncommon in frog pond water (common pond, water, fresh water, jiangxi province, hunan province, china)2018-04-10v4No1 / 274
160amnoncommon in river water upstream of WTP effluent in spring in china (common river, water, china, spring)2017-07-12v4No1 / 278
355amnoncommon ocean, pacific ocean, canada, province of british columbia, calvert island, alga, cryptosiphonia woodii, cryptosiphonia2018-08-01v4No1 / 281
423amnoncommon skin, ukraine, bank vole, myodes glareolus2018-12-05v4No1 / 291
37amnoncommon in plastic leaf plants (in field next to tomato plants) (common leaf, maryland county)2016-12-09v4No1 / 298
237amnonlower in burrow soil compared to bird ( high in bird oceanodroma leucorhoa seabird compared to soil burrow in canada bon portage island )2017-11-07v4No1 / 298
78amnon high in male compared to female in feces tropical grassland biome kenya nanger granti gazelle 2017-03-01v4No1 / 301
241amnonhigher in babies from russia compared to finland ( high in russia compared to finland in feces homo sapiens infant age < 3 years )2017-11-13v4No1 / 306
499amnoncommon digestive system, pond, intestine, poecilia reticulata, brazil, fish, guppy2019-03-05v4No1 / 308
515amnoncommon river, poland, whole body, beetle, carnivorous beetle, raba river, bembidion varicolor2019-04-18v4No1 / 308
534amnoncommon river, water, fresh water, nepal, depth 10 cm, filtered 2.7um, particle bound, koshi river2019-07-22v4No1 / 315
618amnoncommon farm, canada, root endosphere, root, cannabis sativa, pre-vegetative stage2020-05-04v4No1 / 318
461amnoncommon united states of america, water, surface water, sea water, coastal water, atlantic ocean, commonwealth of massachusetts2019-01-12v4No1 / 322
342amnoncommon water, sea water, pacific ocean, philippine sea, depth 300m2018-05-28v4No1 / 323
311amnoncommon in floor of kimchi production facility (common united states of america, food processing factory, state of rhode island, floor)2018-04-09v4No1 / 324
471amnon high in adult compared to tadpole in digestive system united states of america research facility state of florida frog osteopilus septentrionalis 2019-01-14v4No1 / 328
338amnonlower in wild salamanders compared to zoo grown salamanders ( high in zoological garden zoo compared to pond area designated as a nature reserve in skin andrias japonicus japanese giant salamander japan )2018-05-21v4No1 / 334
819amnon high in baoding city prefecture high atmospheric pollution compared to dalian city prefecture low atmospheric pollution in homo sapiens female skin adult scalp china age 25-45 years 2021-07-12v1No1 / 337
351amnoncommon in artificial sea water where sea urchins were grown (common united states of america, research facility, sea water, state of florida, lytechinus variegatus, sea urchin, artificial seawater)2018-07-30v4No1 / 338
254amnoncommon river, water, fresh water, fujian province, depth 0.5m, jiulong river, china2017-11-23v4No1 / 347
620amnon high in gorilla gorilla compared to chimpanzee pan troglodytes troglodytes in feces wild republic of congo nouabale-ndoki national park 2020-05-06v4No1 / 351
209amnonhigher in whale blow condensate compared to ocean water ( high in respiratory airway megaptera novaeangliae humpback whale exhaled air condensate whale blow compared to ocean sea water depth 25cm in north america )2017-10-15v4No1 / 359
341amnonhigher in fresh drinking water compared to week old water ( high in fresh water compared to stagnant water in united states of america water drinking water tap water state of illinois )2018-05-28v4No1 / 365
620amnon high in wild republic of congo nouabale-ndoki national park compared to united states of america zoological garden in feces gorilla gorilla gorilla 2020-05-06v4No1 / 368
174amnonhigher farther away from glacier terminus ( high in top of glacier compared to terminus of glacier in united states of america glacier surface denali national park and preserve alaska debris )2017-07-27v4No1 / 369
486amnoncommon ocean, sediment, pacific ocean, state of oregon, depth 500-1000m, carbonate, lithified carbonate blocks, hydrate ridge, low activity methane seep2019-02-19v4No1 / 371
62amnoncommon feces, homo sapiens, united states of america, child, obsolete_juvenile stage2017-02-13v4No1 / 373
582amnon high in external acoustic meatus ear canal compared to rectum perianal skin in united states of america wild santa catalina island urocyon littoralis urocyon littoralis catalinae santa catalina island fox 2020-01-22v4No1 / 374
