Search result for sequence:
TACAGAGGGTGCGAGCGTTGTTCGGAATTATTGGGCGTAAAGGGCGCGTAGGCGGTGCCACAAGTCACTTGTGAAATCCCCGGGCTTAACTCGGGGCCTGCAGGCGAAACTGTGGTGCTGGAGTATGGGAGAGGTGCGTGGAATTCCCGG
common ontology terms
term enrichment score
TermScore
soil0.409096
cultivated environment0.194690
alabama0.194690
ultisol0.194690
rhizosphere0.183323
auburn0.177419
dekalb county0.165138
illinois0.165138
topsoil0.161798
paddy field soil0.125000
upland soil0.116505
hapludalf0.116505
alfisol0.116505
state of illinois0.110429
forest ecosystem0.110092
sandy loam0.110092
sandy loam soil0.110092
depth (soil) 0-10cm0.102564
park0.101523
heilongjiang province0.101523
oryza sativa0.100000
minas gerais state0.099010
campos rupestres0.099010
mesocosm0.099010
foot slope 0.099010
agricultural field0.098655
china0.097760
ph 60.094340
depth (soil) 0-20cm0.087848
mollisol0.082474
depth (soil) 25-50cm0.082474
brazil0.081081
peat soil0.080808
glycine max0.079734
zea mays0.079208
state of georgia0.076336
united kingdom0.066225
root0.066116
fen0.062827
soybean0.062827
temperate grassland biome0.061856
yellow brown soil0.061856
coarse-loamy soil0.061856
day 820.061856
oak0.061856
cosumnes river preserve0.061856
sacramento0.061856
flood plain0.061856
ph 50.060914
depth (soil) 0-5cm0.060000
sugarcane0.060000
saccharum0.060000
quercus0.060000
nanjing city prefecture0.058252
depth (soil) 0-30 cm0.058252
farm0.057007
tree0.056604
guangzhou city prefecture0.056604
united states of america0.055951
ph 5-60.055556
silt loam0.055046
woodland area0.048387
state of new york0.046154
LOWER IN rhizosphere0.043478
ph<60.042553
LOWER IN ph&gt;60.042553
cambisol0.042553
depth (soil) 10-25cm0.042553
flooded grassland biome0.042105
central park0.042105
taxus0.042105
taxus mairei0.042105
tomato0.042105
fragaria x ananassa0.042105
strawberry0.042105
vellozia epidendroides0.042105
barbacenia macrantha0.042105
miscanthus0.042105
restored prairie0.042105
kellogg biological station0.042105
mesic type hapludalf0.042105
kalamazoo loam0.042105
maize field0.042105
thyrow0.042105
lettuce0.042105
depth 50-70cm0.042105
depth 12-44cm0.042105
depth 44-108cm0.042105
peatland0.041237
depth 20cm0.041237
ph 6.70.041237
non-fertilized soil0.041237
hunan province0.040816
urban biome0.040404
greenhouse soil0.040404
pot expreiment0.040404
citrus0.039604
state of ohio0.039604
age 1 year0.039604
triticum aestivum0.039216
Fraction of dbbact annotations with this term covered by the query
TermScore
volcan sumaco1.000000
fen0.666667
park0.666667
ph<60.666667
LOWER IN ph&gt;60.666667
soybean0.666667
cambisol0.666667
heilongjiang province0.666667
mollisol0.666667
depth (soil) 10-25cm0.666667
depth (soil) 25-50cm0.666667
field soil0.500000
peat soil0.500000
temperate grassland biome0.500000
flooded grassland biome0.500000
quincy, fl0.500000
ft. pierce, fl0.500000
central park0.500000
taxus0.500000
taxus mairei0.500000
southeast china0.500000
LOWER IN taxus media0.500000
LOWER IN taxus cuspidata0.500000
LOWER IN temperate0.500000
temperate0.500000
tomato0.500000
slit loam soil0.500000
slit loam0.500000
ph 5.40.500000
subpolar coniferous forest biome0.500000
boreal forest0.500000
ph>30.500000
LOWER IN ph&lt;30.500000
montane forest0.500000
red soil0.500000
cultivated environment0.500000
fragaria x ananassa0.500000
strawberry0.500000
yellow brown soil0.500000
