Search result for sequence:
TACAGAGGTCCCGAGCGTTGTTCGGATTCACTGGGCGTAAAGGGTGCGTAGGTGGCTTGAAAAGTTTGATGTGAAAGCTCAGGGCTTAACCCTGAAATGGCATTGAATACTGTCGAGCTGGAGGTTTGGAGGGGGGACTGGAATTCTTGG
common ontology terms
term enrichment score
TermScore
soil0.378983
rhizosphere0.174059
triticum aestivum0.169811
ph 60.160920
depth 0-15cm0.160920
grand river watershed0.160920
rare charitable research reserve0.160920
agricultural field0.152381
depth (soil) 0-30 cm0.148148
kellogg biological station0.141176
mesic type hapludalf0.141176
kalamazoo loam0.141176
maize field0.141176
depth (soil) 0-20cm0.134804
cambridge0.129630
state of new york0.128000
province of ontario0.121739
kaiyang county0.120482
guizhou province0.120482
luvisol0.120482
ph 70.116959
ph 7.60.113636
bulk soil0.110497
cultivated environment0.107527
depth (soil) 0-10cm0.107143
kingdom of denmark0.104712
merlot0.098765
grapevine0.098765
coarse-loamy soil0.098765
day 820.098765
restored prairie0.098765
after 6 years0.098765
crop rotation0.098765
bernburg0.098765
dipsacus fullonum0.098765
solidago0.098765
apocynum0.098765
decomissioned agricultural field0.098765
meadow ecosystem0.098765
forested area0.096386
vitis vinifera0.094118
depth (soil) 0-5cm0.094118
daucus carota0.094118
state of michigan0.090226
state of tennessee0.086022
wheat0.086022
park0.077419
orchard0.075949
populus0.075949
miscanthus0.075949
panicum virgatum0.075949
quercus velutina0.075949
quercus alba0.075949
quercus rubra0.075949
acer saccharum0.075949
acer saccharum subsp. nigrum0.075949
fagus grandifolia0.075949
forest0.075949
LOWER IN depth 15-30cm0.075949
state of idaho0.073171
silt loam0.073171
corn0.073171
unamended soil0.073171
luancheng county0.073171
biochar0.070588
root0.068182
LOWER IN root0.068182
fertilized soil0.068182
china0.063907
tree0.058252
united states of america0.056846
united kingdom0.055046
ph 80.052632
tomato0.051948
oak0.051948
lettuce0.051948
flood plain0.051948
sacramento0.051948
cosumnes river preserve0.051948
apricot0.051948
prunus armeniaca0.051948
apennine mountains0.051948
old growth forest0.051948
brunisol0.051948
pasture0.050633
quercus0.050633
haplic luvisol0.050633
depth (soil) 10 cm0.050633
LOWER IN rhizosphere0.050000
canada0.049470
pot expreiment0.049383
depth (water) 10cm0.049383
farm0.046693
solanum lycopersicum0.045977
switzerland0.043956
germany0.039801
ph 7-80.036036
italy0.034188
state of california0.031496
temperate grassland biome0.026667
Fraction of dbbact annotations with this term covered by the query
TermScore
depth (soil) 0-30 cm0.750000
park0.666667
ph 80.666667
temperate grassland biome0.500000
flooded grassland biome0.500000
central park0.500000
merlot0.500000
grapevine0.500000
tomato0.500000
slit loam soil0.500000
ph 60.500000
slit loam0.500000
ph 5.50.500000
boechera stricta0.500000
moist tropical forest0.500000
ph>4.50.500000
LOWER IN ph<4.50.500000
orchard0.500000
reunion island0.500000
LOWER IN detph 30-75cm0.500000
LOWER IN silt clay loam0.500000
populus0.500000
minas gerais state0.500000
campos rupestres0.500000
barbacenia macrantha0.500000
coarse-loamy soil0.500000
day 820.500000
stover ammendment 0.500000
stover amended soil0.500000
temperate rainforest0.500000
olympic national park0.500000
kellogg biological station0.500000
mesic type hapludalf0.500000
kalamazoo loam0.500000
continuous corn0.500000
restored prairie0.500000
miscanthus0.500000
panicum virgatum0.500000
depth (sediment) 0cm0.500000
taihu lake0.500000
taihu national park0.500000
orthic anthrosol0.500000
high biochar0.500000
low biochar0.500000
straw0.500000
maize field0.500000
kaiyang county0.500000
guizhou province0.500000
after 6 years0.500000
oak0.500000
acute oak decline0.500000
oryza rufipogon0.500000
