Search result for sequence:
TACAGAGGTCTCAAGCGTTGTTCGGAATCACTGGGCGTAAAGCGTGCGTAGGCGGTTTCGTAAGTCGTGTGTGAAAGGCGGGGGCTCAACCCCCGGACTGCACATGATACTGCGAGACTAGAGTAATGGAGGGGGAACCGGAATTCTCGG
common ontology terms
term enrichment score
TermScore
china0.323529
feces0.322251
homo sapiens0.314637
adult0.224748
italy0.188291
infant0.131148
child0.115248
united states of america0.113443
2-5 year-old child stage0.099174
research facility0.095023
age 6 weeks0.093645
control0.090928
kingdom of spain0.076336
male0.072727
germany0.072202
taiwan0.072115
female0.072072
colon0.071685
janvier labs0.070423
indonesia0.070423
municipality of yogyakarta0.070423
guangzhou city prefecture0.069204
fourth decade human stage0.066890
formula fed0.065789
new zealand0.065789
lamb0.065789
crohn's disease0.065789
age0.063191
seattle0.057143
colonized germ free0.057143
finland0.056604
juvenile organism0.055556
milan0.055556
sheep0.054945
c57bl/6j0.054945
12-month-old human stage0.054795
fifth decade human stage0.054054
obsolete_juvenile stage0.052632
ovis aries0.052083
city0.050420
chicken0.048780
gallus gallus0.048193
sprague dawley0.046512
mouse0.046332
republic of china0.043956
green turtle0.043956
chelonia mydas0.043956
autoimmune hepatitis0.043478
zhengzhou city prefecture0.043478
high sugar diet0.043478
age 18 weeks0.043478
sigmoid colon0.043478
mus musculus0.043321
heterosexual0.043011
msw0.043011
remission0.042553
rattus norvegicus0.042553
LOWER IN rural community0.041958
kingdom of denmark0.041667
LOWER IN crohn's disease0.041667
1-year-old human stage0.040816
rat0.039216
sweden0.033898
caecum0.032258
glasgow0.029851
cftr s489x0.029412
adriatic sea coastal waters of italy0.029412
caretta caretta0.029412
loggerhead sea turtle0.029412
sigmoid colon brushing0.029412
coronary heart disease0.029412
non-celiac gluten sensitivity0.029412
induced type 1 diabetes0.029412
taipei city0.029412
jinzhou city prefecture0.029412
LOWER IN small village0.029412
tropical grassland biome0.029412
nanger granti0.029412
gazelle0.029412
dairy goat0.029412
pancreatic cancer0.028986
cystic fibrosis0.028986
clostridium difficile intestinal infectious disease0.028986
colonic mucosa0.028986
juvenile0.028986
shanxi province0.028986
colombia0.028777
13-year-old human stage0.028571
state of minnesota0.028571
systemic lupus erythematosus0.028571
type i diabetes mellitus0.028571
kenya0.028571
state of colorado0.028369
cloaca0.028369
hospital0.028169
LOWER IN jejunum0.028169
jejunum0.028169
cecal content0.027778
mediterranean sea0.027778
2-year-old human stage0.027778
Fraction of dbbact annotations with this term covered by the query
TermScore
china5.500000
glasgow1.000000
mexico1.000000
lima1.000000
taiwan0.750000
colon0.666667
republic of china0.666667
green turtle0.666667
chelonia mydas0.666667
LOWER IN active disease0.500000
LOWER IN bronchitis0.500000
LOWER IN infectious bronchitis virus0.500000
primary progressive multiple sclerosis0.500000
nature reserve0.500000
janvier labs0.500000
seattle0.500000
cftr s489x0.500000
colonized germ free0.500000
autoimmune hepatitis0.500000
zhengzhou city prefecture0.500000
high sugar diet0.500000
age 18 weeks0.500000
valladolid0.500000
adriatic sea coastal waters of italy0.500000
caretta caretta0.500000
loggerhead sea turtle0.500000
before hsct0.500000
after hcst0.500000
hematopoietic stem cell transplant0.500000
sigmoid colon0.500000
sigmoid colon brushing0.500000
denver0.500000
metabolic syndrome x0.500000
coronary heart disease0.500000
non-celiac gluten sensitivity0.500000
indonesia0.500000
municipality of yogyakarta0.500000
graves' disease0.500000
taoyuan city0.500000
tucson0.500000
induced type 1 diabetes0.500000
age 0-6 months0.500000
