Search result for sequence:
TACAGAGGTCTCAAGCGTTGTTCGGAATCACTGGGCGTAAAGGGTACGTAGGCGGCTTGATAAGTCGTGCGTGAAAGGCAGGGGCTCAACCTCTGGAGTGCGCATGATACTGTTGAGCTGGAGTAATGGAGGGGGAACCGGAATTCTTGG
common ontology terms
term enrichment score
TermScore
zoological garden0.315789
ovis aries0.266667
mongolian sheep0.250000
antidorcas marsupialis0.250000
springbok0.250000
detritivorous beetle0.250000
bulgaria0.250000
beetle0.222222
whole body0.166667
french republic0.153846
south africa0.153846
cecum0.142857
hirundo rustica0.142857
colorado0.142857
barn swallow0.142857
nanger granti0.142857
kenya0.142857
tropical grassland biome0.142857
gazelle0.142857
balkan mountains0.142857
onthophagus taurus0.142857
aepyceros melampus0.142857
impala0.142857
tragelaphus oryx0.142857
eland0.142857
toronto zoo0.142857
hippotragus niger0.142857
sable antelope0.142857
LOWER IN herbivorous beetle0.142857
LOWER IN poland0.142857
ileum0.133333
LOWER IN rumen0.133333
canada0.133333
rectum0.125000
caecum0.125000
LOWER IN ruminant reticulum0.125000
LOWER IN omasum0.125000
state of tennessee0.117647
sheep0.117647
LOWER IN old age0.100000
young age0.100000
captive0.100000
colon0.080000
age0.064516
skin0.051282
feces0.042463
united states of america0.018868
china0.017857
Fraction of dbbact annotations with this term covered by the query
TermScore
mongolian sheep0.500000
cecum0.500000
hirundo rustica0.500000
colorado0.500000
barn swallow0.500000
nanger granti0.500000
kenya0.500000
tropical grassland biome0.500000
gazelle0.500000
antidorcas marsupialis0.500000
springbok0.500000
detritivorous beetle0.500000
bulgaria0.500000
balkan mountains0.500000
onthophagus taurus0.500000
aepyceros melampus0.500000
impala0.500000
tragelaphus oryx0.500000
eland0.500000
toronto zoo0.500000
hippotragus niger0.500000
sable antelope0.500000
LOWER IN herbivorous beetle0.500000
LOWER IN poland0.500000
LOWER IN rumen0.333333
beetle0.333333
canada0.333333
zoological garden0.300000
ovis aries0.285714
caecum0.250000
LOWER IN ruminant reticulum0.250000
LOWER IN omasum0.250000
state of tennessee0.200000
sheep0.200000
whole body0.166667
french republic0.142857
south africa0.142857
LOWER IN old age0.125000
young age0.125000
captive0.125000
ileum0.111111
rectum0.100000
colon0.052632
age0.052632
skin0.037037
feces0.021930
united states of america0.010000
china0.009434
Fraction of annotations for the query sequences containing the term
TermScore
feces0.666667
zoological garden0.333333
ovis aries0.250000
mongolian sheep0.166667
rectum0.166667
ileum0.166667
colon0.166667
china0.166667
united states of america0.166667
french republic0.166667
antidorcas marsupialis0.166667
springbok0.166667
whole body0.166667
beetle0.166667
detritivorous beetle0.166667
bulgaria0.166667
south africa0.166667
cecum0.083333
hirundo rustica0.083333
colorado0.083333
barn swallow0.083333
nanger granti0.083333
kenya0.083333
tropical grassland biome0.083333
gazelle0.083333
age0.083333
LOWER IN old age0.083333
young age0.083333
state of tennessee0.083333
sheep0.083333
caecum0.083333
LOWER IN rumen0.083333
LOWER IN ruminant reticulum0.083333
LOWER IN omasum0.083333
balkan mountains0.083333
onthophagus taurus0.083333
aepyceros melampus0.083333
impala0.083333
skin0.083333
canada0.083333
captive0.083333
tragelaphus oryx0.083333
eland0.083333
toronto zoo0.083333
hippotragus niger0.083333
sable antelope0.083333
LOWER IN herbivorous beetle0.083333
LOWER IN poland0.083333
Exp. ID User ID Description Date Region Flag Sequences
111amnondominant mongolian sheep, ovis aries, rectum, ileum, cecum, colon, china2017-04-09v4No1 / 13
161amnoncommon in barn swallows in colorado (common hirundo rustica, feces, united states of america, colorado, barn swallow)2017-07-12v4No1 / 245
78amnonhigher in younger gazelles ( high in age young age compared to old age in nanger granti kenya feces tropical grassland biome gazelle )2017-03-01v4No1 / 270
399amnoncommon feces, united states of america, zoological garden, state of tennessee, ovis aries, sheep2018-11-16v4No1 / 451
111amnon high in rectum caecum ileum colon compared to rumen ruminant reticulum omasum in mongolian sheep ovis aries china 2017-04-09v4No1 / 464
406amnoncommon feces, zoological garden, french republic, antidorcas marsupialis, springbok2018-11-21v4No1 / 477
515amnoncommon whole body, beetle, detritivorous beetle, feces, bulgaria, balkan mountains, onthophagus taurus2019-04-18v4No1 / 533
406amnoncommon feces, south africa, aepyceros melampus, impala2018-11-21v4No1 / 643
565amnoncommon skin, canada, zoological garden, captive, tragelaphus oryx, eland, toronto zoo2019-11-21v3No1 / 674
406amnoncommon feces, south africa, antidorcas marsupialis, springbok2018-11-21v4No1 / 678
406amnoncommon feces, zoological garden, hippotragus niger, sable antelope, french republic2018-11-21v4No1 / 1075
515amnon high in detritivorous beetle bulgaria compared to herbivorous beetle poland in whole body beetle 2019-04-19v4No1 / 1543

Problems / suggestions? Please email info AT dbbact DOT org