LOWER IN age 10 years0.500000
LOWER IN continuous cropping0.500000
populus0.500000
hani peatland0.500000
baekdudaegan0.500000
LOWER IN riganqiao peatland0.500000
LOWER IN ph 5.5-6.50.500000
minas gerais state0.500000
campos rupestres0.500000
vellozia epidendroides0.500000
barbacenia macrantha0.500000
coarse-loamy soil0.500000
day 820.500000
stover ammendment 0.500000
substraat arabidopsis0.500000
lentse potgrond0.500000
LOWER IN cherokia georgiana georgiana0.500000
LOWER IN millipede0.500000
mesocosm0.500000
cherokia georgiana georgiana0.500000
millipede0.500000
miscanthus0.500000
restored prairie0.500000
kellogg biological station0.500000
mesic type hapludalf0.500000
kalamazoo loam0.500000
gastric carcinoma0.500000
stomach neoplasm0.500000
oak0.500000
acute oak decline0.500000
bacillus amyloliquefaciens sqr90.500000
lower saxony0.500000
sandy soil0.500000
maize field0.500000
organic fertilization0.500000
thyrow0.500000
albic luvisol0.500000
ph 6.40.500000
lettuce0.500000
bretagne region0.500000
cosumnes river preserve0.500000
sacramento0.500000
flood plain0.500000
alabama0.500000
upland soil0.500000
ultisol0.500000
depth 50-70cm0.500000
depth 70-100cm0.500000
LOWER IN depth 50-70cm0.500000
LOWER IN depth 70-100cm0.500000
foot slope 0.500000
depth 30-50cm0.500000
depth 50-90cm0.500000
depth 90-100cm0.500000
depth 0-27cm0.500000
dekalb county0.500000
illinois0.500000
depth 27-56cm0.500000
depth 56-116cm0.500000
depth 0-12cm0.500000
hapludalf0.500000
Fraction of annotations for the query sequences containing the term
TermScore
soil0.780220
united states of america0.296703
china0.274725
rhizosphere0.175824
cultivated environment0.120879
alabama0.120879
auburn0.120879
ultisol0.120879
agricultural field0.120879
depth (soil) 0-20cm0.109890
topsoil0.098901
dekalb county0.098901
illinois0.098901
state of illinois0.098901
paddy field soil0.076923
oryza sativa0.076923
depth (soil) 0-10cm0.065934
forest ecosystem0.065934
brazil0.065934
upland soil0.065934
sandy loam0.065934
sandy loam soil0.065934
hapludalf0.065934
alfisol0.065934
united kingdom0.054945
park0.054945
ph 60.054945
heilongjiang province0.054945
minas gerais state0.054945
campos rupestres0.054945
mesocosm0.054945
state of georgia0.054945
foot slope 0.054945
peat soil0.043956
root0.043956
glycine max0.043956
zea mays0.043956
mollisol0.043956
farm0.043956
depth (soil) 25-50cm0.043956
temperate grassland biome0.032967
fen0.032967
tree0.032967
LOWER IN rhizosphere0.032967
soybean0.032967
ph 50.032967
woodland area0.032967
ph 5-60.032967
yellow brown soil0.032967
nanjing city prefecture0.032967
depth (soil) 0-5cm0.032967
state of new york0.032967
coarse-loamy soil0.032967
day 820.032967
sugarcane0.032967
saccharum0.032967
guangzhou city prefecture0.032967
depth (soil) 0-30 cm0.032967
oak0.032967
quercus0.032967
cosumnes river preserve0.032967
sacramento0.032967
state of california0.032967
flood plain0.032967
silt loam0.032967
peatland0.021978
depth 20cm0.021978
flooded grassland biome0.021978
citrus0.021978
state of florida0.021978
urban biome0.021978
new york city0.021978
central park0.021978
ph<60.021978
LOWER IN ph&gt;60.021978
taxus0.021978
taxus mairei0.021978
solanum lycopersicum0.021978
tomato0.021978
LOWER IN root0.021978
state of ohio0.021978
hunan province0.021978
cambisol0.021978
triticum aestivum0.021978
ph 6-70.021978
