dbBact sequence annotation

×

Search result for sequence:

TACAGAGGTCCCAAGCGTTGTTCGGATTCACTGGGCGTAAAGGGTGCGTAGGTGGTGAGGTAAGTCGGATGTGAAATCTCCGAGCTCAACTCGGAAATGGCATTGGAAACTACCTTGCTAGAGGGTTGGAGGGGGGACTGGAATACTTGG

Taxonomy: dBacteria;p"Verrucomicrobia";cSubdivision3;gSubdivision3_genera_incertae_sedis

species	# matches	SILVA IDs

common ontology terms

term enrichment score

Term	Score
park	0.400000
state of idaho	0.375000
boechera stricta	0.363636
central park	0.222222
ph 5.5	0.222222
minas gerais state	0.222222
campos rupestres	0.222222
barbacenia macrantha	0.222222
acute oak decline	0.222222
oak	0.222222
root	0.203390
ph<6	0.200000
LOWER IN ph>6	0.200000
pasture	0.200000
quercus	0.200000
urban biome	0.181818
root endosphere	0.181818
depth (soil) 0-30 cm	0.181818
plant disease	0.181818
new zealand	0.166667
brassicaceae	0.160000
new york city	0.142857
ph 5-6	0.083333
brazil	0.076923
LOWER IN leaf	0.071429
united kingdom	0.064516
soil	0.055556
farm	0.045455
plant	0.042105
depth (soil) 0-20cm	0.041667
rhizosphere	0.037037
ph	0.032787
disease	0.009009
united states of america	0.007653

Fraction of dbbact annotations with this term covered by the query

Term	Score
park	0.666667
central park	0.500000
ph 5.5	0.500000
boechera stricta	0.500000
minas gerais state	0.500000
campos rupestres	0.500000
barbacenia macrantha	0.500000
acute oak decline	0.500000
oak	0.500000
ph<6	0.333333
LOWER IN ph>6	0.333333
state of idaho	0.333333
pasture	0.333333
quercus	0.333333
urban biome	0.250000
root endosphere	0.250000
depth (soil) 0-30 cm	0.250000
plant disease	0.250000
new zealand	0.200000
new york city	0.142857
root	0.133333
brassicaceae	0.111111
ph 5-6	0.058824
brazil	0.052632
LOWER IN leaf	0.047619
united kingdom	0.041667
soil	0.029703
farm	0.027027
depth (soil) 0-20cm	0.024390
plant	0.022727
rhizosphere	0.021277
ph	0.018519
disease	0.004651
united states of america	0.003861

Fraction of annotations for the query sequences containing the term

Term	Score
soil	0.428571
united states of america	0.428571
state of idaho	0.428571
root	0.428571
park	0.285714
brassicaceae	0.285714
boechera stricta	0.285714
plant	0.285714
urban biome	0.142857
new york city	0.142857
central park	0.142857
ph	0.142857
ph<6	0.142857
LOWER IN ph>6	0.142857
ph 5.5	0.142857
LOWER IN leaf	0.142857
pasture	0.142857
farm	0.142857
new zealand	0.142857
minas gerais state	0.142857
campos rupestres	0.142857
brazil	0.142857
barbacenia macrantha	0.142857
root endosphere	0.142857
depth (soil) 0-30 cm	0.142857
depth (soil) 0-20cm	0.142857
ph 5-6	0.142857
disease	0.142857
plant disease	0.142857
acute oak decline	0.142857
united kingdom	0.142857
oak	0.142857
quercus	0.142857
rhizosphere	0.142857

Exp. ID	User ID	Description	Date	Region	Flag	Sequences
548	amnon	common minas gerais state, campos rupestres, brazil, barbacenia macrantha, root endosphere, root	2019-08-17	v4	No	1 / 575
266	amnon	common in roots in JAM garden (common brassicaceae, boechera stricta, plant, united states of america, state of idaho, root)	2017-12-19	v4	No	1 / 843
698	amnon	common depth (soil) 0-30 cm, depth (soil) 0-20cm, ph 5-6, disease, plant disease, acute oak decline, park, united kingdom, oak, quercus, rhizosphere	2028-04-01	v3	No	1 / 848
480	amnon	common soil, pasture, farm, new zealand	2019-02-05	v4	No	1 / 970
266	amnon	common in soil from JAM garden (common soil, united states of america, state of idaho, ph 5.5)	2017-12-18	v4	No	1 / 1456
100	amnon	high in ph ph<6 compared to ph>6 in soil urban biome park new york city central park	2017-04-03	v4	No	1 / 5770
266	amnon	high in root compared to leaf in brassicaceae boechera stricta plant united states of america state of idaho	2017-12-19	v4	No	1 / 5886

Problems / suggestions? Please email info AT dbbact DOT org