mineral fertilization0.500000
therwil0.500000
lettuce0.500000
thyrow0.500000
crop rotation0.500000
mouldboard plough0.500000
loess chernozem0.500000
bernburg0.500000
cultivator tillage0.500000
maize pre-crop0.500000
rapeseed pre-crop0.500000
chromic cambisol0.500000
bretagne region0.500000
flood plain0.500000
sacramento0.500000
cosumnes river preserve0.500000
LOWER IN litter bag0.500000
apricot0.500000
prunus armeniaca0.500000
apennine mountains0.500000
okinawa islands0.500000
LOWER IN normal weather0.500000
tropical storm0.500000
plough layer 0.500000
late weichselian glaciation0.500000
clayey till0.500000
lund0.500000
LOWER IN depth 30-60cm0.500000
depth 0-15cm0.500000
luvisol0.500000
mature forest0.500000
grand river watershed0.500000
rare charitable research reserve0.500000
quercus velutina0.500000
quercus alba0.500000
quercus rubra0.500000
acer saccharum0.500000
acer saccharum subsp. nigrum0.500000
fagus grandifolia0.500000
forest0.500000
old growth forest0.500000
LOWER IN depth 15-30cm0.500000
dipsacus fullonum0.500000
solidago0.500000
apocynum0.500000
brunisol0.500000
decomissioned agricultural field0.500000
meadow ecosystem0.500000
Fraction of annotations for the query sequences containing the term
TermScore
soil0.808219
united states of america0.356164
china0.205479
rhizosphere0.178082
depth (soil) 0-20cm0.150685
triticum aestivum0.123288
state of new york0.109589
agricultural field0.109589
ph 60.095890
depth 0-15cm0.095890
grand river watershed0.095890
rare charitable research reserve0.095890
cambridge0.095890
province of ontario0.095890
canada0.095890
depth (soil) 0-10cm0.082192
depth (soil) 0-30 cm0.082192
state of michigan0.082192
kellogg biological station0.082192
mesic type hapludalf0.082192
kalamazoo loam0.082192
maize field0.082192
cultivated environment0.068493
kingdom of denmark0.068493
ph 70.068493
bulk soil0.068493
kaiyang county0.068493
guizhou province0.068493
ph 7.60.068493
luvisol0.068493
merlot0.054795
vitis vinifera0.054795
grapevine0.054795
state of tennessee0.054795
depth (soil) 0-5cm0.054795
coarse-loamy soil0.054795
day 820.054795
forested area0.054795
restored prairie0.054795
wheat0.054795
after 6 years0.054795
crop rotation0.054795
bernburg0.054795
germany0.054795
dipsacus fullonum0.054795
solidago0.054795
apocynum0.054795
daucus carota0.054795
decomissioned agricultural field0.054795
meadow ecosystem0.054795
united kingdom0.041096
park0.041096
root0.041096
LOWER IN root0.041096
LOWER IN rhizosphere0.041096
state of idaho0.041096
orchard0.041096
silt loam0.041096
populus0.041096
tree0.041096
farm0.041096
biochar0.041096
corn0.041096
miscanthus0.041096
panicum virgatum0.041096
unamended soil0.041096
quercus velutina0.041096
quercus alba0.041096
quercus rubra0.041096
acer saccharum0.041096
acer saccharum subsp. nigrum0.041096
fagus grandifolia0.041096
forest0.041096
LOWER IN depth 15-30cm0.041096
luancheng county0.041096
fertilized soil0.041096
solanum lycopersicum0.027397
tomato0.027397
pasture0.027397
ph 80.027397
oak0.027397
quercus0.027397
switzerland0.027397
haplic luvisol0.027397
lettuce0.027397
pot expreiment0.027397
flood plain0.027397
state of california0.027397
sacramento0.027397
cosumnes river preserve0.027397
depth (soil) 10 cm0.027397
ph 7-80.027397
apricot0.027397
prunus armeniaca0.027397
apennine mountains0.027397
italy0.027397
old growth forest0.027397
brunisol0.027397
depth (water) 10cm0.027397
depth 5cm0.013699
Exp. ID User ID Description Date Region Flag Sequences
631sheryoHigher in maize field unamended bulk soil, after 6 years of biochar amended, compared to biochar amended soil ( high in unamended soil compared to biochar in china guizhou province kaiyang county soil maize field bulk soil after 6 years )2020-06-02v3No1 / 201