fragaria x ananassa0.021978
strawberry0.021978
greenhouse soil0.021978
age 1 year0.021978
vellozia epidendroides0.021978
barbacenia macrantha0.021978
depth (soil) 10-25cm0.021978
miscanthus0.021978
restored prairie0.021978
state of michigan0.021978
kellogg biological station0.021978
mesic type hapludalf0.021978
kalamazoo loam0.021978
zhejiang province0.021978
ph 6.70.021978
Exp. ID User ID Description Date Region Flag Sequences
316amnondominant united states of america, soil, topsoil, state of ohio, depth (soil) 0-10cm, ph 5, forest ecosystem2018-04-10v4No1 / 11
823sheryoHigher in 50-70cm depth compared to 70-100cm depth in ultisol soil in auburn, alabama ( high in depth 50-70cm compared to depth 70-100cm in alabama auburn upland soil ultisol agricultural field soil )2021-08-08v3No1 / 127
823sheryoHigher in 25-50cm depth compared to 50-70cm depth in ultisol soil in auburn, alabama ( high in depth (soil) 25-50cm compared to depth 50-70cm in alabama auburn upland soil ultisol agricultural field soil )2021-08-07v3No1 / 161
316amnoncommon united states of america, soil, topsoil, state of ohio, depth (soil) 0-10cm, ph 5, forest ecosystem2018-04-10v4No1 / 199
520amnonhigher in gastric cancer compared to paired normal tissue ( high in gastric carcinoma stomach neoplasm compared to control in homo sapiens zhejiang province stomach adult china )2019-06-26v3No1 / 214
788amnoncommon plant litter, mesocosm, state of georgia, united states of america2021-05-31v4No1 / 259
823sheryoHigher in 25-50cm depth compared to 10-25cm depth in ultisol soil in auburn, alabama ( high in depth (soil) 25-50cm compared to depth (soil) 10-25cm in alabama auburn upland soil ultisol agricultural field soil )2021-08-07v3No1 / 283
512amnon high in hani peatland baekdudaegan ph 5-6 compared to riganqiao peatland tibetan plateau ph 5.5-6.5 in fen peatland peat soil soil china 2019-03-22v4No1 / 363
412amnonlower in pig manured soil with wheat-maize rotation compared to non-manured soil ( high in non-manured soil compared to manured soil in soil hunan province red soil cambisol zea mays triticum aestivum china )2018-11-26v4No1 / 437
829sheryohigher soil depth of 44-108cm compared to 12-44cm in Alfisol soil, Dekalb, Illinois, united states of america ( high in depth 44-108cm compared to depth 12-44cm in sandy loam sandy loam soil hapludalf alfisol united states of america soil state of illinois illinois dekalb county )2021-08-26v3No1 / 442
823sheryoCommon at 70-100cm depth in ultisol soil in auburn, alabama (common depth 70-100cm, alabama, auburn, upland soil, ultisol, agricultural field, soil)2021-08-07v3No1 / 459
964amnoncommon stratovolcano, ph 4-5, soil, depth (soil) 10-25cm, ecuador, volcan sumaco2022-12-21v3No1 / 472
357amnoncommon soil, topsoil, depth (soil) 0-10cm, woodland area, forest ecosystem2018-08-19v4No1 / 474
829sheryoCommon in soil depth of 56-116cm in Mollisol soil, Dekalb, Illinois, united states of america (common depth 56-116cm, dekalb county, illinois, state of illinois, mollisol, silt loam, soil, united states of america)2021-08-26v3No1 / 491
616amnon high in ph 6.7 non-fertilized soil compared to ph 5.5-6 fertilized soil in depth (soil) 0-20cm sugarcane saccharum soil topsoil china guangzhou city prefecture 2020-04-27v3No1 / 504
