Search result for sequence:
TACAGAGGTCTCAAGCGTTGTTCGGATTCATTGGGCGTAAAGGGTGCGTAGGCGGCGCGGTAAGTCGGGTGTGAAATCTCGGAGCTTAACTCCGAAACTGCATTCGATACTGCCGTGCTTGAGGACTGGAGAGGAGACTGGAATTTACGG
common ontology terms
term enrichment score
TermScore
soil0.620013
rhizosphere0.291216
china0.206452
agricultural field0.193435
cultivated environment0.179104
zea mays0.159544
kalamazoo loam0.139942
mesic type hapludalf0.139942
kellogg biological station0.139942
depth 0-10cm0.138398
united states of america0.126246
united states0.124629
des moines0.124629
nicollet soil series0.124629
glycine max0.121212
iowa0.117318
silt loam0.108761
state of michigan0.093933
ph 60.088608
topsoil0.088235
forest ecosystem0.088235
triticum aestivum0.085942
wheat0.083244
restored prairie0.080997
pot expreiment0.080997
shaanxi province0.080997
farm0.078624
loess plateau0.077844
citrus0.076677
ph 6-70.075949
oryza sativa0.075949
depth 0-20cm0.074928
woodland area0.071217
mexico0.071217
orchard0.070626
state of california0.069705
reforestation0.069401
robinia pseudoacacia0.069401
river0.068451
bulk soil0.062827
brazil0.058394
state of new york0.057971
lettuce0.057508
depth 25-50cm0.055901
state of idaho0.055901
mississippi river0.052345
depth 0-15cm0.052117
pasture0.052117
paddy field soil0.052117
kelley0.051447
subsurface drainage0.051447
miscanthus0.051447
mesocosm0.051447
agricultural feature0.051447
root0.050157
depth 15-30cm0.045827
state of georgia0.045584
fresh water0.045584
kanawha0.045307
panicum virgatum0.045307
hunan province0.044968
tree0.044800
ph 7-80.044633
corn0.044304
depth 10-25cm0.044304
haplic luvisol0.044304
switzerland0.043344
leaf0.042424
state of tennessee0.042424
canada0.040698
desert0.039886
depth 0-30cm0.039604
depth (soil) 30-60cm0.039474
manured soil0.039474
heilongjiang province0.039474
ames0.039088
dekalb county0.039088
illinois0.039088
guanajuato0.039088
flood plain0.039088
sacramento0.039088
cosumnes river preserve0.039088
coarse-loamy soil0.039088
thyrow0.039088
20 years0.039088
north china plain0.039088
kingdom of denmark0.037618
jiangsu province0.037618
state of illinois0.036923
depth 0-5cm0.036923
peat soil0.033149
park0.033058
mollisol0.033058
npk fertilization0.033058
hordeum vulgare0.033058
continuous corn0.032787
myrtillocactus geometrizans0.032787
opuntia robusta0.032787
day 820.032787
aquatic biome0.032787
Fraction of dbbact annotations with this term covered by the query
TermScore
depth 0-30cm0.750000
cultivated environment0.750000
mississippi river0.750000
peat soil0.750000
wheat0.750000
agricultural field0.714286
park0.666667
depth 0-15cm0.666667
ph 60.666667
depth 15-30cm0.666667
depth (soil) 30-60cm0.666667
pasture0.666667
orchard0.666667
citrus0.666667
soybean0.666667
mollisol0.666667
seed0.666667
LOWER IN hay0.666667
particles0.666667
npk fertilization0.666667
LOWER IN stem0.666667
fen0.666667
brassica oleracea0.666667
manured soil0.666667
manure fertilization0.666667
subtropical0.666667
ph 5.60.666667
paddy field soil0.666667
heilongjiang province0.666667
northeast china0.666667
hordeum vulgare0.666667
LOWER IN plant litter0.666667
ph 5.90.666667
unamended soil0.666667
depth 0-10cm0.615385
ph 5-60.600000
depth 5cm0.600000
rhizosphere0.590909
glycine max0.571429
ph 6-70.571429
oryza sativa0.571429
soil0.537634
central park0.500000
temperate woodland biome0.500000
temperate deciduos forest0.500000
non-seleniferous0.500000
ph 5.40.500000
zea mays0.500000
united states0.500000
des moines0.500000
nicollet soil series0.500000
kelley0.500000
ph 6.20.500000
subsurface drainage0.500000
