Search result for sequence:
TACAGAGGTCTCAAGCGTTGTTCGGAATCACTGGGCGTAAAGCGTGCGTAGGCTGTTTCGTAAGTCGTGTGTGAAAGGCGCGGGCTCAACCCGCGGACGGCACATGATACTGCGAGACTAGAGTAATGGAGGGGGAACCGGAATTCTCGG
common ontology terms
term enrichment score
TermScore
feces0.601439
mouse0.481294
mus musculus0.466541
homo sapiens0.444693
research facility0.409168
united states of america0.352298
c57bl/60.233841
adult0.219094
female0.145455
c57bl/6j0.133630
child0.120000
jackson laboratories0.103093
city0.099197
china0.093352
obsolete_juvenile stage0.089041
infant0.085246
mouse chow0.083916
caecum0.077922
high fat diet0.076878
age 8 weeks0.073579
colon0.073579
male0.073130
canada0.072829
india0.071174
control0.064935
jiangsu province0.063380
diet0.054741
LOWER IN control0.051537
finland0.049587
israel0.048780
texas0.047619
ketogenic diet0.043636
rat0.042796
msw0.036563
heterosexual0.036563
colombia0.036452
swiss webster0.036232
biopsy site0.036232
new delhi0.036232
balb/c0.036232
biopsy0.035907
right colon0.035907
ileum0.035800
kingdom of denmark0.035587
united kingdom0.035587
antibiotic0.035377
kingdom of spain0.035377
state of colorado0.035273
age0.034513
state of oregon0.034364
state of oklahoma0.029412
age >940.029197
south korea0.029197
c57bl/6ncrl0.029197
age 130.029197
rattus norvegicus0.029056
rural community0.029056
LOWER IN high fat diet0.028986
control diet0.028571
LOWER IN feces0.028470
duodenum0.028369
juvenile organism0.028369
kingdom of norway0.028369
japan0.027778
state of california0.026316
metabolic syndrome0.022181
caloric restriction diet0.022181
south america0.022181
schizophrenia0.022059
ldlr-0.022059
f3666 diet0.022059
polydextrose0.022059
high fat diet + polydextrose0.022059
mus musculoides0.022059
nyulmc0.022059
nod/shiltj (no. 001976, jackson labs)0.022059
house mice0.022059
age one year0.022059
coturnix coturnix0.022059
oslo0.022059
denver0.022059
age 3-60.022059
state of rhode island0.022059
wastewater treatment plant0.022059
LOWER IN ulcerative colitis0.021978
clostridium difficile intestinal infectious disease0.021938
state of ohio0.021818
state of washington0.021818
lean body mass0.021818
terminal ileum0.021818
age < 3 years0.021818
rectum0.021818
LOWER IN taconic farms0.021818
diarrhea0.021700
new york city0.021583
small intestine0.021583
switzerland0.021583
LOWER IN mouse chow0.021583
sweden0.021583
age 4 weeks0.021352
Fraction of dbbact annotations with this term covered by the query
TermScore
c57bl/60.733333
mouse0.693878
ketogenic diet0.666667
state of oklahoma0.666667
india0.666667
msw0.666667
heterosexual0.666667
metabolic syndrome0.666667
caloric restriction diet0.666667
LOWER IN gay0.666667
LOWER IN msm0.666667
LOWER IN homosexual0.666667
south america0.666667
mus musculus0.625000
c57bl/6j0.600000
jackson laboratories0.600000
mouse chow0.600000
colombia0.600000
high fat diet0.545455
child0.529412
interferon gamma knockout0.500000
glucose tolerance0.500000
age 9 weeks0.500000
nod mouse0.500000
swiss webster0.500000
schizophrenia0.500000
age >940.500000
jiangsu province0.500000
south korea0.500000
small waist circumference0.500000
LOWER IN waist circumference0.500000
LOWER IN large waist circumference0.500000
ldlr-0.500000
f3666 diet0.500000
biopsy site0.500000
c57bl/6ncrl0.500000
polydextrose0.500000
high fat diet + polydextrose0.500000
mus musculoides0.500000
nyulmc0.500000
nod/shiltj (no. 001976, jackson labs)0.500000
pulsed antibiotic treatment, macrolide tylosin tartrate0.500000
new delhi0.500000
obsolete_juvenile stage0.500000
azerbaijan0.500000
house mice0.500000
atherosclerosis0.500000
daycare0.500000
age 1-5 years0.500000
age 130.500000
age one year0.500000
nzb/w f10.500000
dahl salt-sensitive0.500000
coturnix coturnix0.500000
common quail0.500000
oslo0.500000
age 30-400.500000
age<17 years0.500000
toronto0.500000
glasgow0.500000
age 25 weeks0.500000
LOWER IN age 35 weeks0.500000
estonia0.500000
native american0.500000
cheyenne0.500000
arapaho0.500000
LOWER IN american0.500000
denver0.500000
f1515 diet0.500000
LOWER IN age 9 weeks0.500000
metabolic syndrome x0.500000
commonwealth of pennsylvania0.500000
LOWER IN terminal ileum0.500000
LOWER IN sub-therapeutic antibiotic treatment, penicillin v potassium salt0.500000
LOWER IN obese body mass index status0.500000
LOWER IN db/db mouse0.500000
centererians0.500000
age 3-60.500000
LOWER IN f1515 diet0.500000
LOWER IN age 24 weeks0.500000
quail0.500000
autism spectrum disorder0.500000
poly ic0.500000
malaria0.500000
experimental cerebral malaria0.500000
cefoperazone0.500000
termite0.500000
reticulitermes flaviceps0.500000
LOWER IN wood diet0.500000
LOWER IN normal diet0.500000
eucalyptus viminalis diet0.500000
cape otway0.500000
koala0.500000
phascolarctos cinereus0.500000
eucalyptus obliqua diet0.500000
cabbage0.500000
state of rhode island0.500000
LOWER IN egypt0.500000
age 30 days0.500000
dairy0.500000
Fraction of annotations for the query sequences containing the term
TermScore
feces0.785714
homo sapiens0.481203
united states of america0.469925
research facility0.406015
mus musculus0.372180
mouse0.368421
adult0.169173
c57bl/60.139098
female0.090226
china0.082707
c57bl/6j0.075188
child0.067669
jackson laboratories0.056391
city0.056391
control0.052632
canada0.048872
obsolete_juvenile stage0.048872
infant0.048872
caecum0.045113
mouse chow0.045113
LOWER IN control0.041353
age 8 weeks0.041353
high fat diet0.041353
male0.041353
colon0.041353
india0.037594
jiangsu province0.033835
diet0.030075
finland0.026316
israel0.026316
texas0.026316
ketogenic diet0.022556
rat0.022556