842sheryoCommon in soil depth of 15-30cm in an old growth forest in Ontario, Canada (common depth 15-30cm, old growth forest, luvisol, grand river watershed, rare charitable research reserve, quercus velutina, quercus alba, quercus rubra, acer saccharum, acer saccharum subsp. nigrum, fagus grandifolia, cambridge, forest, forested area, province of ontario, canada, soil)2021-11-14v3No1 / 507
548amnoncommon minas gerais state, campos rupestres, brazil, barbacenia macrantha, root endosphere, root2019-08-17v4No1 / 575
762sheryoHigh in bulk soil comparedc to rhizosphere of a pot experiment with lettuce planted in haplic luvisol Switzerland ( high in bulk soil compared to rhizosphere in thyrow switzerland haplic luvisol pot expreiment lettuce soil )2021-04-08v3No1 / 577
84amnoncommon soil, peatland, peat soil, sphagnum bog, temperate grassland biome, depth 20cm, wetland area2017-03-06v4No1 / 590
357amnoncommon soil, topsoil, depth (soil) 0-10cm, montane forest, woodland area, forest ecosystem2018-08-19v4No1 / 592
788amnoncommon cherokia georgiana georgiana, millipede, feces, mesocosm, state of georgia, united states of america2021-05-31v4No1 / 607
823sheryoCommon at 50-70cm depth in ultisol soil in auburn, alabama (common depth 50-70cm, alabama, auburn, upland soil, ultisol, agricultural field, soil)2021-08-07v3No1 / 620
698amnoncommon depth (soil) 0-30 cm, depth (soil) 0-20cm, ph 4-4.5, park, london, united kingdom, oak, quercus, rhizosphere2028-04-01v3No1 / 623
548amnoncommon minas gerais state, campos rupestres, brazil, barbacenia macrantha, rhizosphere2019-08-17v4No1 / 651
823sheryoCommon at 25-50cm depth in ultisol soil in auburn, alabama (common depth (soil) 25-50cm, alabama, auburn, upland soil, ultisol, agricultural field, soil)2021-08-07v3No1 / 652
786sheryoHigher at 30-60cm depth compared to 0-30cm depth in flood plain soil near cosumnes river, california ( high in depth 30-60cm compared to depth (soil) 0-30 cm depth (soil) 0-20cm in flood plain soil united states of america state of california sacramento cosumnes river preserve )2021-09-13v3No1 / 675
422amnoncommon soil, paddy field soil, oryza sativa, heilongjiang province, ph 6-7, cultivated environment, china2018-12-04v4No1 / 682
100amnoncommon soil, urban biome, park, new york city, central park2017-04-03v4No1 / 685
829sheryohigher soil depth of 12-44cm compared to 0-12cm in Alfisol soil, Dekalb, Illinois, united states of america ( high in depth 12-44cm compared to depth 0-12cm in sandy loam sandy loam soil hapludalf alfisol united states of america soil state of illinois illinois dekalb county )2021-08-26v3No1 / 692
134amnon high in taxus mairei southeast china subtropical compared to taxus media taxus cuspidata northeast china temperate in rhizosphere tree taxus china 2017-04-16v4No1 / 694
754sheryoCommon in soil planted with cucmber, fertilized with bioorganic fertilizer (Bacillus amyloliquefaciens SQR 9) and infected with Fusarium oxysporum f. sp. cucumerinum (common bacillus amyloliquefaciens sqr9, zhejiang province, cucumber, fusarium oxysporum, bio-organic fertilizer, soil, china)2021-03-15v3No1 / 701
762sheryoCommon in bulk soil of a pot experiment with lettuce planted in organic fertilized albic luvisol from Germany (common manured soil, manure fertilization, germany, organic fertilization, soil, bulk soil, thyrow, albic luvisol, ph 6.4, lettuce, pot expreiment)2021-04-07v3No1 / 704