160amnoncommon in river water upstream of WTP effluent in autumn in china (common river, water, autumn, china)2017-07-12v4No1 / 376
791sheryoCommon in highly saline sodic soil at8 80cm depth in China (common soil, high salinity, china, songnen plain, da'an station, salic solonetz, high sodicity, ph 10, depth (soil) 80cm)2021-06-07v4No1 / 377
29amnon high in seed compared to seedling in brassica oleracea french republic 2016-12-05v4No1 / 379
612amnoncommon united states of america, water, fresh water, state of florida, spring water, location 52020-04-22v4No1 / 383
256amnonhigher in small intestine compared to colon in pigs ( high in duodenum jejunum ileum compared to caecum left colon right colon in sus scrofa pig united kingdom )2017-11-26v4No1 / 387
170amnonhigher in low turbidity river water ( high in turbidity low turbidity compared to high turbidity in united states of america river stream water fresh water depth 10 cm )2017-07-24v4No1 / 395
342amnoncommon water, sea water, pacific ocean, philippine sea, depth 150m2018-05-28v4No1 / 397
722amnon high in surface water sea water compared to sediment marine sediment sediment surface in united states of america estuary state of new york new york city 2021-01-02v4No1 / 399
558amnon high in gizzard compared to crop in united states of america state of wyoming bird centrocercus urophasianus greater sage-grouse 2019-09-20v4No1 / 408
353amnoncommon in wild Lissotriton vulgaris newts skin (common skin, adult, cambridgeshire, newt, lissotriton vulgaris, united kingdom)2018-07-30v4No1 / 418
612amnoncommon united states of america, water, fresh water, state of florida, spring water, location 32020-04-22v4No1 / 420
62amnoncommon feces, homo sapiens, child, egypt, obsolete_juvenile stage2017-02-13v4No1 / 422
504amnoncommon sediment, marine sediment, nan'ao island, china2019-03-14v4No1 / 437
99amnoncommon united states of america, mucus, skin, commonwealth of virginia, pseudacris crucifer, peeper2017-04-02v4No1 / 438
504amnoncommon water, sea water, nan'ao island, china2019-03-14v4No1 / 452
353amnoncommon in wild Triturus cristatus newts skin (common skin, adult, cambridgeshire, newt, triturus cristatus, united kingdom)2018-07-30v4No1 / 456
504amnon high in water sea water compared to sediment marine sediment in nan'ao island china 2019-03-14v4No1 / 462
160amnoncommon in wastewater treatment plant effluent in autumn in china (common wastewater treatment plant, effluent, autumn, china)2017-07-12v4No1 / 469
28amnon high in leaf whole plant compared to feces achatinella mustelina in hawaii 2016-12-05v4No1 / 471
718amnon high in epilimnion compared to hypolimnion in united states of america state of wisconsin dimictic lake bog lake freshwater lake ph 4.5-5 "north sparkling bog" lake 2028-05-23v4No1 / 488
315amnonhigher in frog pond water compared to frog gut ( high in water fresh water compared to digestive system colon frog quasipaa spinosa giant spiny frog in jiangxi province hunan province china )2018-04-10v4No1 / 505
539amnon high in late timepoint days 30-60 anaerobic fermentation compared to early timepoint days 1-15 aerobic fermentation in ethiopia ensete ventricosum ethiopian banana food (fermented) 2019-07-31v4No1 / 510
618amnon high in root endosphere root compared to rhizosphere in farm canada cannabis sativa 2020-05-04v4No1 / 510
304amnoncommon united states of america, beach, air, aerosol, state of california, pacific ocean, santa cruz province2018-03-12v4No1 / 518
612amnoncommon united states of america, water, fresh water, state of florida, spring water, location 12020-04-22v4No1 / 518
515amnoncommon feces, onthophagus taurus, bulgaria, balkan mountains, whole body, beetle, detritivorous beetle2019-04-18v4No1 / 533
352amnon high in small intestine duodenum compared to feces in homo sapiens new delhi india 2018-07-30v4No1 / 545
462amnon high in populus deltoides compared to populus trichocarpa x deltoides in united states of america state of tennessee leaf populus tree cultivated environment 2019-01-13v4No1 / 559
138amnoncommon in ocean water depth 1000m (common ocean, sea water, pacific ocean, depth 1000m)2017-04-18v4No1 / 566
443amnoncommon united states of america, river, water, fresh water, mississippi river, particles, downstream, depth 1m, filtered 2.7um, lower mississippi river2019-01-07v4No1 / 568
254amnon high in summer autumn wet season compared to winter dry season in river water fresh water fujian province depth 0.5m jiulong river china 2017-11-23v4No1 / 571