842sheryoCommon in soil depth of 0-15cm in a mature forest in Ontario, Canada (common depth 0-15cm, luvisol, mature forest, grand river watershed, rare charitable research reserve, quercus velutina, quercus alba, quercus rubra, acer saccharum, acer saccharum subsp. nigrum, fagus grandifolia, cambridge, forest, forested area, province of ontario, canada, soil)2021-11-14v3No1 / 460
755sheryocommon in wild rice (Oryza rufipogon) rhizosphere (common oryza rufipogon, ph 7, jilin province, rhizosphere, soil, black soil, china)2021-03-18v3No1 / 530
600sheryohigher in stover ammendment soil ( high in stover amended soil compared to unamended soil in depth (soil) 0-5cm state of new york soil united states of america coarse-loamy soil ph 6 day 82 )2020-03-27v4No1 / 567
548amnoncommon minas gerais state, campos rupestres, brazil, barbacenia macrantha, root endosphere, root2019-08-17v4No1 / 575
762sheryoHigh in bulk soil comparedc to rhizosphere of a pot experiment with lettuce planted in haplic luvisol Switzerland ( high in bulk soil compared to rhizosphere in thyrow switzerland haplic luvisol pot expreiment lettuce soil )2021-04-08v3No1 / 577
842sheryoHigher in soil depth of 0-15cm compared soil depth of 15-30cm in a Decomissioned Agricultural Field in Ontario, Canada ( high in depth 0-15cm compared to depth 15-30cm in dipsacus fullonum solidago apocynum daucus carota brunisol decomissioned agricultural field meadow ecosystem grand river watershed rare charitable research reserve cambridge province of ontario canada soil )2021-11-14v3No1 / 601
786sheryoHigher at 0-30cm depth compared to 30-60cm depth in flood plain soil near cosumnes river, california ( high in depth (soil) 0-30 cm depth (soil) 0-20cm compared to depth 30-60cm in flood plain soil united states of america state of california sacramento cosumnes river preserve )2021-09-13v3No1 / 627
762sheryoCommon in bulk soil of a pot experiment with lettuce planted in npk fertilized haplic luvisol Switzerland (common npk fertilization, mineral fertilization, ph 5.6, therwil, switzerland, haplic luvisol, soil, bulk soil, lettuce, pot expreiment)2021-04-07v3No1 / 648
842sheryoHigher in soil depth of 0-15cm compared to soil depth of 15-30cm in an old growth forest in Ontario, Canada ( high in depth 0-15cm compared to depth 15-30cm in old growth forest luvisol grand river watershed rare charitable research reserve quercus velutina quercus alba quercus rubra acer saccharum acer saccharum subsp. nigrum fagus grandifolia cambridge forest forested area province of ontario canada soil )2021-11-14v3No1 / 653
100amnoncommon soil, urban biome, park, new york city, central park2017-04-03v4No1 / 685
415amnoncommon rhizosphere, soil, citrus, orchard, reunion island, cultivated environment2018-11-27v4No1 / 721
813amnoncommon forested area, temperate rainforest, united states of america, state of washington, olympic national park, soil2021-06-22v4No1 / 740
480amnoncommon soil, pasture, farm, ireland2019-02-05v4No1 / 816
842sheryoCommon in soil depth of 0-15cm in an old growth forest in Ontario, Canada (common depth 0-15cm, old growth forest, luvisol, grand river watershed, rare charitable research reserve, quercus velutina, quercus alba, quercus rubra, acer saccharum, acer saccharum subsp. nigrum, fagus grandifolia, cambridge, forest, forested area, province of ontario, canada, soil)2021-11-14v3No1 / 834
698amnoncommon depth (soil) 0-30 cm, depth (soil) 0-20cm, ph 5-6, disease, plant disease, acute oak decline, park, united kingdom, oak, quercus, rhizosphere2028-04-01v3No1 / 848