taipei city0.500000
time 5 days0.500000
fermented cocoa mass0.500000
cocoa mass0.500000
theobroma cacao0.500000
state of tabasco0.500000
aphis gossypii0.500000
cotton aphid0.500000
common bottlenose dolphin0.500000
municipality of reus0.500000
felis silvestris0.500000
wild cat0.500000
LOWER IN age 7 months0.500000
LOWER IN age one week0.500000
amblyrhynchus cristatus0.500000
cloacal swab0.500000
marine iguana0.500000
LOWER IN antiretroviral therapy0.500000
municipality of logrono0.500000
pelagic zone0.500000
gulf of mexico0.500000
LOWER IN wildlife sactuary0.500000
jinzhou city prefecture0.500000
LOWER IN small village0.500000
LOWER IN tunapuco0.500000
shantytown0.500000
LOWER IN el salado0.500000
hirundo rustica0.500000
barn swallow0.500000
milk0.500000
cow milk (fluid)0.500000
cow milk (raw)0.500000
lowland pasture0.500000
lowland farm0.500000
tropical grassland biome0.500000
nanger granti0.500000
gazelle0.500000
age 3-60.500000
age 8-120.500000
LOWER IN himalayas0.500000
LOWER IN age 0-6 months0.500000
sewage0.500000
children0.500000
acidosis0.500000
dairy goat0.500000
subacute rumen acidosis0.500000
lund0.500000
clayey till0.500000
late weichselian glaciation0.500000
depth 200-260cm0.500000
LOWER IN ulcer0.500000
LOWER IN wound0.500000
gopherus polyphemus0.500000
gopher tortoise0.500000
finland0.428571
age 6 weeks0.400000
guangzhou city prefecture0.400000
heterosexual0.400000
Fraction of annotations for the query sequences containing the term
TermScore
feces0.818182
homo sapiens0.659091
adult0.340909
research facility0.212121
united states of america0.189394
china0.166667
control0.128788
italy0.128788
child0.098485
infant0.083333
female0.083333
germany0.075758
mus musculus0.068182
mouse0.068182
male0.060606
2-5 year-old child stage0.060606
age 6 weeks0.053030
kingdom of spain0.045455
formula fed0.037879
ovis aries0.037879
new zealand0.037879
sheep0.037879
lamb0.037879
colon0.037879
crohn's disease0.037879
c57bl/6j0.037879
janvier labs0.037879
guangzhou city prefecture0.037879
fourth decade human stage0.037879
taiwan0.037879
indonesia0.037879
municipality of yogyakarta0.037879
age0.037879
12-month-old human stage0.030303
rattus norvegicus0.030303
sprague dawley0.030303
rat0.030303
gallus gallus0.030303
chicken0.030303
LOWER IN control0.030303
city0.030303
juvenile organism0.030303
finland0.030303
obsolete_juvenile stage0.030303
seattle0.030303
colonized germ free0.030303
milan0.030303
fifth decade human stage0.030303
remission0.022727
caecum0.022727
autoimmune hepatitis0.022727
zhengzhou city prefecture0.022727
high sugar diet0.022727
age 18 weeks0.022727
sigmoid colon0.022727
heterosexual0.022727
msw0.022727
republic of china0.022727
green turtle0.022727
chelonia mydas0.022727
1-year-old human stage0.022727
sweden0.022727
kingdom of denmark0.022727
LOWER IN crohn's disease0.022727
LOWER IN rural community0.022727
israel0.015152
pancreatic cancer0.015152
cecal content0.015152
australia0.015152
colombia0.015152
mouse chow0.015152
13-year-old human stage0.015152
cystic fibrosis0.015152
cftr s489x0.015152
hospital0.015152
clostridium difficile intestinal infectious disease0.015152
mediterranean sea0.015152
adriatic sea coastal waters of italy0.015152
caretta caretta0.015152
loggerhead sea turtle0.015152
state of minnesota0.015152
systemic lupus erythematosus0.015152
colonic mucosa0.015152
sigmoid colon brushing0.015152
glasgow0.015152
state of colorado0.015152
coronary heart disease0.015152
human adult stage0.015152
non-celiac gluten sensitivity0.015152
state of georgia0.015152
juvenile0.015152
type i diabetes mellitus0.015152
induced type 1 diabetes0.015152
taipei city0.015152
LOWER IN under-1-year-old human stage0.015152