moist tropical forest0.500000
continuous corn0.500000
kalamazoo loam0.500000
mesic type hapludalf0.500000
kellogg biological station0.500000
restored prairie0.500000
miscanthus0.500000
ph 7.10.500000
kanawha0.500000
ph 5.50.500000
mesocosm0.500000
quercus0.500000
oak0.500000
myrtillocactus geometrizans0.500000
opuntia robusta0.500000
ph 6-6.50.500000
heteromeles arbutifolia0.500000
ceanothus jepsonii0.500000
ames0.500000
ph 7.40.500000
silt loam0.500000
dekalb county0.500000
illinois0.500000
depth 0-27cm0.500000
cherokia georgiana georgiana0.500000
millipede0.500000
amphibia0.500000
oophaga pumilio0.500000
strawberry poison frog0.500000
guanajuato0.500000
agave0.500000
agave tequiliana0.500000
remartinia0.500000
aeshnidae0.500000
dragonfly0.500000
rhaebo haematiticus0.500000
truando toad0.500000
depth 30-60cm0.500000
LOWER IN depth 60-100cm0.500000
flood plain0.500000
sacramento0.500000
cosumnes river preserve0.500000
craugastor fitzingeri0.500000
common rain frog0.500000
seed structure0.500000
coarse-loamy soil0.500000
Fraction of annotations for the query sequences containing the term
TermScore
soil0.732203
united states of america0.322034
china0.271186
rhizosphere0.193220
agricultural field0.111864
cultivated environment0.101695
zea mays0.094915
state of michigan0.081356
kalamazoo loam0.081356
mesic type hapludalf0.081356
kellogg biological station0.081356
depth 0-10cm0.077966
iowa0.071186
united states0.071186
des moines0.071186
nicollet soil series0.071186
glycine max0.067797
silt loam0.061017
farm0.054237
topsoil0.050847
forest ecosystem0.050847
ph 60.047458
triticum aestivum0.047458
restored prairie0.044068
state of california0.044068
pot expreiment0.044068
depth 0-20cm0.044068
wheat0.044068
shaanxi province0.044068
loess plateau0.044068
woodland area0.040678
ph 6-70.040678
citrus0.040678
mexico0.040678
oryza sativa0.040678
orchard0.037288
river0.037288
reforestation0.037288
robinia pseudoacacia0.037288
brazil0.033898
state of new york0.033898
bulk soil0.033898
depth 25-50cm0.030508
state of idaho0.030508
lettuce0.030508
depth 0-15cm0.027119
kelley0.027119
subsurface drainage0.027119
miscanthus0.027119
pasture0.027119
state of georgia0.027119
mesocosm0.027119
fresh water0.027119
mississippi river0.027119
root0.027119
paddy field soil0.027119
agricultural feature0.027119
depth 15-30cm0.023729
corn0.023729
depth 10-25cm0.023729
kanawha0.023729
desert0.023729
canada0.023729
leaf0.023729
switzerland0.023729
haplic luvisol0.023729
hunan province0.023729
state of tennessee0.023729
tree0.023729
ph 7-80.023729
panicum virgatum0.023729
depth (soil) 30-60cm0.020339
depth 0-30cm0.020339
ames0.020339
state of illinois0.020339
dekalb county0.020339
illinois0.020339
guanajuato0.020339
flood plain0.020339
sacramento0.020339
cosumnes river preserve0.020339
depth 0-5cm0.020339
coarse-loamy soil0.020339
thyrow0.020339
kingdom of denmark0.020339
manured soil0.020339
heilongjiang province0.020339
jiangsu province0.020339
20 years0.020339
winter0.020339
north china plain0.020339
park0.016949
state of florida0.016949
continuous corn0.016949
united kingdom0.016949
myrtillocactus geometrizans0.016949
opuntia robusta0.016949
cactus0.016949
semi-arid0.016949
mollisol0.016949
Exp. ID User ID Description Date Region Flag Sequences
100amnondominant park, soil, urban biome, new york city, central park2017-04-03v4No1 / 1
357amnonhigh freq. in temperate deciduous forests around the world (dominant soil, temperate woodland biome, topsoil, depth 0-10cm, temperate deciduos forest, woodland area, forest ecosystem)2018-08-18v4No1 / 1