854sheryoCommon in soil depth of 25-50cm of colluvial soil, Czech rebuplic (common ph 8, calcic chernozem, czech republic, south moravian region, colluvial soil, depth 25-50cm, soil)2021-12-23v3No1 / 905
480amnoncommon soil, pasture, farm, new zealand2019-02-05v4No1 / 970
462amnoncommon depth (soil) 0-30 cm, depth (soil) 0-20cm, united states of america, state of tennessee, rhizosphere, populus, tree, silt loam, cultivated environment2019-01-13v4No1 / 997
610sheryoCommon in agricultural field soil amended with straw (common straw, triticum aestivum, ph 7, wheat, kingdom of denmark, agricultural field, soil)2020-04-21v3No1 / 998
610sheryoCommon in agricultural field soil amended with low biochar (common low biochar, triticum aestivum, ph 7, wheat, kingdom of denmark, agricultural field, soil)2020-04-21v3No1 / 1009
768sheryoCommon in maize fields in Brittany, France (common zea mays, maize field, cambisol, bretagne region, french republic, soil)2021-04-18v3No1 / 1034
786sheryocommon in flood plain soil near cosumnes river, california, at 0-30cm depth (common depth (soil) 0-30 cm, depth (soil) 0-20cm, flood plain, soil, united states of america, state of california, sacramento, cosumnes river preserve)2021-05-18v3No1 / 1048
610sheryoCommon in agricultural field soil (common triticum aestivum, ph 7, wheat, kingdom of denmark, agricultural field, soil)2020-04-21v3No1 / 1053
610sheryoCommon in agricultural field soil amended with high biochar (common soil, agricultural field, kingdom of denmark, wheat, ph 7, high biochar, triticum aestivum)2020-04-21v3No1 / 1079
842sheryoCommon in soil depth of 0-15cm in a Decomissioned Agricultural Field in Ontario, Canada (common depth 0-15cm, dipsacus fullonum, solidago, apocynum, daucus carota, brunisol, decomissioned agricultural field, meadow ecosystem, grand river watershed, rare charitable research reserve, cambridge, province of ontario, canada, soil)2021-11-14v3No1 / 1082
765sheryocommon in wheat field in the loess plateau in china (common triticum aestivum, ph 7.7, loess plateau, silt loam, chromic cambisol, shanxi province, china, soil)2021-04-12v3No1 / 1087
101amnoncommon state of new york, merlot, vitis vinifera, grapevine, united states of america, root2017-04-03v4No1 / 1106
827sheryoCommon in soil at 25cm depth in clayey till loam soil, Lund Denmark (common depth (soil) 20-30cm, plough layer , loam soil, late weichselian glaciation, clayey till, agricultural field, kingdom of denmark, lund)2021-08-24v3No1 / 1111
698amnoncommon depth (soil) 0-30 cm, depth (soil) 0-20cm, control, ph 6-7, park, united kingdom, oak, quercus, rhizosphere2028-04-01v3No1 / 1115
764sheryocommon in leoss soil in wheat field grown under crop rotation with rapeseed pre-crop in germany (common bernburg, germany, soil, triticum aestivum, crop rotation, ph 7.6, brassica napus, rapeseed pre-crop)2021-04-12v3No1 / 1129
146amnon high in soil compared to rhizosphere in united states of america solanum lycopersicum tomato slit loam ph 6 2017-04-20v4No1 / 1135
764sheryoCommon in leoss soil in wheat field grown under conservation tillage and crop rotation in germany (common ph 7.6, crop rotation, cultivator tillage, conservation tillage, triticum aestivum, soil, germany, bernburg)2021-04-12v3No1 / 1140
146amnoncommon united states of america, solanum lycopersicum, tomato, soil, slit loam soil, ph 62017-04-20v4No1 / 1144
807amnon high in tropical storm compared to normal weather in summer okinawa islands japan filtered 0.2um near shore sea water surface water 2021-06-20v3No1 / 1191
764sheryoCommon in leoss soil in wheat field grown under conventional tillage and crop rotation in germany (common crop rotation, triticum aestivum, ph 7.6, mouldboard plough, conventional tillage, loess chernozem, bernburg, germany, soil)2021-04-12v3No1 / 1213