2-year-old human stage0.015152
hiv infection0.015152
LOWER IN duodenum0.015152
LOWER IN jejunum0.015152
LOWER IN adult0.015152
Exp. ID User ID Description Date Region Flag Sequences
797amnon high in formula fed compared to breast fed in feces homo sapiens infant germany 12-month-old human stage 2021-06-13v3No1 / 10
649amnondominant research facility, ovis aries, new zealand, sheep, lamb, age 6 weeks, colon2020-09-07v3No1 / 13
713amnon high in remission compared to active disease in feces homo sapiens crohn's disease 2028-05-21v3No1 / 13
831amnondominant feces, homo sapiens, adult, israel, pancreatic cancer2021-09-11v3No1 / 14
584amnondominant feces, control, research facility, rattus norvegicus, sprague dawley, rat, china, male2020-01-31v3No1 / 16
604amnon high in control compared to bronchitis infectious bronchitis virus in research facility caecum gallus gallus chicken cecal content china 2020-04-06v3No1 / 16
663amnondominant feces, homo sapiens, adult, switzerland, low bmi2020-09-22v4No1 / 17
574amnon high in primary progressive multiple sclerosis compared to control in feces homo sapiens adult russia 2020-01-05v3No1 / 17
639amnondominant feces, nature reserve, adult, oryctolagus cuniculus, australia, wild, european rabbit2020-08-21v3No1 / 17
564amnondominant feces, homo sapiens, control, child, italy, 2-5 year-old child stage2019-11-18v3No1 / 18
713amnondominant feces, homo sapiens, remission, crohn's disease2028-05-21v3No1 / 18
404amnondominant feces, homo sapiens, city, adult, colombia2018-11-20v4No1 / 19
477amnondominant feces, homo sapiens, united states of america, adult2019-01-28v4No1 / 19
522amnondominant feces, female, research facility, mus musculus, c57bl/6j, germany, mouse, mouse chow, age 6 weeks, janvier labs2019-07-03v3No1 / 19
45amnonhigh freq. in feces babies <2 years in india (dominant feces, homo sapiens, infant, india)2016-12-19v4No1 / 20
197amnondominant feces, homo sapiens, juvenile organism, finland, obsolete_juvenile stage, 13-year-old human stage2017-09-12v4No1 / 20
238amnondominant feces, homo sapiens, colombia2017-11-07v4No1 / 20
619amnondominant feces, united states of america, research facility, mus musculus, mouse, cystic fibrosis, seattle, cftr s489x, colonized germ free2020-05-04v3No1 / 20
720amnondominant feces, homo sapiens, adult, autoimmune hepatitis, china, zhengzhou city prefecture2028-05-23v3No1 / 20
851amnondominant feces, homo sapiens, adult, italy, milan2021-12-16v3No1 / 20
320amnondominant feces, homo sapiens, adult, crohn's disease2018-04-19v4No1 / 21
591amnondominant feces, homo sapiens, united states of america, adult, parkinson's disease, human late adulthood stage2020-02-17v4No1 / 21
522amnondominant feces, female, research facility, mus musculus, c57bl/6j, germany, mouse, janvier labs, high sugar diet, age 18 weeks2019-07-03v3No1 / 21
728amnondominant feces, homo sapiens, hospital, adult, kingdom of spain, clostridium difficile intestinal infectious disease, clostridium difficile infection, valladolid2021-01-05v3No1 / 21
810amnondominant in sea turtle feces from sea turtle rescue center (dominant feces, research facility, mediterranean sea, italy, adriatic sea coastal waters of italy, caretta caretta, loggerhead sea turtle)2021-06-22v3No1 / 21
835amnondominant feces, homo sapiens, adult, japan2021-09-11v3No1 / 21
185amnonhigh freq. in patients with c. diff infection before treatment (dominant feces, homo sapiens, united states of america, state of minnesota, clostridium difficile intestinal infectious disease)2017-08-20v4No1 / 22
619amnondominant feces, control, united states of america, research facility, mus musculus, mouse, seattle, colonized germ free2020-05-04v3No1 / 22