160amnoncommon in wastewater treatment plant effluent in spring in china (common wastewater treatment plant, effluent, china, spring)2017-07-12v4No1 / 573
254amnon high in summer wet season compared to winter autumn dry season in river water fresh water fujian province depth 0.5m jiulong river china 2017-11-23v4No1 / 581
138amnoncommon in ocean water depth 150-500m (common ocean, sea water, pacific ocean, depth 150-500m)2017-04-18v4No1 / 582
808amnon high in ileum compared to caecum in research facility mucosa gallus gallus germany chicken age 35 weeks hen 2021-06-20v1No1 / 587
146amnon high in rhizosphere compared to soil in united states of america solanum lycopersicum tomato ph 6 slit loam 2017-04-20v4No1 / 590
718amnon high in epilimnion compared to hypolimnion in united states of america state of wisconsin meromictic lake bog lake freshwater lake "hells kitchen" lake 2028-05-23v4No1 / 594
612amnoncommon united states of america, water, fresh water, state of florida, spring water, location 22020-04-22v4No1 / 596
406amnoncommon feces, united states of america, zoological garden, switzerland, diceros bicornis, black rhinoceros2018-11-21v4No1 / 600
425amnon high in duodenum compared to feces in homo sapiens child africa 2018-12-08v4No1 / 622
360amnonhigher in leaf surface compared to soil in agave plants ( high in leaf leaf surface compared to soil in desert state of california mexico guanajuato agave )2018-08-21v4No1 / 645
360amnoncommon desert, leaf, state of california, agave, agave deserti, leaf surface2018-08-21v4No1 / 649
103amnonlower in particle bound fraction compared to free floating bacteria in mississippi river ( high in free floating compared to particles in united states of america river aquatic biome fresh water mississippi river )2017-04-05v4No1 / 653
612amnoncommon united states of america, water, fresh water, state of florida, spring water, location 42020-04-22v4No1 / 655
175amnonhigher in summer compared to winter in heavy metal contaminated soils in china ( high in summer compared to winter in soil heavy metal china )2017-07-29v4No1 / 658
138amnoncommon in ocean water depth 2000-4000m (common ocean, sea water, pacific ocean, depth 2000-4000m)2017-04-18v4No1 / 674
271amnon high in rhizosphere glycine max soybean compared to soil in depth 0-20cm china 2018-01-09v4No1 / 750
206amnoncommon in air from israel particles <10um size (common air, dust, israel, size < 10um, clear day)2017-10-04v4No1 / 765
384amnon high in nasal cavity pair of nares compared to saliva oral cavity mouth in farm equus caballus canada horse 2018-10-22v4No1 / 791
478amnoncommon farm, water, saline water, shrimp farm, china2019-02-19v4No1 / 799
232amnonlower in diabetec foot ulcers compared to non-ulcer skin in diabetic patients ( high in control compared to ulcer wound in homo sapiens skin foot australia diabetes mellitus )2017-11-05v4No1 / 836
517amnon high in arm skin forearm compared to feces in homo sapiens child bolivia chuquisaca department rural community age 5-13 years 2019-05-29v4No1 / 836
265amnoncommon water, canada, province of quebec, soilwater2017-12-11v4No1 / 841
266amnoncommon in roots in JAM garden (common united states of america, state of idaho, plant, brassicaceae, boechera stricta, root)2017-12-19v4No1 / 843
462amnon high in leaf compared to stem in united states of america state of tennessee populus tree cultivated environment 2019-01-13v4No1 / 890
146amnoncommon united states of america, rhizosphere, solanum lycopersicum, tomato, slit loam soil, ph 62017-04-20v4No1 / 894
206amnoncommon in dust storm air from israel particles <10um size (common air, dust, israel, size < 10um, dust storm)2017-10-04v4No1 / 902
767sheryoCommon in soil planted with Chrysanthemum, amended with soil fumigant 'Dazomet' in Nanjing China (common soil, china, nanjing county, chrysanthemum, chrysanthemum morifolium ramat., ph 6.9, soil fumigation, dazomet)2021-04-14v4No1 / 946
37amnonlower in tomato plant leaves compared to plastic control ( high in control compared to solanum lycopersicum in leaf maryland county )2016-12-09v4No1 / 950
517amnon high in arm skin forearm compared to mouth mucosa mouth in homo sapiens child bolivia chuquisaca department rural community age 5-13 years 2019-05-29v4No1 / 1014
478amnoncommon farm, sediment, shrimp farm, china2019-02-19v4No1 / 1085
266amnon high in leaf compared to root in united states of america state of idaho plant brassicaceae boechera stricta 2017-12-19v4No1 / 1175