76amnonhigh freq in non-seleniferous soil (dominant united states of america, soil, rhizosphere, state of florida, non-seleniferous)2017-02-28v4No1 / 3
356amnonhigh freq. in deciduous broad leaved forest top soil in japan (dominant soil, topsoil, hokkaido, depth 0-10cm, ph 5.4, forest ecosystem, japan)2018-08-15v4No1 / 3
801sheryoDominant at depth 0-15cm in corn and soybean agriculture fields, Iowa USA (dominant soil, zea mays, glycine max, iowa, agricultural field, united states, des moines, depth 0-15cm, nicollet soil series, kelley, ph 6.2, subsurface drainage)2021-06-15v4No1 / 3
357amnonhigh freq. in moist tropical forest topsoil around the world (dominant soil, topsoil, depth 0-10cm, moist tropical forest, woodland area, forest ecosystem)2018-08-18v4No1 / 4
801sheryoDominant at depth 15-30cm in corn and soybean agriculture fields, Iowa USA (dominant soil, zea mays, glycine max, iowa, ph 6, agricultural field, united states, des moines, nicollet soil series, depth 15-30cm, kelley, subsurface drainage)2021-06-15v4No1 / 4
821sheryoDominant in soil of continuous corn field at 25-50cm depth, Michigan USA (dominant united states of america, soil, state of michigan, corn, continuous corn, kalamazoo loam, mesic type hapludalf, kellogg biological station, depth 25-50cm)2021-07-28v4No1 / 4
821sheryoDominant in soil of restored prairie at 25-50cm depth, Michigan USA (dominant united states of america, soil, state of michigan, kalamazoo loam, mesic type hapludalf, kellogg biological station, depth 25-50cm, restored prairie)2021-07-28v4No1 / 4
821sheryoDominant in soil of miscanthus field at 10-25cm depth, Michigan USA (dominant united states of america, soil, state of michigan, miscanthus, kalamazoo loam, mesic type hapludalf, kellogg biological station, depth 10-25cm, restored prairie)2021-08-02v4No1 / 4
821sheryoDominant in soil of miscanthus field at 25-50cm depth, Michigan USA (dominant united states of america, soil, state of michigan, miscanthus, kalamazoo loam, mesic type hapludalf, kellogg biological station, depth 25-50cm)2021-08-02v4No1 / 4
801sheryoDominant at depth 0-15cm in corn agriculture fields, Iowa USA (dominant soil, zea mays, iowa, agricultural field, united states, des moines, depth 0-15cm, nicollet soil series, ph 7.1, kanawha)2021-06-15v4No1 / 5
801sheryoDominant at depth 30-60cm in corn and soybean agriculture fields, Iowa USA (dominant soil, zea mays, glycine max, iowa, agricultural field, united states, des moines, ph 6.7, depth (soil) 30-60cm, nicollet soil series, kelley, subsurface drainage)2021-06-16v4No1 / 5
821sheryoDominant in soil of restored prairie at 10-25cm depth, Michigan USA (dominant united states of america, soil, state of michigan, kalamazoo loam, mesic type hapludalf, kellogg biological station, depth 10-25cm, restored prairie)2021-07-28v4No1 / 5
266amnonhigh freq. in soil from JAM garden (dominant united states of america, soil, state of idaho, ph 5.5)2017-12-18v4No1 / 6
480amnondominant farm, pasture, soil, new zealand2019-02-05v4No1 / 6
788amnondominant united states of america, soil, state of georgia, mesocosm2021-05-31v4No1 / 6
801sheryoDominant at depth 15-30cm in corn agriculture fields, Iowa USA (dominant soil, zea mays, iowa, agricultural field, united states, des moines, ph 7.7, nicollet soil series, depth 15-30cm, kanawha)2021-06-15v4No1 / 6
698amnondominant control, park, rhizosphere, ph 6-7, depth 0-30cm, united kingdom, quercus, oak2028-04-01v3No1 / 6