655amnondominant in patients before hematopoietic stem cell transplant (dominant feces, homo sapiens, italy, before hsct)2020-09-13v3No1 / 22
655amnondominant in patients after hematopoietic stem cell transplant (dominant feces, homo sapiens, italy, after hcst, hematopoietic stem cell transplant)2020-09-13v3No1 / 22
707amnondominant feces, homo sapiens, female, adult, guangzhou city prefecture, systemic lupus erythematosus, china, fourth decade human stage, fifth decade human stage2028-04-11v3No1 / 22
713amnoncommon feces, homo sapiens, remission, crohn's disease2028-05-21v3No1 / 22
851amnondominant homo sapiens, colonic mucosa, sigmoid colon, adult, italy, milan, sigmoid colon brushing2021-12-16v3No1 / 22
73amnondominant feces, homo sapiens, adult, glasgow2017-02-26v4No1 / 23
132amnondominant feces, homo sapiens, united states of america2017-04-16v4No1 / 23
284amnondominant feces, homo sapiens, female, infant, state of california, 12-month-old human stage2018-01-27v4No1 / 23
344amnonhigh freq. in feces of heterosexuals (dominant feces, homo sapiens, united states of america, state of colorado, denver, heterosexual, msw)2018-05-31v4No1 / 23
487amnondominant feces, homo sapiens, united states of america, metabolic syndrome x, metabolic syndrome2019-02-24v4No1 / 23
734amnondominant feces, homo sapiens, adult, taiwan, coronary heart disease, republic of china2021-01-22v3No1 / 23
797amnoncommon feces, homo sapiens, infant, germany, formula fed, 12-month-old human stage2021-06-13v3No1 / 23
843amnondominant feces, adult, italy, human adult stage, non-celiac gluten sensitivity2021-11-17v3No1 / 23
239amnondominant feces, homo sapiens, united states of america2017-11-08v4No1 / 24
641amnoncommon feces, united states of america, research facility, juvenile organism, state of georgia, green turtle, chelonia mydas, juvenile2020-08-23v3No1 / 24
641amnondominant feces, united states of america, research facility, juvenile organism, state of georgia, green turtle, chelonia mydas, juvenile2020-08-23v3No1 / 24
723amnondominant feces, homo sapiens, child, indonesia, municipality of yogyakarta, 2-5 year-old child stage2021-01-02v3No1 / 24
849amnondominant feces, homo sapiens, control, adult, zhejiang province, china, fourth decade human stage2021-12-14v3No1 / 24
707amnondominant feces, homo sapiens, female, adult, guangzhou city prefecture, china, fourth decade human stage, fifth decade human stage2028-04-11v3No1 / 25
796amnondominant feces, homo sapiens, adult, taiwan, graves' disease, republic of china, taoyuan city2021-06-10v3No1 / 25
689amnondominant feces, homo sapiens, united states of america, hospital, adult, non c. diff diarrhea, tucson2028-03-11v4No1 / 26
584amnondominant feces, research facility, rattus norvegicus, sprague dawley, type i diabetes mellitus, rat, china, male, induced type 1 diabetes2020-01-31v3No1 / 26
723amnondominant feces, homo sapiens, infant, child, indonesia, municipality of yogyakarta, age 0-6 months2021-01-02v3No1 / 26
529amnondominant feces, homo sapiens, control, adult, taipei city, taiwan2019-07-18v3No1 / 27
723amnoncommon feces, homo sapiens, child, indonesia, municipality of yogyakarta, 2-5 year-old child stage2021-01-02v3No1 / 30
681amnondominant feces, homo sapiens, adult, seoul, south korea2028-03-04v3No1 / 31
233amnon high in age 1-year-old human stage compared to under-1-year-old human stage in feces homo sapiens united states of america infant 2017-11-05v4No1 / 37
564amnoncommon feces, homo sapiens, autistic disorder, child, italy, 2-5 year-old child stage2019-11-18v3No1 / 42