357amnon high in ph>3 compared to ph<3 in soil topsoil depth (soil) 0-10cm subpolar coniferous forest biome boreal forest woodland area forest ecosystem 2018-08-19v4No1 / 719
829sheryoCommon in soil depth of 12-44m in Alfisol soil, Dekalb, Illinois, united states of america (common depth 12-44cm, sandy loam, sandy loam soil, hapludalf, alfisol, united states of america, soil, state of illinois, illinois, dekalb county)2021-08-26v3No1 / 721
422amnoncommon soil, paddy field soil, oryza sativa, heilongjiang province, ph 5-6, cultivated environment, china2018-12-04v4No1 / 726
829sheryoCommon in soil depth of 0-12m in Alfisol soil, Dekalb, Illinois, united states of america (common depth 0-12cm, sandy loam, sandy loam soil, hapludalf, alfisol, united states of america, soil, state of illinois, illinois, dekalb county)2021-08-26v3No1 / 737
761sheryoCommon in maize rhizosphere sandy soil maize field in Germany (common zea mays, rhizosphere, ph 5, lower saxony, sandy soil, germany, maize field)2021-04-06v3No1 / 742
829sheryoCommon in soil depth of 44-108cm in Alfisol soil, Dekalb, Illinois, united states of america (common depth 44-108cm, sandy loam, sandy loam soil, hapludalf, alfisol, united states of america, soil, state of illinois, illinois, dekalb county)2021-08-26v3No1 / 751
709sheryoCommon in potting mix soil from the Netherlands, substraat arabidopsis, Lentse Potgrond (common substraat arabidopsis, lentse potgrond, soil, potting mix, kingdom of the netherlands)2028-05-16v4No1 / 752
823sheryoCommon at 30-50cm depth in foot slope ultisol soil in auburn, alabama (common depth 30-50cm, foot slope , alabama, auburn, ultisol, agricultural field, soil)2021-08-08v3No1 / 753
823sheryoCommon at 90-100cm depth in foot slope ultisol soil in auburn, alabama (common depth 90-100cm, foot slope , alabama, auburn, ultisol, agricultural field, soil)2021-08-08v3No1 / 782
829sheryoCommon in soil depth of 0-27cm in Mollisol soil, Dekalb, Illinois, united states of america (common depth 0-27cm, dekalb county, illinois, state of illinois, mollisol, silt loam, soil, united states of america)2021-08-26v3No1 / 798
548amnoncommon in endopytic roots of Vellozia epidendroides (common minas gerais state, campos rupestres, brazil, vellozia epidendroides, plant, root)2019-08-15v4No1 / 800
823sheryoCommon at 50-90cm depth in foot slope ultisol soil in auburn, alabama (common depth 50-90cm, foot slope , alabama, auburn, ultisol, agricultural field, soil)2021-08-08v3No1 / 815
422amnoncommon soil, paddy field soil, oryza sativa, yunnan province, china, cultivated environment2018-12-02v4No1 / 821
356amnoncommon in deciduous broad leaved forest top soil in japan (common soil, depth (soil) 0-10cm, hokkaido, topsoil, ph 5.4, japan, forest ecosystem)2018-08-15v4No1 / 834
698amnoncommon depth (soil) 0-30 cm, depth (soil) 0-20cm, ph 5-6, disease, plant disease, acute oak decline, park, united kingdom, oak, quercus, rhizosphere2028-04-01v3No1 / 848
829sheryoCommon in soil depth of 108-140cm in Alfisol soil, Dekalb, Illinois, united states of america (common depth 108-140cm, sandy loam, sandy loam soil, hapludalf, alfisol, united states of america, soil, state of illinois, illinois, dekalb county)2021-08-26v3No1 / 871