state of oregon0.018797
swiss webster0.018797
biopsy0.018797
biopsy site0.018797
antibiotic0.018797
new delhi0.018797
kingdom of spain0.018797
right colon0.018797
colombia0.018797
kingdom of denmark0.018797
united kingdom0.018797
state of colorado0.018797
msw0.018797
heterosexual0.018797
ileum0.018797
age0.018797
balb/c0.018797
age >940.015038
south korea0.015038
state of oklahoma0.015038
control diet0.015038
c57bl/6ncrl0.015038
duodenum0.015038
age 130.015038
juvenile organism0.015038
rattus norvegicus0.015038
kingdom of norway0.015038
state of california0.015038
japan0.015038
LOWER IN feces0.015038
LOWER IN high fat diet0.015038
rural community0.015038
age 4 weeks0.011278
state of ohio0.011278
schizophrenia0.011278
ldlr-0.011278
state of washington0.011278
f3666 diet0.011278
polydextrose0.011278
high fat diet + polydextrose0.011278
mus musculoides0.011278
nyulmc0.011278
nod/shiltj (no. 001976, jackson labs)0.011278
clostridium difficile intestinal infectious disease0.011278
diarrhea0.011278
lean body mass0.011278
house mice0.011278
new york city0.011278
small intestine0.011278
switzerland0.011278
age one year0.011278
coturnix coturnix0.011278
oslo0.011278
terminal ileum0.011278
age < 3 years0.011278
germany0.011278
denver0.011278
metabolic syndrome0.011278
age 3-60.011278
LOWER IN mouse chow0.011278
caloric restriction diet0.011278
LOWER IN ulcerative colitis0.011278
wild0.011278
food product0.011278
state of rhode island0.011278
rectum0.011278
LOWER IN taconic farms0.011278
Exp. ID User ID Description Date Region Flag Sequences
124amnonhigher in interferon gamma knockout mice ( high in interferon gamma knockout compared to control united states of america in mus musculus mouse caecum feces c57bl/6j )2017-04-14v4No1 / 1
124amnonassociated with glucose tolerance (other mus musculus, mouse, caecum, feces, c57bl/6j, glucose tolerance)2017-04-14v4No1 / 1
217amnonhighfreq mus musculus, mouse, research facility, feces, female, c57bl/62017-10-24v4No1 / 7
435amnonhighfreq mus musculus, mouse, feces, research facility, c57bl/6, female, united states of america, state of oregon, age 4 weeks2018-12-23v4No1 / 7
435amnonhighfreq mus musculus, mouse, feces, research facility, c57bl/6, female, united states of america, state of oregon, age 9 weeks2018-12-23v4No1 / 7
167amnonhighfreq mus musculus, mouse, nod mouse, feces, female, research facility, united states of america2017-07-18v4No1 / 8
516amnoncommon urine, adult, state of ohio, united states of america, homo sapiens2019-05-29v4No1 / 8
538amnonhighfreq jackson laboratories, feces, canada, age 8 weeks, c57bl/6, research facility, mouse, mus musculus2019-07-30v4No1 / 12
405amnonhighfreq mouse, mus musculus, research facility, feces, united states of america, swiss webster, ketogenic diet2018-11-20v4No1 / 13
441amnonhighfreq mus musculus, mouse, c57bl/6j, feces, research facility, united states of america, jackson laboratories2019-01-06v4No1 / 13
502amnon high in schizophrenia compared to control in homo sapiens feces adult united states of america 2019-03-12v4No1 / 13
438amnonhighfreq feces, homo sapiens, china, age >94, adult, jiangsu province2018-12-30v4No1 / 14
74amnonhighfreq united states of america, feces, homo sapiens2017-02-27v4No1 / 15
131amnonnegatively correlated with waist circumference ( high in small waist circumference compared to waist circumference large waist circumference in homo sapiens feces south korea )2017-04-16v4No1 / 15
276amnonhighfreq feces, homo sapiens, united states of america, city, state of oklahoma, adult2018-01-22v4No1 / 15
326amnonhighfreq mus musculus, mouse, c57bl/6, ldlr-, research facility, united states of america, state of washington, high fat diet2018-04-29v4No1 / 15
383amnonhighfreq mus musculus, mouse, feces, research facility, c57bl/6, united states of america, ketogenic diet, f3666 diet2018-10-22v4No1 / 15
405amnonhighfreq mouse, mus musculus, research facility, feces, united states of america, swiss webster, control diet2018-11-20v4No1 / 15
409amnonhighfreq homo sapiens, united states of america, adult, left colon, biopsy, biopsy site2018-11-22v4No1 / 15
435amnoncommon mus musculus, mouse, feces, research facility, c57bl/6, female, united states of america, state of oregon, age 4 weeks2018-12-23v4No1 / 15
457amnonhighfreq mouse, mus musculus, feces, research facility, c57bl/6ncrl, finland, male, polydextrose, high fat diet + polydextrose2019-01-11v4No1 / 15
502amnonhighfreq homo sapiens, feces, adult, united states of america, schizophrenia2019-03-12v4No1 / 15
46amnonsmj: higher in female mice feces treated with antibiotics ( high in antibiotic pulsed antibiotic treatment, macrolide tylosin tartrate compared to control in feces mus musculoides united states of america nyulmc nod/shiltj (no. 001976, jackson labs) research facility female )2017-01-12v4No1 / 16
94amnoncommon homo sapiens, clostridium difficile intestinal infectious disease, feces, state of michigan, diarrhea2017-03-12v4No1 / 16
211amnonHigh freq. in multiple mouse strains feces (highfreq mus musculus, mouse, research facility, united states of america, feces, high fat diet)2017-10-22v4No1 / 16
214amnonhighfreq mouse, mus musculus, feces, united states of america, research facility, high fat diet, c57bl/6j2017-10-23v4No1 / 16
352amnonhighfreq homo sapiens, feces, india, new delhi2018-07-30v4No1 / 16
365amnonhighfreq homo sapiens, feces, child, obsolete_juvenile stage, azerbaijan2018-08-30v4No1 / 16
212amnonhighfreq mouse, mus musculus, feces, research facility, united states of america, lean body mass, control2017-10-22v4No1 / 17