789amnonlow in unfemented compared to fermented cocoa mass ( high in time 5 days fermented cocoa mass compared to time 0 in mexico cocoa mass theobroma cacao state of tabasco )2021-06-01v3No1 / 43
831amnoncommon feces, homo sapiens, adult, israel, pancreatic cancer2021-09-11v3No1 / 43
241amnonhigher in babies from finland compared to estonia ( high in finland compared to estonia in feces homo sapiens infant age < 3 years )2017-11-13v4No1 / 45
797amnoncommon feces, homo sapiens, child, germany, formula fed, 2-year-old human stage2021-06-13v3No1 / 46
720amnoncommon feces, homo sapiens, adult, autoimmune hepatitis, china, zhengzhou city prefecture2028-05-23v3No1 / 48
564amnoncommon feces, homo sapiens, control, child, italy, 2-5 year-old child stage2019-11-18v3No1 / 50
771amnoncommon body proper, whole body, china, aphis gossypii, cotton aphid2021-04-21v3No1 / 54
578amnon high in sweden compared to kingdom of spain in feces homo sapiens hiv infection adult gay homosexual msm male 2020-01-14v3No1 / 55
707amnoncommon feces, homo sapiens, female, adult, guangzhou city prefecture, systemic lupus erythematosus, china, fourth decade human stage, fifth decade human stage2028-04-11v3No1 / 55
666amnoncommon feces, homo sapiens, italy2020-09-25v3No1 / 58
843amnoncommon feces, adult, italy, human adult stage, non-celiac gluten sensitivity2021-11-17v3No1 / 59
619amnoncommon feces, control, united states of america, research facility, mus musculus, mouse, seattle, colonized germ free2020-05-04v3No1 / 61
851amnoncommon feces, homo sapiens, adult, italy, milan2021-12-16v3No1 / 62
619amnoncommon feces, united states of america, research facility, cystic fibrosis, mus musculus, mouse, seattle, cftr s489x, colonized germ free2020-05-04v3No1 / 64
720amnon high in autoimmune hepatitis compared to control in feces homo sapiens adult china zhengzhou city prefecture 2028-05-23v3No1 / 65
734amnoncommon feces, homo sapiens, adult, taiwan, coronary heart disease, republic of china2021-01-22v3No1 / 66
398amnon high in crohn's disease compared to control in feces homo sapiens belgium 2018-11-15v4No1 / 68
851amnoncommon homo sapiens, colonic mucosa, sigmoid colon, adult, italy, milan, sigmoid colon brushing2021-12-16v3No1 / 71
810amnoncommon in sea turtle feces from sea turtle rescue center (common feces, research facility, mediterranean sea, italy, adriatic sea coastal waters of italy, caretta caretta, loggerhead sea turtle)2021-06-22v3No1 / 72
666amnoncommon feces, tursiops truncatus, italy, rectal swab, common bottlenose dolphin2020-09-25v3No1 / 76
799amnonlower before ketogenic diet compared to after ketogenic diet in obese participants ( high in ketogenic diet compared to control diet in feces homo sapiens obesity adult estonia high bmi )2021-06-13v3No1 / 77
630amnoncommon feces, homo sapiens, adult, kingdom of spain, madrid2020-06-01v3No1 / 78
529amnoncommon feces, homo sapiens, control, adult, taipei city, taiwan2019-07-18v3No1 / 79
732amnoncommon feces, homo sapiens, adult, kingdom of spain, municipality of reus2021-01-11v3No1 / 79
522amnon high in high sugar diet age 18 weeks compared to mouse chow age 6 weeks in feces female research facility mus musculus c57bl/6j germany mouse janvier labs 2019-07-03v3No1 / 81
707amnoncommon feces, homo sapiens, female, adult, guangzhou city prefecture, china, fourth decade human stage, fifth decade human stage2028-04-11v3No1 / 82
666amnoncommon feces, italy, felis silvestris, wild cat2020-09-25v3No1 / 91
578amnoncommon feces, homo sapiens, control, adult, kingdom of spain, sweden, heterosexual, msw, male2020-01-14v3No1 / 92
649amnon high in ileum compared to duodenum jejunum in research facility ovis aries new zealand sheep lamb age 6 weeks 2020-09-07v3No1 / 92