786sheryoCommon in flood plain soil near cosumnes river, california, at 60-100cm depth (common depth (soil) 60-100cm, cosumnes river preserve, sacramento, state of california, united states of america, soil, flood plain)2021-05-18v3No1 / 878
788amnoncommon soil, mesocosm, state of georgia, united states of america2021-05-31v4No1 / 897
821sheryoCommon in soil of miscanthus field at 25-50cm depth, Michigan USA (common depth (soil) 25-50cm, miscanthus, restored prairie, united states of america, state of michigan, kellogg biological station, mesic type hapludalf, kalamazoo loam, soil)2021-08-02v4No1 / 901
829sheryoCommon in soil depth of 27-56cm in Mollisol soil, Dekalb, Illinois, united states of america (common depth 27-56cm, united states of america, soil, silt loam, mollisol, state of illinois, illinois, dekalb county)2021-08-26v3No1 / 906
548amnoncommon minas gerais state, campos rupestres, brazil, rock2019-08-17v4No1 / 924
444amnoncommon in uncultivated soil plot (common yellow brown soil, nanjing city prefecture, soil, china)2019-01-07v4No1 / 946
98amnoncommon citrus, rhizosphere, quincy, fl, root, state of florida2017-04-01v4No1 / 950
422amnoncommon soil, paddy field soil, jiangsu province, oryza sativa, china, cultivated environment2018-12-02v4No1 / 957
414amnon high in ph<6 npk fertilizer compared to ph>6 in soil heilongjiang province agricultural feature triticum aestivum glycine max zea mays black soil mollisol china 2018-11-26v4No1 / 963
480amnoncommon soil, pasture, farm, new zealand2019-02-05v4No1 / 970
134amnoncommon rhizosphere, tree, taxus, northeast china, temperate, taxus mairei, china2017-04-16v4No1 / 973
474amnoncommon soil, farm, glycine max, soybean, ph 4-6, brazil, cultivated environment2019-01-16v4No1 / 974
768sheryoCommon in maize fields in Brittany, France (common zea mays, maize field, cambisol, bretagne region, french republic, soil)2021-04-18v3No1 / 1034
548amnoncommon minas gerais state, campos rupestres, brazil, rhizosphere, vellozia epidendroides2019-08-15v4No1 / 1040
422amnoncommon soil, paddy field soil, oryza sativa, heilongjiang province, china, cultivated environment2018-12-02v4No1 / 1049
698amnoncommon depth (soil) 0-30 cm, depth (soil) 0-20cm, control, ph 6-7, park, united kingdom, oak, quercus, rhizosphere2028-04-01v3No1 / 1115
146amnon high in soil compared to rhizosphere in united states of america solanum lycopersicum tomato slit loam ph 6 2017-04-20v4No1 / 1135
146amnoncommon united states of america, solanum lycopersicum, tomato, soil, slit loam soil, ph 62017-04-20v4No1 / 1144
422amnoncommon soil, paddy field soil, oryza sativa, heilongjiang province, ph 7-8, cultivated environment, china2018-12-04v4No1 / 1169
786sheryoCommon in flood plain soil near cosumnes river, california, at 30-60cm depth (common depth (soil) 30-60cm, cosumnes river preserve, sacramento, state of california, united states of america, soil, flood plain)2021-05-18v3No1 / 1180
823sheryoCommon at 0-15cm depth in foot slope ultisol soil in auburn, alabama (common foot slope , depth (soil) 0-15cm, alabama, auburn, ultisol, agricultural field, soil)2021-08-08v3No1 / 1199
823sheryoCommon at 15-30cm depth in foot slope ultisol soil in auburn, alabama (common depth (soil) 15-30cm, foot slope , alabama, auburn, ultisol, agricultural field, soil)2021-08-08v3No1 / 1218