337amnonhigh freq. in feces of house mice from new york city (highfreq mus musculus, house mice, mouse, new york city, united states of america, city)2018-05-18v4No1 / 17
352amnonhigh freq. in duodenal biopsies (highfreq homo sapiens, india, new delhi, duodenum, small intestine)2018-07-30v4No1 / 17
369amnonhighfreq mus musculus, mouse, research facility, switzerland, c57bl/6j, feces, mouse chow2018-09-06v4No1 / 17
207amnonhigh freq. in people hospitalized with diarrhea (highfreq homo sapiens, israel, feces, diarrhea)2017-10-05v4No1 / 18
294amnonhigh freq. in non-IBS healthy controls (highfreq homo sapiens, feces, adult, kingdom of spain, control)2018-02-09v4No1 / 18
538amnonhighfreq right colon, colon, jackson laboratories, canada, age 8 weeks, c57bl/6, research facility, mouse, mus musculus2019-07-30v4No1 / 18
404amnonhighfreq homo sapiens, feces, colombia, city, adult2018-11-20v4No1 / 19
455amnonhighfreq homo sapiens, feces, adult, canada, atherosclerosis2019-01-10v4No1 / 19
482amnonhighfreq homo sapiens, feces, colombia, medellin metropolitan area, child, daycare, age 1-5 years2019-02-12v4No1 / 19
516amnonhighfreq adult, state of ohio, united states of america, feces, homo sapiens2019-05-29v4No1 / 19
45amnonhigh freq. in feces babies <2 years in india (highfreq homo sapiens, feces, india, infant)2016-12-19v4No1 / 20
197amnonhighfreq feces, homo sapiens, obsolete_juvenile stage, age 13, juvenile organism, finland2017-09-12v4No1 / 20
238amnonhighfreq homo sapiens, feces, colombia2017-11-07v4No1 / 20
273amnonhighfreq feces, homo sapiens, kingdom of denmark, infant, age one year2018-01-14v4No1 / 20
368amnonhighfreq feces, united states of america, mouse, mus musculus, research facility, nzb/w f12018-09-03v4No1 / 20
409amnonhighfreq homo sapiens, united states of america, adult, biopsy, biopsy site, right colon2018-11-22v4No1 / 20
429amnonhighfreq rat, rattus norvegicus, dahl salt-sensitive, feces, israel, research facility, control diet2018-12-13v4No1 / 20
108amnonhighfreq research facility, texas, united states of america, caecum, mus musculus, mouse2017-04-07v4No1 / 21
108amnonhighfreq research facility, texas, united states of america, caecum, coturnix coturnix, common quail2017-04-07v4No1 / 21
122amnonhighfreq homo sapiens, feces, united kingdom2017-04-13v4No1 / 21
247amnonhighfreq homo sapiens, italy, feces, obesity, high bmi2017-11-21v4No1 / 21
320amnonhighfreq homo sapiens, feces, adult, crohn's disease2018-04-19v4No1 / 21
330amnonhighfreq homo sapiens, feces, kingdom of norway, oslo, adult, age 30-402018-05-13v4No1 / 21
393amnonhighfreq homo sapiens, feces, united states of america, adult, state of colorado, city, msw, heterosexual2018-11-06v4No1 / 21
94amnonhighfreq homo sapiens, clostridium difficile intestinal infectious disease, feces, state of michigan, diarrhea2017-03-12v4No1 / 22
120amnonhighfreq homo sapiens, feces, brazil2017-04-12v4No1 / 22
185amnonhigh freq. in patients with c. diff infection before treatment (highfreq homo sapiens, feces, united states of america, state of minnesota, clostridium difficile intestinal infectious disease)2017-08-20v4No1 / 22
284amnonhighfreq homo sapiens, adult, female, feces, state of california2018-01-27v4No1 / 22
297amnonhighfreq homo sapiens, feces, obsolete_juvenile stage, age<17 years, united states of america, atlanta, child2018-02-12v4No1 / 22
334amnonhighfreq mus musculus, mouse, feces, israel, research facility, c57bl/62018-05-15v4No1 / 22
538amnon high in feces compared to right colon colon in canada age 8 weeks jackson laboratories c57bl/6 research facility mouse mus musculus 2019-07-29v4No1 / 22
538amnonhighfreq jackson laboratories, terminal ileum, ileum, canada, age 8 weeks, c57bl/6, research facility, mouse, mus musculus2019-07-30v4No1 / 22
10amnonhighfreq homo sapiens, feces, toronto2016-10-27v4No1 / 23
73amnonhighfreq homo sapiens, feces, adult, glasgow2017-02-26v4No1 / 23
132amnonhighfreq homo sapiens, feces, united states of america2017-04-16v4No1 / 23
187amnonnegatively correlated with age 25-35 weeks ( high in early timepoints age 25 weeks compared to late timepoints age 35 weeks age in rat rattus research facility feces wistar rat czech republic )2017-08-23v4No1 / 23
197amnonhighfreq feces, homo sapiens, obsolete_juvenile stage, age 13, juvenile organism, india2017-09-12v4No1 / 23
241amnonhigh freq. in babies age < 3 years in russia (highfreq homo sapiens, feces, infant, russia, age < 3 years)2017-11-13v4No1 / 23
241amnonhigh freq. in babies age < 3 years in estonia (highfreq homo sapiens, feces, infant, age < 3 years, estonia)2017-11-13v4No1 / 23
242amnonhigher in native-americans compared to non native-american ( high in native american cheyenne arapaho compared to american in homo sapiens feces united states of america state of oklahoma )2017-11-14v4No1 / 23
284amnonhighfreq homo sapiens, female, feces, state of california, infant, age 1 year2018-01-27v4No1 / 23
303amnonhighfreq homo sapiens, feces, germany, adult2018-03-12v4No1 / 23
344amnonhigh freq. in feces of heterosexuals (highfreq homo sapiens, feces, united states of america, state of colorado, denver, heterosexual, msw)2018-05-31v4No1 / 23
383amnonhighfreq mus musculus, mouse, feces, research facility, c57bl/6, united states of america, mouse chow, f1515 diet2018-10-22v4No1 / 23
435amnonlower in mice at end of experiment compared to initial sample ( high in age 4 weeks compared to age 9 weeks in feces united states of america female research facility mus musculus c57bl/6 state of oregon mouse )2018-12-23v4No1 / 23