837sheryoCommon in soil at 40-100cm depth after 30 years reforestation with Black locust trees, shaanxi, China (common soil, silt loam, reforestation, china, shaanxi province, loess plateau, robinia pseudoacacia, depth 40-100cm, 30 years)2021-09-26v4No1 / 1311
837sheryoCommon in soil at 0-40 cm depth after 30 years reforestation with Black locust trees, shaanxi, China (common soil, silt loam, reforestation, china, shaanxi province, loess plateau, robinia pseudoacacia, depth 0-40cm, 30 years)2021-09-26v4No1 / 1346
837sheryoCommon in soil at 100-300cm depth after 30 years reforestation with Black locust trees, shaanxi, China (common soil, silt loam, reforestation, china, shaanxi province, loess plateau, robinia pseudoacacia, depth 100-300cm, 30 years)2021-09-26v4No1 / 1354
808amnon high in mucosa ileal mucosa compared to digesta in research facility ileum gallus gallus germany chicken age 35 weeks hen 2021-06-20v1No1 / 1360
98amnoncommon rhizosphere, state of florida, citrus, gainesville, fl, root2017-04-01v4No1 / 1371
443amnonhigher in lower mississippi river (downstream) compared to upper mississippi river ( high in downstream lower mississippi river compared to upstream upper mississippi river in united states of america river water fresh water mississippi river particles depth 1m filtered 2.7um )2019-01-07v4No1 / 1418
40amnoncommon soil, field soil, rhizosphere, nicotiana tabacum, china2016-12-09v4No1 / 1420
462amnon high in rhizosphere compared to soil in united states of america state of tennessee populus tree cultivated environment 2019-01-12v4No1 / 1428
271amnoncommon rhizosphere, glycine max, soybean, depth 0-20cm, china2018-01-09v4No1 / 1459
4amnoncommon periplaneta americana, digestive system, united states of america2016-10-13v4No1 / 1637
819amnon high in skin of cheek compared to scalp in homo sapiens female skin adult china age 25-45 years 2021-07-12v1No1 / 1684
101amnon high in root compared to rhizosphere in united states of america vitis vinifera state of new york merlot grapevine 2017-04-03v4No1 / 2075
271amnoncommon soil, depth 0-20cm, china2018-01-09v4No1 / 2856
166amnoncommon in river sediment (5cm) without mussels (common united states of america, river, sediment, freshwater biome, mississippi river, depth 5cm, upper mississippi river)2017-07-18v4No1 / 2877
265amnon high in water soilwater compared to soil in canada province of quebec 2017-12-11v4No1 / 3277
837sheryoHigher in soil after 10 years reforestation with Black locust trees compared to agricultural feild, shaanxi, China ( high in reforestation robinia pseudoacacia 10 years compared to zea mays wheat agricultural field in soil silt loam china shaanxi province loess plateau )2021-09-26v4No1 / 3932
837sheryoHigher in soil after 30 years compared to 20 years of reforestation with Black locust trees, shaanxi, China ( high in 30 years compared to 20 years in soil silt loam reforestation china shaanxi province loess plateau robinia pseudoacacia )2021-09-27v4No1 / 3936
462amnon high in rhizosphere compared to root in united states of america state of tennessee populus tree cultivated environment 2019-01-13v4No1 / 4630
837sheryoHigher in soil after 30 years compared to 10 years of reforestation with Black locust trees, shaanxi, China ( high in 30 years compared to 10 years in soil silt loam reforestation china shaanxi province loess plateau robinia pseudoacacia )2021-09-27v4No1 / 5245
837sheryoHigher in soil after 20 years compared to 10 years of reforestation with Black locust trees, shaanxi, China ( high in 20 years compared to 10 years in soil silt loam reforestation china shaanxi province loess plateau robinia pseudoacacia )2021-09-27v4No1 / 5270
837sheryoHigher in soil after 30 years reforestation with Black locust trees compared to agricultural feild, shaanxi, China ( high in reforestation robinia pseudoacacia 30 years compared to zea mays triticum aestivum agricultural field in soil silt loam china shaanxi province loess plateau )2021-09-27v4No1 / 5596
837sheryoHigher in soil after 20 years reforestation with Black locust trees compared agricultural feild, shaanxi, China ( high in reforestation robinia pseudoacacia 20 years compared to zea mays triticum aestivum agricultural field in soil silt loam china shaanxi province loess plateau )2021-09-26v4No1 / 5661
271amnon high in soil rhizosphere compared to root structure root in glycine max soybean depth 0-20cm china 2018-01-09v4No1 / 7954

Problems / suggestions? Please email info AT dbbact DOT org