415amnondominant orchard, soil, rhizosphere, citrus, cultivated environment, china2018-11-27v4No1 / 7
266amnonhigh freq. in soil from PAR garden (dominant united states of america, soil, state of idaho, ph 5.5)2017-12-18v4No1 / 8
266amnonhigh freq. in soil from SIL garden (dominant united states of america, soil, state of idaho, ph 6)2017-12-18v4No1 / 8
415amnondominant orchard, soil, rhizosphere, brazil, citrus, cultivated environment2018-11-27v4No1 / 8
474amnondominant farm, soil, glycine max, brazil, soybean, ph 4-6, cultivated environment2019-01-16v4No1 / 8
480amnondominant farm, pasture, soil, ireland2019-02-05v4No1 / 8
129amnondominant soil, mexico, myrtillocactus geometrizans, opuntia robusta, cactus, semi-arid, ph 6-6.52017-04-15v4No1 / 9
479amnondominant united states of america, rhizosphere, state of california, ph 6-7, heteromeles arbutifolia2019-02-05v4No1 / 9
479amnondominant united states of america, rhizosphere, state of california, ph 6-7, ceanothus jepsonii2019-02-05v4No1 / 9
801sheryoDominant in soybean and corn agriculture fields at depth 15-30cm, Iowa USA (dominant soil, zea mays, glycine max, iowa, agricultural field, united states, ames, des moines, nicollet soil series, depth 15-30cm, ph 7.4)2021-06-15v4No1 / 9
801sheryoDominant in soybean and corn agriculture fields at depth 30-60cm, Iowa USA (dominant soil, zea mays, glycine max, iowa, agricultural field, united states, ames, des moines, depth (soil) 30-60cm, nicollet soil series, ph 7.4)2021-06-15v4No1 / 9
829sheryoDominant in soil depth of 0-27cm in Mollisol soil, Dekalb, Illinois, united states of america (dominant united states of america, soil, state of illinois, mollisol, silt loam, dekalb county, illinois, depth 0-27cm)2021-08-26v3No1 / 10
316amnondominant united states of america, soil, topsoil, state of ohio, ph 5, depth 0-10cm, forest ecosystem2018-04-10v4No1 / 11
788amnondominant feces, united states of america, state of georgia, mesocosm, cherokia georgiana georgiana, millipede2021-05-31v4No1 / 13
788amnondominant united states of america, state of georgia, mesocosm, plant litter2021-05-31v4No1 / 15
374amnoncommon skin, costa rica, frog, amphibia, oophaga pumilio, strawberry poison frog2018-09-09v4No1 / 61
360amnoncommon desert, soil, rhizosphere, mexico, guanajuato, agave, agave tequiliana, cultivated environment2018-08-21v4No1 / 98
499amnoncommon digestive system, pond, larval stage, intestine, brazil, remartinia, aeshnidae, dragonfly2019-03-05v4No1 / 104
374amnoncommon skin, costa rica, amphibia, rhaebo haematiticus, truando toad, toad2018-09-09v4No1 / 121
786sheryoHigher at 30-60cm depth compared to 60-100cm depth in flood plain soil near cosumnes river, california ( high in depth 30-60cm compared to depth 60-100cm in united states of america soil state of california flood plain sacramento cosumnes river preserve )2021-09-14v3No1 / 124
374amnoncommon skin, costa rica, frog, amphibia, craugastor fitzingeri, common rain frog2018-09-09v4No1 / 136
192amnoncommon seed structure, brassica napus, seed2017-09-05v4No1 / 161
600sheryolower in biochar ammendment soil ( high in unamended compared to biochar in united states of america soil state of new york depth 0-5cm ph 6 coarse-loamy soil day 82 )2020-03-27v4No1 / 166
357amnoncommon in moist tropical forest topsoil around the world (common soil, topsoil, depth 0-10cm, moist tropical forest, woodland area, forest ecosystem)2018-08-18v4No1 / 171
374amnoncommon skin, costa rica, frog, amphibia, craugastor bransfordii, bransford’s litter frog2018-09-09v4No1 / 171