487amnonhighfreq homo sapiens, feces, united states of america, metabolic syndrome, metabolic syndrome x2019-02-24v4No1 / 23
239amnonhighfreq homo sapiens, feces, united states of america2017-11-08v4No1 / 24
330amnonhighfreq homo sapiens, feces, kingdom of norway, oslo, infant, age 1 year2018-05-13v4No1 / 24
395amnonhighfreq homo sapiens, feces, united states of america, commonwealth of pennsylvania, control2018-11-14v4No1 / 24
108amnonhighfreq research facility, texas, united states of america, colon, mus musculus, mouse2017-04-07v4No1 / 25
538amnon high in feces compared to terminal ileum ileum in canada age 8 weeks jackson laboratories c57bl/6 research facility mouse mus musculus 2019-07-29v4No1 / 25
46amnonsmj: lower in control mice feces than treated with antibiotics ( high in control compared to sub-therapeutic antibiotic treatment, penicillin v potassium salt antibiotic in feces mus musculoides united states of america nyulmc nod/shiltj (no. 001976, jackson labs) research facility male )2017-01-12v4No1 / 26
62amnonhighfreq homo sapiens, feces, obsolete_juvenile stage, child, united states of america2017-02-13v4No1 / 26
212amnon high in lean body mass compared to obesity obese body mass index status db/db mouse in mouse mus musculus feces research facility united states of america 2017-10-22v4No1 / 26
131amnonhighfreq homo sapiens, feces, south korea2017-04-16v4No1 / 27
46amnonsmj: higher in mice feces treated with antibiotics ( high in pulsed antibiotic treatment, macrolide tylosin tartrate antibiotic compared to control in feces male mus musculoides united states of america nyulmc nod/shiltj (no. 001976, jackson labs) research facility )2017-01-12v4No1 / 28
36amnonhigher in centernarians ( high in centererians compared to adult in homo sapiens feces sichuan province )2016-12-06v4No1 / 30
435amnoncommon mus musculus, mouse, feces, research facility, c57bl/6, female, united states of america, state of oregon, age 9 weeks2018-12-23v4No1 / 30
438amnonhighfreq homo sapiens, feces, china, jiangsu province, child, age 3-62018-12-30v4No1 / 30
383amnonhigher in feces of ketogenic diet fed mice compared to normal mouse chow ( high in ketogenic diet f3666 diet compared to mouse chow f1515 diet in mus musculus mouse feces research facility c57bl/6 united states of america )2018-10-22v4No1 / 31
458amnonnegatively correlated with age ( high in age 3 weeks compared to age 24 weeks age in mus musculus mouse research facility feces female united states of america )2019-01-11v4No1 / 31
108amnoncommon research facility, texas, united states of america, colon, quail, coturnix coturnix2017-04-07v4No1 / 35
219amnonlower in controls compared to ASD mice (following mother poly IC treatment) ( high in autism spectrum disorder poly ic compared to control in mus musculus mouse feces c57bl/6 male research facility south korea )2017-10-24v4No1 / 36
503amnonincreases following malaria infection ( high in malaria late time points experimental cerebral malaria compared to control early time points in mouse mus musculus research facility c57bl/6 japan feces )2019-03-12v4No1 / 38
352amnoncommon homo sapiens, feces, india, new delhi2018-07-30v4No1 / 41
241amnoncommon in babies age < 3 years in russia (common homo sapiens, feces, infant, russia, age < 3 years)2017-11-13v4No1 / 44
321amnonhigher in mice treated with Metronidazole compared to untreated mice ( high in antibiotic metronidazole compared to control in mus musculus mouse c57bl/6j feces united states of america research facility )2018-04-22v4No1 / 44
273amnoncommon feces, homo sapiens, kingdom of denmark, infant, age one year2018-01-14v4No1 / 46
207amnonlower in people hospitalized with diarrhea compared to healthy controls ( high in control compared to diarrhea in feces homo sapiens israel )2017-10-05v4No1 / 47
441amnonhigher after antibiotic treatment ( high in antibiotic cefoperazone compared to control in mus musculus mouse c57bl/6j feces research facility united states of america )2019-01-06v4No1 / 50
321amnonhigher in mice treated with ampicillin compared to untreated mice ( high in ampicillin antibiotic compared to control in mus musculus mouse c57bl/6j feces united states of america research facility )2018-04-22v4No1 / 52
416amnon high in fasting compared to wood diet in termite reticulitermes flaviceps colon research facility united states of america 2018-11-30v4No1 / 52
369amnonhigher in mice with 40% caloric restriction diet ( high in caloric restriction diet compared to normal diet in mus musculus mouse research facility switzerland c57bl/6j feces mouse chow )2018-09-06v4No1 / 58
214amnoncommon mouse, mus musculus, feces, united states of america, research facility, c57bl/6j, mouse chow2017-10-23v4No1 / 60
214amnoncommon mouse, mus musculus, feces, united states of america, research facility, high fat diet, c57bl/6j2017-10-23v4No1 / 62
502amnoncommon homo sapiens, feces, adult, united states of america, schizophrenia2019-03-12v4No1 / 63
326amnon high in diet high fat diet compared to mouse chow in mus musculus mouse c57bl/6 ldlr- research facility united states of america state of washington 2018-04-29v4No1 / 65
194amnon high in colon ileum compared to feces in homo sapiens kingdom of norway 2017-09-07v4No1 / 67
211amnonCommon in multiple mouse strains feces (common mus musculus, mouse, research facility, united states of america, feces, high fat diet)2017-10-22v4No1 / 68