723amnonhigher in children age 2-4 years compared to mothers ( high in child 2-5 year-old child stage compared to adult in feces homo sapiens indonesia municipality of yogyakarta )2021-01-02v3No1 / 95
797amnon high in 12-month-old human stage compared to age 7 months in feces homo sapiens infant germany formula fed 2021-06-13v3No1 / 106
273amnon high in age 1-month-old human stage compared to age one week 1-month-old human stage in feces homo sapiens infant kingdom of denmark 2018-01-14v4No1 / 107
395amnonlower in kids with ibd compared to healthy donors ( high in control compared to child inflammatory bowel disease crohn's disease ulcerative colitis in feces homo sapiens united states of america commonwealth of pennsylvania )2018-11-13v4No1 / 107
740amnoncommon cloaca, ecuador, galapagos islands, alimentary part of gastrointestinal system, amblyrhynchus cristatus, cloacal swab, marine iguana2021-02-08v4No1 / 110
794amnon high in control compared to hiv infection human immunodeficiency virus infectious disease antiretroviral therapy in feces homo sapiens adult kingdom of spain municipality of logrono 2021-06-08v4No1 / 112
522amnoncommon feces, female, research facility, mus musculus, c57bl/6j, germany, mouse, janvier labs, high sugar diet, age 18 weeks2019-07-03v3No1 / 126
779amnon high in control compared to crohn's disease in feces homo sapiens adult guangzhou city prefecture china 2021-04-28v4No1 / 127
649amnoncommon research facility, ovis aries, new zealand, sheep, lamb, age 6 weeks, colon2020-09-07v3No1 / 128
522amnoncommon feces, female, research facility, mus musculus, c57bl/6j, germany, mouse, mouse chow, age 6 weeks, janvier labs2019-07-03v3No1 / 130
288amnoncommon pelagic zone, cloaca, gulf of mexico, summer, green turtle, chelonia mydas2018-01-29v4No1 / 135
197amnoncommon feces, homo sapiens, juvenile organism, finland, obsolete_juvenile stage, 13-year-old human stage2017-09-12v4No1 / 136
63amnon high in female compared to male in homo sapiens skin 2017-02-15v4No1 / 139
797amnon high in child 2-year-old human stage compared to infant 12-month-old human stage in feces homo sapiens germany formula fed 2021-06-13v3No1 / 139
73amnoncommon feces, homo sapiens, adult, glasgow2017-02-26v4No1 / 147
759amnon high in canis lupus familiaris dog compared to canis lupus wolf wildlife sactuary in feces united states of america state of minnesota 2021-04-06v4No1 / 148
780amnon high in small intestine duodenum jejunum compared to caecum in research facility gallus gallus chicken china jinzhou city prefecture 2021-04-28v3No1 / 153
276amnon high in united states of america city state of oklahoma compared to peru small village tunapuco rural community in feces homo sapiens adult 2018-01-22v4No1 / 168
319amnoncommon feces, homo sapiens, united states of america, state of texas2018-04-18v4No1 / 183
604amnoncommon research facility, caecum, gallus gallus, chicken, cecal content, china2020-04-06v3No1 / 185
584amnoncommon feces, research facility, rattus norvegicus, sprague dawley, type i diabetes mellitus, rat, china, male, induced type 1 diabetes2020-01-31v3No1 / 202
578amnonlower in gay (msm) individuals compared to heterosexual (msw) ( high in heterosexual msw compared to gay homosexual msm in feces homo sapiens hiv infection adult kingdom of spain sweden male )2020-01-14v3No1 / 220
584amnoncommon feces, control, research facility, rattus norvegicus, sprague dawley, rat, china, male2020-01-31v3No1 / 221
780amnoncommon research facility, small intestine, duodenum, jejunum, gallus gallus, chicken, china, jinzhou city prefecture2021-04-28v3No1 / 232
53amnon high in lima shantytown compared to el salado small village in feces homo sapiens city 2017-01-21v4No1 / 236