531amnoncommon rhizosphere, greenhouse soil, farm, orthic anthrosol, cucumis sativus, cucumber, china2019-07-21v3No1 / 1223
764sheryoCommon in leoss soil in wheat field grown under crop rotation with maize pre-crop in germany (common maize pre-crop, ph 7.6, crop rotation, triticum aestivum, soil, germany, bernburg)2021-04-12v3No1 / 1225
798amnoncommon depth (soil) 10 cm, depth (soil) 0-20cm, ph 7-8, soil, orchard, apricot, prunus armeniaca, apennine mountains, italy2021-06-13v3No1 / 1230
855sheryoCommon in soil depth of 10cm in fertilized soil in china (common luancheng county, china, depth (water) 10cm, fertilized soil, agricultural field, soil)2021-12-27v3No1 / 1253
842sheryoCommon in soil depth of 0-15cm in a Decomissioned Agricultural Field in Ontario, Canada (common depth 0-15cm, luvisol, dipsacus fullonum, solidago, apocynum, daucus carota, decomissioned agricultural field, meadow ecosystem, grand river watershed, rare charitable research reserve, cambridge, province of ontario, canada, soil)2021-11-14v3No1 / 1281
798amnon high in ph 7-8 soil compared to hay plant litter litter bag in depth (soil) 10 cm depth (soil) 0-20cm orchard apricot prunus armeniaca apennine mountains italy 2021-06-13v3No1 / 1285
821sheryoCommon in soil of restored prairie at 0-10cm depth, Michigan USA (common ph 6.5, depth (soil) 0-10cm, restored prairie, united states of america, state of michigan, kellogg biological station, mesic type hapludalf, kalamazoo loam, soil)2021-07-28v4No1 / 1291
600sheryoCommon in biochar ammended soil after 82 days (common depth (soil) 0-5cm, state of new york, soil, biochar, united states of america, coarse-loamy soil, ph 6, day 82)2020-03-27v4No1 / 1326
600sheryoCommon in stover ammended soil after 82 days (common depth (soil) 0-5cm, state of new york, soil, united states of america, coarse-loamy soil, ph 6, day 82, stover ammendment )2020-03-27v4No1 / 1327
821sheryoCommon in soil of continuous corn field at 0-10cm depth, Michigan USA (common united states of america, state of michigan, kellogg biological station, ph 5.9, mesic type hapludalf, kalamazoo loam, depth (soil) 0-10cm, continuous corn, corn, soil)2021-07-28v4No1 / 1380
821sheryoHigher at 0-10cm depth compared to 10-25cm depth in soil in Michigan USA ( high in depth (soil) 0-10cm compared to depth (soil) 10-25cm in restored prairie corn miscanthus panicum virgatum kellogg biological station mesic type hapludalf kalamazoo loam state of michigan soil united states of america )2021-08-05v4No1 / 1383
266amnoncommon in soil from SIL garden (common soil, united states of america, state of idaho, ph 6)2017-12-18v4No1 / 1389
600sheryoCommon in unammended soil after 82 days (common depth (soil) 0-5cm, state of new york, soil, united states of america, coarse-loamy soil, ph 6, day 82)2020-03-27v4No1 / 1395
462amnon high in rhizosphere compared to soil in united states of america state of tennessee populus tree cultivated environment 2019-01-12v4No1 / 1428
821sheryoCommon in soil of miscanthus field at 0-10cm depth, Michigan USA (common depth (soil) 0-10cm, miscanthus, restored prairie, united states of america, state of michigan, kellogg biological station, mesic type hapludalf, kalamazoo loam, soil)2021-07-28v4No1 / 1447
266amnoncommon in soil from JAM garden (common soil, united states of america, state of idaho, ph 5.5)2017-12-18v4No1 / 1456
631sheryoCommon in maize field biochar amended rhizosphere soil (common ph 7.85, biochar, rhizosphere, china, guizhou province, kaiyang county, soil, maize field, after 6 years)2020-06-02v3No1 / 1492
855sheryoHigher in soil depth of 75cm compared to soil depth of 175cm in fertilized soil in china ( high in depth 75cm compared to depth 175cm in luancheng county china agricultural field fertilized soil soil )2021-12-27v3No1 / 1522