51amnon high in control compared to hiv infection in homo sapiens feces united states of america 2017-01-19v4No1 / 69
22amnon high in control compared to hiv infection in united states of america feces homo sapiens 2016-11-28v4No1 / 70
394amnon high in control compared to ulcerative colitis in homo sapiens feces adult united states of america state of california 2018-11-06v4No1 / 71
541amnoncommon eucalyptus viminalis diet, cape otway, wild, australia, feces, koala, phascolarctos cinereus2019-08-01v4No1 / 72
516amnoncommon adult, state of ohio, united states of america, feces, homo sapiens2019-05-29v4No1 / 77
541amnoncommon eucalyptus obliqua diet, cape otway, wild, australia, feces, koala, phascolarctos cinereus2019-08-01v4No1 / 77
404amnoncommon homo sapiens, feces, colombia, city, adult2018-11-20v4No1 / 79
383amnoncommon mus musculus, mouse, feces, research facility, c57bl/6, united states of america, ketogenic diet, f3666 diet2018-10-22v4No1 / 81
344amnoncommon in feces of heterosexuals (common homo sapiens, feces, united states of america, state of colorado, denver, heterosexual, msw)2018-05-31v4No1 / 82
311amnoncommon in salted cabbage (common cabbage, food product, united states of america, state of rhode island)2018-04-09v4No1 / 85
405amnon high in ketogenic diet compared to control diet in mouse mus musculus research facility feces united states of america swiss webster 2018-11-20v4No1 / 85
62amnon high in united states of america compared to egypt in homo sapiens feces obsolete_juvenile stage child 2017-02-13v4No1 / 88
487amnoncommon homo sapiens, feces, united states of america, metabolic syndrome, metabolic syndrome x2019-02-24v4No1 / 88
303amnoncommon homo sapiens, feces, germany, adult2018-03-12v4No1 / 93
238amnoncommon homo sapiens, feces, colombia2017-11-07v4No1 / 96
365amnoncommon homo sapiens, feces, child, obsolete_juvenile stage, azerbaijan2018-08-30v4No1 / 97
409amnoncommon homo sapiens, united states of america, adult, biopsy, biopsy site, right colon2018-11-22v4No1 / 97
457amnonhigher in mice fed polydextrose+high fat diet compared to high fat diet ( high in high fat diet + polydextrose polydextrose compared to high fat diet in mouse mus musculus feces research facility c57bl/6ncrl finland male )2019-01-11v4No1 / 97
441amnoncommon mus musculus, mouse, c57bl/6j, feces, research facility, united states of america, jackson laboratories2019-01-06v4No1 / 99
124amnonhigher in ifn-gamma knockout comapred to wt ( high in interferon gamma knockout compared to control in mus musculus mouse caecum feces c57bl/6j united states of america )2017-04-14v4No1 / 100
363amnon high in caecum colon rectum compared to rumen ruminant reticulum omasum in ovis aries age 30 days obsolete_juvenile stage italy dairy 2018-08-29v4No1 / 101
108amnon high in colon compared to caecum in research facility texas united states of america oreochromis niloticus nile tilapia 2017-04-07v4No1 / 103
284amnoncommon homo sapiens, adult, female, feces, state of california2018-01-27v4No1 / 105
344amnonlower in gay (msm) individuals compared to heterosexual (msw) ( high in heterosexual msw compared to gay msm homosexual in homo sapiens feces united states of america state of colorado denver )2018-05-31v4No1 / 106
438amnoncommon homo sapiens, feces, china, jiangsu province, child, age 8-122018-12-30v4No1 / 106
273amnon high in age age one month compared to age one week in feces homo sapiens kingdom of denmark infant 2018-01-14v4No1 / 107
393amnon high in heterosexual msw compared to gay homosexual msm in homo sapiens feces united states of america adult state of colorado city 2018-11-06v4No1 / 107
395amnonlower in kids with ibd compared to healthy donors ( high in control compared to child inflammatory bowel disease crohn's disease ulcerative colitis in homo sapiens feces united states of america commonwealth of pennsylvania )2018-11-13v4No1 / 107
409amnoncommon homo sapiens, united states of america, feces, adult2018-11-22v4No1 / 108
538amnoncommon jackson laboratories, feces, canada, age 8 weeks, c57bl/6, research facility, mouse, mus musculus2019-07-30v4No1 / 108
438amnoncommon homo sapiens, feces, china, jiangsu province, child, age 3-62018-12-30v4No1 / 109
276amnoncommon feces, homo sapiens, united states of america, city, state of oklahoma, adult2018-01-22v4No1 / 110
538amnon high in jackson laboratories compared to taconic farms in feces canada age 8 weeks c57bl/6 research facility mouse mus musculus 2019-07-29v4No1 / 110
438amnoncommon feces, homo sapiens, china, age 60-79, adult, jiangsu province2018-12-30v4No1 / 111
214amnon high in c57bl/6j compared to strain s129 in mouse mus musculus feces united states of america research facility jackson laboratories high fat diet 2017-10-23v4No1 / 113
217amnoncommon mus musculus, mouse, research facility, feces, female, c57bl/62017-10-24v4No1 / 113
438amnoncommon feces, homo sapiens, china, jiangsu province, age 30-50, adult2018-12-30v4No1 / 115
239amnoncommon homo sapiens, feces, united states of america2017-11-08v4No1 / 117
409amnoncommon homo sapiens, united states of america, adult, left colon, biopsy, biopsy site2018-11-22v4No1 / 118
410amnonlower in feces compared to rectal biopsies in children with treatment naive uc ( high in rectum biopsy biopsy site compared to feces in homo sapiens child united states of america ulcerative colitis )2018-11-22v4No1 / 118
212amnoncommon mouse, mus musculus, feces, research facility, united states of america, lean body mass, control2017-10-22v4No1 / 120