161amnoncommon in barn swallows in colorado (common feces, united states of america, state of colorado, hirundo rustica, barn swallow)2017-07-12v4No1 / 245
617amnoncommon farm, milk, italy, cow milk (fluid), cow milk (raw), lowland pasture, lowland farm2020-05-03v3No1 / 257
78amnonhigher in older gazelles ( high in age old age compared to young age in feces tropical grassland biome kenya nanger granti gazelle )2017-03-01v4No1 / 273
438amnon high in child age 3-6 age 8-12 2-5 year-old child stage 6-12 year-old child stage compared to adult 65-79 year-old human stage fourth decade human stage fifth decade human stage in feces homo sapiens china 2018-12-30v4No1 / 279
477amnon high in united states of america compared to nepal himalayas rural community in feces homo sapiens adult 2019-01-28v4No1 / 295
78amnon high in male compared to female in feces tropical grassland biome kenya nanger granti gazelle 2017-03-01v4No1 / 301
723amnon high in 2-5 year-old child stage compared to infant age 0-6 months in feces homo sapiens child indonesia municipality of yogyakarta 2021-01-02v3No1 / 305
299amnon high in mouth neoplasm cancer compared to control in homo sapiens saliva adult china 2018-02-27v4No1 / 319
400amnonlower in people from thailand compared to 2nd generation immigrants to usa ( high in united states of america compared to thailand rural community in feces homo sapiens )2018-11-18v4No1 / 343
62amnoncommon feces, homo sapiens, united states of america, child, obsolete_juvenile stage2017-02-13v4No1 / 373
62amnoncommon feces, homo sapiens, child, egypt, obsolete_juvenile stage2017-02-13v4No1 / 422
53amnonlower in wastewater plant effluent compared to influent and sewer in south america ( high in sewage influent compared to effluent in city wastewater treatment plant south america )2017-01-21v4No1 / 440
19amnonhigher in controls compared to CD in biopsies ( high in control compared to crohn's disease in homo sapiens united states of america rectum caecum colon sigmoid colon terminal ileum biopsy children )2016-11-14v4No1 / 459
787amnoncommon in high grain diet induced subacute acidosis (common research facility, rumen, ruminal fluid, acidosis, capra hircus, china, shanxi province, goat, dairy goat, subacute rumen acidosis)2021-05-23v3No1 / 463
273amnon high in age 1-year-old human stage compared to 1-month-old human stage in feces homo sapiens infant kingdom of denmark 2018-01-14v4No1 / 557
240amnonlower in infants age<1 year compared to 1-3 years in baby feces ( high in age 1-year-old human stage compared to under-1-year-old human stage in feces homo sapiens infant finland )2017-11-12v4No1 / 567
827sheryoCommon in soil at 230cm depth in clayey till loam soil, Lund Denmark (common kingdom of denmark, agricultural field, lund, loam soil, clayey till, late weichselian glaciation, depth 200-260cm)2021-08-24v3No1 / 644
787amnoncommon control, research facility, rumen, ruminal fluid, capra hircus, china, shanxi province, goat, dairy goat2021-05-23v3No1 / 700
232amnonlower in diabetec foot ulcers compared to non-ulcer skin in diabetic patients ( high in control compared to ulcer wound in homo sapiens skin foot australia diabetes mellitus )2017-11-05v4No1 / 836
649amnon high in colon compared to ileum in research facility ovis aries new zealand sheep lamb age 6 weeks 2020-09-07v3No1 / 897
649amnon high in colon compared to duodenum jejunum in research facility ovis aries new zealand sheep lamb age 6 weeks 2020-09-07v3No1 / 1261
137amnoncommon feces, united states of america, state of florida, gopherus polyphemus, gopher tortoise2017-04-17v4No1 / 1622

Problems / suggestions? Please email info AT dbbact DOT org