Search result for sequence:
TACAGAGGTCTCAAGCGTTGTTCGGAATCACTGGGCGTAAAGCGTATGTAGGCTGTACGGTAAGTCAGATGTGAAAGCCCAGGGCTCAACCCTGGAACTGCATCCGATACTGCCATACTAGAGTAGTGGAGGGGTATATGGAATTCACGG
common ontology terms
term enrichment score
TermScore
beach0.514286
bodega bay0.320000
state of california0.256410
sand0.238095
zostera marina0.230769
marine eelgrass0.230769
pacific ocean0.196078
haliotis sorenseni0.190476
white abalone0.190476
santa cruz province0.190476
san francisco bay0.190476
hawaii0.181818
monterey bay0.173913
LOWER IN sea water0.148148
marine sediment0.133333
aerosol0.105263
shell0.105263
pearl harbor0.105263
hydroides elegans0.105263
tubeworm0.105263
tubeworm tube0.105263
shore0.105263
santa cruz county0.105263
LOWER IN air0.105263
LOWER IN water0.102564
sea water0.101695
foot0.100000
ocean0.098765
water0.076190
air0.074074
root0.066667
ocean water0.058824
leaf0.055556
sediment0.050000
research facility0.037618
united states of america0.033287
Fraction of dbbact annotations with this term covered by the query
TermScore
haliotis sorenseni0.500000
white abalone0.500000
bodega bay0.500000
beach0.500000
aerosol0.500000
santa cruz province0.500000
shell0.500000
pearl harbor0.500000
hydroides elegans0.500000
tubeworm0.500000
tubeworm tube0.500000
shore0.500000
san francisco bay0.500000
santa cruz county0.500000
LOWER IN air0.500000
hawaii0.400000
foot0.333333
zostera marina0.333333
marine eelgrass0.333333
monterey bay0.333333
sand0.200000
LOWER IN sea water0.200000
marine sediment0.153846
state of california0.150000
pacific ocean0.117647
air0.100000
LOWER IN water0.090909
root0.076923
sea water0.071429
ocean0.062500
ocean water0.058824
leaf0.052632
water0.045455
sediment0.043478
research facility0.021053
united states of america0.017045
Fraction of annotations for the query sequences containing the term
TermScore
state of california0.882353
united states of america0.705882
pacific ocean0.588235
beach0.529412
sand0.294118
bodega bay0.235294
ocean0.235294
water0.235294
research facility0.176471
zostera marina0.176471
marine eelgrass0.176471
sea water0.176471
haliotis sorenseni0.117647
white abalone0.117647
santa cruz province0.117647
monterey bay0.117647
hawaii0.117647
marine sediment0.117647
san francisco bay0.117647
LOWER IN water0.117647
LOWER IN sea water0.117647
foot0.058824
root0.058824
leaf0.058824
air0.058824
aerosol0.058824
shell0.058824
pearl harbor0.058824
hydroides elegans0.058824
tubeworm0.058824
tubeworm tube0.058824
shore0.058824
ocean water0.058824
santa cruz county0.058824
sediment0.058824
LOWER IN air0.058824
Exp. ID User ID Description Date Sequences
308amnoncommon united states of america, state of california, research facility, haliotis sorenseni, white abalone, foot2018-03-301 / 368
236amnoncommon state of california, bodega bay, ocean, zostera marina, marine eelgrass, root2017-11-071 / 483
236amnoncommon state of california, bodega bay, ocean, zostera marina, marine eelgrass, leaf2017-11-071 / 505
304amnoncommon united states of america, state of california, beach, pacific ocean, air, aerosol, santa cruz province2018-03-121 / 518
308amnoncommon united states of america, state of california, research facility, haliotis sorenseni, white abalone, shell2018-03-301 / 632
304amnoncommon united states of america, state of california, beach, pacific ocean, water, sea water, monterey bay2018-03-121 / 667
483amnoncommon hawaii, pearl harbor, research facility, hydroides elegans, tubeworm, united states of america, tubeworm tube2019-02-131 / 683
304amnoncommon united states of america, state of california, beach, pacific ocean, sand, monterey bay2018-03-121 / 1038
93amnoncommon in marine sediment near the shore in hawaii (common hawaii, shore, marine sediment)2017-03-121 / 1151
236amnoncommon ocean, ocean water, state of california, pacific ocean, bodega bay, water2017-11-071 / 1156
304amnoncommon united states of america, state of california, beach, pacific ocean, water, sea water, san francisco bay2018-03-121 / 1166
304amnoncommon united states of america, state of california, beach, pacific ocean, water, sea water, santa cruz county2018-03-121 / 1425
304amnonlower in seawater compared to beach sand ( high in sand compared to water sea water in united states of america state of california beach pacific ocean )2018-03-121 / 1599
304amnoncommon united states of america, state of california, beach, pacific ocean, sand, san francisco bay2018-03-121 / 1799
304amnoncommon united states of america, state of california, beach, pacific ocean, sand, santa cruz province2018-03-121 / 1838
236amnoncommon state of california, bodega bay, ocean, zostera marina, marine eelgrass, sediment, marine sediment2017-11-071 / 1904
304amnonhigher in beach sand compared to sea water and sea spray ( high in sand compared to air water sea water in united states of america beach state of california pacific ocean )2018-03-121 / 2070

Problems / suggestions? Please email info AT dbbact DOT org