383amnoncommon mus musculus, mouse, feces, research facility, c57bl/6, united states of america, mouse chow, f1515 diet2018-10-22v4No1 / 120
311amnoncommon united states of america, state of rhode island, food product, scallion2018-04-09v4No1 / 121
352amnoncommon in duodenal biopsies (common homo sapiens, india, new delhi, duodenum, small intestine)2018-07-30v4No1 / 121
438amnoncommon feces, homo sapiens, china, age >94, jiangsu province, adult2018-12-30v4No1 / 121
326amnoncommon mus musculus, mouse, c57bl/6, ldlr-, research facility, united states of america, state of washington, high fat diet2018-04-29v4No1 / 122
386amnonnegatively correlated with altitude (0-4km) in house mouse caecum ( high in low altitude compared to high altitude in mouse mus musculus caecum wild south america )2018-10-28v4No1 / 122
131amnoncommon homo sapiens, feces, south korea2017-04-16v4No1 / 128
330amnoncommon homo sapiens, feces, kingdom of norway, oslo, adult, age 30-402018-05-13v4No1 / 130
368amnonlower in nzb/w f1 mice late timepoints (SLE model) compared to early timepoints ( high in control early timepoints age 10-18 weeks compared to late timepoints 23-33 weeks systemic lupus erythematosus in feces united states of america mouse mus musculus research facility nzb/w f1 )2018-09-03v4No1 / 132
293amnoncommon feces, homo sapiens, united states of america, adult, cron diet, caloric restriction diet2018-02-07v4No1 / 134
438amnoncommon homo sapiens, feces, china, jiangsu province, age 13-142018-12-30v4No1 / 134
197amnoncommon feces, homo sapiens, obsolete_juvenile stage, age 13, juvenile organism, finland2017-09-12v4No1 / 136
212amnonhigher in obese mice fed quinoa diet compared to ain-93g rodent diet ( high in diet quinoa product compared to ain-93g rodent diet in mouse mus musculus feces research facility united states of america obesity obese body mass index status db/db mouse )2017-10-22v4No1 / 143
132amnoncommon homo sapiens, feces, united states of america2017-04-16v4No1 / 145
509amnoncommon feces, homo sapiens, nigeria, kebbi state, rural community, child, age 10-15 years, schistosomiasis, urinary schistosomiasis2019-03-18v4No1 / 146
53amnonhigher in sewer and wastewater influent comapred to feces in low income south america ( high in sewer wastewater treatment plant compared to feces in south america city low income )2017-01-21v4No1 / 148
74amnonHigher in animal product diet compared to plant diet ( high in diet animal product diet compared to plant diet in homo sapiens feces united states of america )2017-02-27v4No1 / 149
73amnoncommon homo sapiens, feces, adult, glasgow2017-02-26v4No1 / 150
214amnon high in c57bl/6j compared to strain 129s in feces united states of america research facility mus musculus mouse jackson laboratories mouse chow 2017-10-23v4No1 / 154
538amnon high in jackson laboratories compared to taconic farms in terminal ileum ileum canada age 8 weeks c57bl/6 research facility mouse mus musculus 2019-07-29v4No1 / 154
122amnoncommon homo sapiens, feces, united kingdom2017-04-13v4No1 / 157
290amnoncommon homo sapiens, feces, china, adult, city2018-02-01v4No1 / 162
297amnoncommon homo sapiens, feces, obsolete_juvenile stage, age<17 years, united states of america, atlanta, child2018-02-12v4No1 / 162
337amnoncommon in feces of house mice from new york city (common mus musculus, house mice, mouse, new york city, united states of america, city)2018-05-18v4No1 / 165
276amnon high in united states of america city state of oklahoma compared to peru small village tunapuco rural community in feces homo sapiens adult 2018-01-22v4No1 / 168
457amnoncommon mouse, mus musculus, feces, research facility, c57bl/6ncrl, finland, male, polydextrose, high fat diet + polydextrose2019-01-11v4No1 / 168
123amnon high in high fat diet diet compared to normal diet mouse chow in mus musculus mouse feces research facility united states of america c57bl/6j 2017-04-13v4No1 / 170
197amnoncommon feces, homo sapiens, obsolete_juvenile stage, age 13, juvenile organism, india2017-09-12v4No1 / 170
424amnonfarm dependent in feces of pigs with same genetic background ( high in farm 1 compared to farm 2 in sus scrofa pig jinhua city prefecture china jinhua pig feces farm )2018-12-06v4No1 / 171
538amnon high in jackson laboratories compared to taconic farms in right colon colon canada age 8 weeks c57bl/6 research facility mouse mus musculus 2019-07-29v4No1 / 172
241amnonlower in babies age <1 year compared to age 1-3 years ( high in age age 1-3 years compared to age < 1 year in homo sapiens feces infant )2017-11-13v4No1 / 173
405amnoncommon mouse, mus musculus, research facility, feces, united states of america, swiss webster, ketogenic diet2018-11-20v4No1 / 177
311amnoncommon ginger, food product, united states of america, state of rhode island2018-04-09v4No1 / 180
399amnon high in control compared to ulcerative colitis in feces united states of america homo sapiens 2018-11-16v4No1 / 180
538amnoncommon jackson laboratories, terminal ileum, ileum, canada, age 8 weeks, c57bl/6, research facility, mouse, mus musculus2019-07-30v4No1 / 182
179amnoncommon mus musculus, mouse, oral cavity, mouth, research facility, united states of america, balb/c2017-08-13v4No1 / 183
321amnoncommon mus musculus, mouse, c57bl/6j, feces, united states of america, research facility2018-04-22v4No1 / 183
399amnoncommon feces, united states of america, research facility, rat, rattus norvegicus2018-11-16v4No1 / 184
188amnoncommon mus musculus, mouse, research facility, female, cba/caj, taconic farms, feces2017-10-25v4No1 / 185