101amnon high in rhizosphere compared to root in state of new york vitis vinifera united states of america merlot grapevine 2017-04-03v4No1 / 1588
631sheryocommon in maize field unamended rhizosphere soil (common unamended soil, ph 7.6, rhizosphere, china, guizhou province, kaiyang county, soil, maize field, after 6 years)2020-06-02v3No1 / 1637
462amnon high in depth (soil) 0-30 cm depth (soil) 0-20cm silt loam compared to detph 30-75cm silt clay loam in soil united states of america state of tennessee cultivated environment 2019-01-12v4No1 / 1648
855sheryoHigher in soil depth of 10cm compared to soil depth of 75cm in fertilized soil in china ( high in depth (water) 10cm compared to depth 75cm in luancheng county china agricultural field fertilized soil soil )2021-12-27v3No1 / 1678
821sheryoHigher at 10-25cm depth compared to 25-50cm depth in soil in Michigan USA ( high in depth (soil) 10-25cm compared to depth (soil) 25-50cm in restored prairie corn miscanthus panicum virgatum kellogg biological station mesic type hapludalf kalamazoo loam state of michigan soil united states of america )2021-08-05v4No1 / 1704
842sheryoHigher in soil depth of 0-15cm compared to 15-30cm in a Decomissioned Agricultural Field in Ontario, Canada ( high in depth 0-15cm compared to depth 15-30cm in luvisol dipsacus fullonum solidago apocynum daucus carota decomissioned agricultural field meadow ecosystem grand river watershed rare charitable research reserve cambridge province of ontario canada soil )2021-11-14v3No1 / 1723
631sheryoCommon in maize field unamended bulk soil (common bulk soil, unamended soil, ph 7.9, maize field, soil, kaiyang county, guizhou province, china)2020-06-02v3No1 / 1814
901amnon high in sediment surface depth (sediment) 0cm compared to depth (sediment) 0-20cm in taihu lake depth (water) 20-100cm taihu national park china lake sediment 2022-04-25v4No1 / 1819
631sheryocommon in maize field biochar amended bulk soil, after 6 years of biochar amended (common ph 8, china, guizhou province, kaiyang county, soil, maize field, bulk soil, biochar, after 6 years)2020-06-02v3No1 / 1872
101amnoncommon state of new york, vitis vinifera, united states of america, merlot, grapevine, rhizosphere2017-04-03v4No1 / 1980
821sheryoCommon in soil of switchgrass field at 0-10cm depth, Michigan USA (common kellogg biological station, mesic type hapludalf, kalamazoo loam, panicum virgatum, depth (soil) 0-10cm, state of michigan, soil, united states of america)2021-08-02v4No1 / 2067
101amnoncommon state of new york, vitis vinifera, united states of america, merlot, grapevine, soil2017-04-03v4No1 / 2537
357amnon high in ph>4.5 compared to ph<4.5 in soil topsoil depth (soil) 0-10cm moist tropical forest woodland area forest ecosystem 2018-08-18v4No1 / 2773
271amnoncommon depth (soil) 0-20cm, soil, china2018-01-09v4No1 / 2856
84amnoncommon depth 5cm, soil, temperate grassland biome, fen, peat soil, flooded grassland biome, united kingdom2017-03-07v4No1 / 3434
462amnon high in rhizosphere compared to root in united states of america state of tennessee populus tree cultivated environment 2019-01-13v4No1 / 4630
271amnon high in soil compared to rhizosphere glycine max soybean in depth (soil) 0-20cm china 2018-01-09v4No1 / 4853
266amnon high in root compared to leaf in brassicaceae boechera stricta plant united states of america state of idaho 2017-12-19v4No1 / 5886
271amnon high in soil rhizosphere compared to root structure root in depth (soil) 0-20cm glycine max soybean china 2018-01-09v4No1 / 7954

Problems / suggestions? Please email info AT dbbact DOT org