444amnonlower in continuously cropped strawberry soil ( high in age 1 year compared to age 5 years age 10 years continuous cropping in rhizosphere fragaria x ananassa strawberry greenhouse soil farm yellow brown soil nanjing city prefecture china cultivated environment )2019-01-07v4No1 / 1221
616amnoncommon in topsoil of non-fertilized sugarcane field (common depth (soil) 0-20cm, ph 6.7, sugarcane, saccharum, soil, topsoil, china, guangzhou city prefecture, non-fertilized soil)2020-04-27v3No1 / 1277
788amnon high in soil compared to plant litter in mesocosm state of georgia united states of america 2021-05-31v4No1 / 1280
600sheryoCommon in biochar ammended soil after 82 days (common depth (soil) 0-5cm, state of new york, soil, biochar, united states of america, coarse-loamy soil, ph 6, day 82)2020-03-27v4No1 / 1326
600sheryoCommon in stover ammended soil after 82 days (common depth (soil) 0-5cm, state of new york, soil, united states of america, coarse-loamy soil, ph 6, day 82, stover ammendment )2020-03-27v4No1 / 1327
98amnoncommon citrus, rhizosphere, ft. pierce, fl, root, state of florida2017-04-01v4No1 / 1340
821sheryoCommon in soil of miscanthus field at 10-25cm depth, Michigan USA (common depth (soil) 10-25cm, miscanthus, restored prairie, united states of america, state of michigan, kellogg biological station, mesic type hapludalf, kalamazoo loam, soil)2021-08-02v4No1 / 1377
600sheryoCommon in unammended soil after 82 days (common depth (soil) 0-5cm, state of new york, soil, united states of america, coarse-loamy soil, ph 6, day 82)2020-03-27v4No1 / 1395
788amnon high in soil compared to cherokia georgiana georgiana millipede feces in mesocosm state of georgia united states of america 2021-05-31v4No1 / 1395
422amnoncommon soil, paddy field soil, oryza sativa, hunan province, hubei province, china, cultivated environment2018-12-02v4No1 / 1399
40amnoncommon soil, field soil, nicotiana tabacum, rhizosphere, china2016-12-09v4No1 / 1420
444amnoncommon rhizosphere, fragaria x ananassa, strawberry, greenhouse soil, farm, yellow brown soil, nanjing city prefecture, age 1 year, china, cultivated environment2019-01-07v4No1 / 1439
271amnoncommon depth (soil) 0-20cm, rhizosphere, glycine max, soybean, china2018-01-09v4No1 / 1459
616amnoncommon in topsoil of PK/NP/NPK/NK fertilized sugarcane field (common depth (soil) 0-20cm, fertilized soil, ph 5.5-6, sugarcane, saccharum, soil, topsoil, china, guangzhou city prefecture)2020-04-27v3No1 / 1710
271amnoncommon depth (soil) 0-20cm, soil, china2018-01-09v4No1 / 2856
84amnoncommon depth 20cm, soil, temperate grassland biome, fen, peat soil, flooded grassland biome, united kingdom2017-03-06v4No1 / 2866
84amnoncommon depth 5cm, soil, temperate grassland biome, fen, peat soil, flooded grassland biome, united kingdom2017-03-07v4No1 / 3434
462amnon high in rhizosphere compared to root in united states of america state of tennessee populus tree cultivated environment 2019-01-13v4No1 / 4630
271amnon high in soil compared to rhizosphere glycine max soybean in depth (soil) 0-20cm china 2018-01-09v4No1 / 4853
100amnon high in ph ph<6 compared to ph>6 in soil urban biome park new york city central park 2017-04-03v4No1 / 5770
271amnon high in soil rhizosphere compared to root structure root in depth (soil) 0-20cm glycine max soybean china 2018-01-09v4No1 / 7954

Problems / suggestions? Please email info AT dbbact DOT org