538amnoncommon right colon, colon, jackson laboratories, canada, age 8 weeks, c57bl/6, research facility, mouse, mus musculus2019-07-30v4No1 / 186
312amnoncommon feces, homo sapiens, french republic, adult, spondylitis, spondyloarthritis2018-04-09v4No1 / 197
334amnoncommon mus musculus, mouse, feces, israel, research facility, c57bl/62018-05-15v4No1 / 200
6amnoncommon urine, female, homo sapiens, pregnancy, state of tennessee2016-10-13v4No1 / 201
248amnoncommon mouse, mus musculus, research facility, fvb/n mice, germany, feces2017-11-22v4No1 / 203
405amnoncommon mouse, mus musculus, research facility, feces, united states of america, swiss webster, control diet2018-11-20v4No1 / 203
457amnoncommon mouse, mus musculus, feces, research facility, c57bl/6ncrl, finland, male, high fat diet2019-01-11v4No1 / 204
120amnoncommon homo sapiens, feces, brazil2017-04-12v4No1 / 208
503amnoncommon mouse, mus musculus, research facility, japan, feces, c57bl/62019-03-12v4No1 / 210
108amnoncommon research facility, texas, united states of america, caecum, coturnix coturnix, common quail2017-04-07v4No1 / 216
455amnoncommon homo sapiens, feces, adult, canada, atherosclerosis2019-01-10v4No1 / 216
290amnoncommon homo sapiens, feces, china, adult, small village, rural community2018-02-01v4No1 / 218
369amnoncommon mus musculus, mouse, research facility, switzerland, c57bl/6j, feces, mouse chow2018-09-06v4No1 / 224
458amnonlower in BALB/c strain compared to A/J and C57BL/6 strains ( high in a/j c57bl/6 compared to balb/c in mus musculus mouse research facility feces female united states of america )2019-01-11v4No1 / 224
42amnoncommon in tcr-b deficient balb/c mice (common mus musculus, research facility, japan, feces, balb/c)2016-12-10v4No1 / 227
310amnoncommon homo sapiens, feces, female, adult, poland, rectum2018-04-07v4No1 / 227
214amnonlower in mice from jackson laboratories compared to taconic farms ( high in taconic farms compared to jackson laboratories in mouse mus musculus feces united states of america research facility strain 129s )2017-10-23v4No1 / 232
331amnon high in dry season compared to wet season in feces monkey theropithecus gelada ethiopia 2018-05-13v4No1 / 232
349amnoncommon rattus, rat, feces, china, research facility, sprague dawley, male2018-07-29v4No1 / 235
53amnon high in shantytown lima compared to el salado small village in homo sapiens feces city 2017-01-21v4No1 / 237
119amnoncommon mus musculus, mouse, feces, research facility, sweden2017-04-12v4No1 / 239
108amnoncommon research facility, texas, united states of america, caecum, mus musculus, mouse2017-04-07v4No1 / 241
220amnoncommon feces, united states of america, female, research facility, mus musculus, balb/c, high fat diet, mouse, diet2017-10-24v4No1 / 241
161amnoncommon in barn swallows in colorado (common hirundo rustica, feces, united states of america, colorado, barn swallow)2017-07-12v4No1 / 245
351amnoncommon sea urchin, lytechinus variegatus, coelomic fluid, research facility, eagle harbor, state of florida, united states of america2018-07-30v4No1 / 249
45amnonlower in young babies compared to 2 year olds in india ( high in age age 1-2 compared to age 0-1 in homo sapiens feces india infant )2016-12-19v4No1 / 253
503amnoncommon mouse, mus musculus, research facility, japan, feces, balb/c2019-03-12v4No1 / 257
167amnoncommon feces, female, research facility, mus musculus, nod mouse, mouse, united states of america2017-07-18v4No1 / 260
220amnoncommon mus musculus, mouse, feces, research facility, united states of america, female, balb/c, diet, mouse chow, low fat diet2017-10-24v4No1 / 262
399amnonlower in ampicillin treated mice compared to controls ( high in control compared to ampicillin antibiotic in feces united states of america research facility mus musculus mouse )2018-11-18v4No1 / 263
494amnoncommon mus musculus, mouse, research facility, c57bl/6, male, charles river laboratories, sweden, colon, mouse chow2019-02-27v4No1 / 275
438amnon high in age 3-6 age 8-12 child compared to adult age 30-50 age 60-79 in homo sapiens feces china 2018-12-30v4No1 / 279
225amnoncommon in polgA mutants (accelerated aging) (common mouse, mus musculus, feces, research facility, united kingdom, polga mutant)2017-10-29v4No1 / 281
334amnonlower in il-1alpha knockout mice compared to c57bl/6 controls ( high in c57bl/6 compared to il-1alpha knockout in mus musculus mouse feces israel research facility )2018-05-15v4No1 / 284
494amnon high in mouse chow compared to diet western diet high fat diet in mus musculus mouse research facility c57bl/6 male charles river laboratories sweden colon 2019-02-27v4No1 / 293
477amnon high in united states of america compared to nepal himalayas rural community in homo sapiens feces adult 2019-01-28v4No1 / 295
510amnoncommon kingdom of spain, water, bilbao, estuary, estuary water, fresh water, salinity <5 ppt2019-03-20v4No1 / 317
299amnon high in cancer mouth neoplasm compared to control in saliva adult homo sapiens china 2018-02-27v4No1 / 319
123amnoncommon mus musculus, mouse, feces, research facility, united states of america, c57bl/6j2017-04-13v4No1 / 325
518amnonhigher in beginning of experiment ( high in days 1-2 compared to days 14-28 in angus steer post-weaning state of georgia united states of america feces cow bos taurus )2019-06-11v4No1 / 325
429amnoncommon rat, rattus norvegicus, dahl salt-sensitive, feces, israel, research facility, control diet2018-12-13v4No1 / 327
467amnoncommon homo sapiens, feces, kingdom of denmark, metabolic syndrome, adult2019-01-14v4No1 / 328
351amnoncommon in artificial sea water where sea urchins were grown (common sea urchin, lytechinus variegatus, research facility, state of florida, united states of america, artificial seawater, sea water)2018-07-30v4No1 / 338
456amnon high in caecum compared to tongue in mus musculus mouse research facility united states of america c57bl/6 female 2019-01-10v4No1 / 338
124amnoncommon mus musculus, mouse, caecum, feces, c57bl/6j, united states of america2017-04-14v4No1 / 339
442amnoncommon in tnbs induced colitis in rat feces (common rattus norvegicus, rat, sprague dawley, male, research facility, china, feces, colitis, tnbs)2019-01-06v4No1 / 360
337amnonlower in manhattan compared to queens in feces of house mice from new york city ( high in queens region compared to manhatten region in united states of america city mus musculus new york city mouse house mice )2018-05-18v4No1 / 362
225amnoncommon in wild type cotrols (common mouse, mus musculus, feces, research facility, united kingdom, wild type genotype)2017-10-29v4No1 / 370
62amnoncommon homo sapiens, feces, united states of america, obsolete_juvenile stage, child2017-02-13v4No1 / 373
160amnoncommon in river water upstream of WTP effluent in autumn in china (common river, china, water, autumn)2017-07-12v4No1 / 376
458amnonhigher in C57BL/6 strain compared to A/J and BALB/c strains ( high in c57bl/6 compared to a/j balb/c in mus musculus mouse research facility feces female united states of america )2019-01-11v4No1 / 380
293amnonhigher in caloric restriction (CRON) diet compared to american diet ( high in cron diet caloric restriction diet diet compared to american diet in homo sapiens adult feces united states of america )2018-02-07v4No1 / 381
63amnon high in female compared to male in homo sapiens feces united states of america 2017-12-04v4No1 / 384
256amnonhigher in small intestine compared to colon in pigs ( high in duodenum jejunum ileum compared to caecum right colon left colon in sus scrofa pig united kingdom )2017-11-26v4No1 / 387
399amnon high in control compared to crohn's disease in feces united states of america homo sapiens 2018-11-16v4No1 / 390
425amnon high in feces compared to duodenum in homo sapiens africa child 2018-12-08v4No1 / 416
371amnonlower in amerindians compared to western visitors ( high in united states of america city compared to amerindian hunter gatherer venezuela in feces homo sapiens )2018-09-06v4No1 / 417
62amnoncommon homo sapiens, feces, obsolete_juvenile stage, child, egypt2017-02-13v4No1 / 422
53amnonlower in wastewater plant effluent compared to influent and sewer in south america ( high in sewage influent compared to effluent in south america wastewater treatment plant city )2017-01-21v4No1 / 440
339amnon high in adult compared to infant age < 1 year in homo sapiens feces india 2018-05-24v4No1 / 457
160amnoncommon in wastewater treatment plant effluent in autumn in china (common china, autumn, wastewater treatment plant, effluent)2017-07-12v4No1 / 469
438amnonhigher in centenarians compared to adults ( high in age >94 compared to age 30-50 age 60-79 in homo sapiens feces china )2018-12-30v4No1 / 474
214amnon high in diet nih 31m chow mouse chow compared to high fat diet in mouse mus musculus feces united states of america research facility 2017-10-23v4No1 / 495
352amnon high in small intestine duodenum compared to feces in homo sapiens india new delhi 2018-07-30v4No1 / 545
273amnon high in age age one year compared to age one month in feces homo sapiens kingdom of denmark infant 2018-01-14v4No1 / 557
240amnonlower in infants age<1 year compared to 1-3 years in baby feces ( high in age age > 1 year compared to age <1 year in homo sapiens feces infant finland )2017-11-12v4No1 / 567
372amnon high in mouse chow compared to high fat diet in mouse mus musculus feces research facility united states of america 2018-09-07v4No1 / 579
510amnon high in fresh water salinity <5 ppt compared to saline water salinity >20 ppt in kingdom of spain water bilbao estuary estuary water 2019-03-20v4No1 / 592
438amnonlower in students and soldiers age 19-24 compared to older adults ( high in age 30-50 age 60-79 age >94 compared to age 19-24 soldiers in homo sapiens feces china )2018-12-30v4No1 / 617
264amnoncommon oryctolagus cuniculus, rex rabbit, china, caecum, research facility, jiangsu province2017-12-11v4No1 / 622
458amnonhigher in mice from hsd compared to jackson laboratories ( high in harlan sprague dawley compared to jackson laboratories in mus musculus mouse research facility feces female united states of america )2019-01-11v4No1 / 644
517amnon high in feces compared to mouth mucosa mouth in chuquisaca department rural community bolivia age 5-13 years child homo sapiens 2019-05-29v4No1 / 752
478amnoncommon china, farm, litopenaeus vannamei, pacific white shrimp, intestine2019-02-19v4No1 / 795
517amnon high in forearm arm skin compared to mouth mucosa mouth in chuquisaca department rural community bolivia age 5-13 years child homo sapiens 2019-05-29v4No1 / 1014
252amnoncommon in river rock biofilm (common kingdom of spain, biofilm, river, rock, epilithic)2017-11-22v4No1 / 1081
478amnoncommon china, farm, shrimp farm, sediment2019-02-19v4No1 / 1085
252amnoncommon in river sand biofilm (common river, biofilm, kingdom of spain, sand)2017-11-22v4No1 / 1181
145amnoncommon soil, rhizosphere, oryza sativa, rice, united states of america, ph 5.62017-04-19v4No1 / 1515

Problems / suggestions? Please email info AT dbbact DOT org