384amnoncommon farm, pasture, nasal cavity, pair of nares, equus caballus, canada, horse2018-10-22v4No1 / 175
499amnoncommon digestive system, pond, intestine, tadpole, brazil, frog, scinax fuscovarius2019-03-05v4No1 / 176
316amnoncommon united states of america, soil, topsoil, state of ohio, ph 5, depth 0-10cm, forest ecosystem2018-04-10v4No1 / 199
384amnoncommon farm, pasture, saliva, oral cavity, equus caballus, canada, horse, mouth2018-10-22v4No1 / 201
360amnoncommon desert, leaf, mexico, guanajuato, agave, agave tequiliana, leaf surface, cultivated environment2018-08-21v4No1 / 210
360amnon high in summer compared to spring in desert soil rhizosphere state of california mexico 2018-08-21v4No1 / 214
129amnon high in soil compared to rhizosphere in mexico myrtillocactus geometrizans opuntia robusta cactus semi-arid ph 6-6.5 2017-04-15v4No1 / 221
279amnoncommon grassland, steppe, soil, mongolia, china2018-01-24v4No1 / 235
384amnon high in pasture compared to hay barn in farm saliva equus caballus canada horse mouth 2018-10-22v4No1 / 245
103amnon high in upstream compared to downstream in united states of america river aquatic biome fresh water mississippi river particles 2017-04-05v4No1 / 256
103amnon high in upstream compared to downstream in united states of america river aquatic biome fresh water mississippi river free floating 2017-04-05v4No1 / 257
788amnoncommon united states of america, state of georgia, mesocosm, plant litter2021-05-31v4No1 / 259
762sheryoCommon in rhizosphere soil of a pot experiment with lettuce planted in npk fertilized haplic luvisol Switzerland (common soil, rhizosphere, switzerland, thyrow, pot expreiment, npk fertilization, lettuce, mineral fertilization, haplic luvisol)2021-04-08v3No1 / 286
827sheryoHigher in soil depth of 60cm compared to soil depth of 275cm in clayey till loam soil, Lund Denmark ( high in depth 20-120cm compared to depth 200-350cm in kingdom of denmark agricultural field lund loam soil clayey till late weichselian glaciation )2021-09-13v3No1 / 295
37amnoncommon in plastic leaf plants (in field next to tomato plants) (common leaf, maryland county)2016-12-09v4No1 / 298
384amnon high in pasture compared to hay barn in farm nasal cavity pair of nares equus caballus canada horse 2018-10-22v4No1 / 304
615amnon high in leaf leaf surface compared to stem upper stem stem surface in brazil greenhouse exosphere campinas saccharum sugarcane 2020-04-27v4No1 / 321
512amnoncommon peatland, fen, soil, peat soil, baekdudaegan, ph 5-6, hani peatland, china2019-03-22v4No1 / 329
129amnoncommon rhizosphere, mexico, myrtillocactus geometrizans, opuntia robusta, cactus, semi-arid2017-04-15v4No1 / 338
762sheryoHigher in bulk soil of a pot experiment with lettuce planted in npk fertilized compared to organic fertilized haplic luvisol Switzerland ( high in npk fertilization mineral fertilization compared to manured soil manure fertilization organic fertilization bio-dynamic fertilizer in soil bulk soil switzerland pot expreiment lettuce haplic luvisol therwil )2021-04-07v3No1 / 347
583amnoncommon mountain, soil, switzerland, depth 0-10cm, canton of graubunden, elevation 2000-3000m, siliceous parent material, ph 4.5-72020-01-27v3No1 / 359
512amnon high in baekdudaegan ph 5-6 hani peatland compared to tibetan plateau riganqiao peatland ph 5.5-6.5 in peatland fen soil peat soil china 2019-03-22v4No1 / 363
686sheryoHigher in vanilla field soil infected with Fusarium oxysporum, fertilized with fungal and bacterial bio-fertilizer and had low Fusarium cumulative disease incidence ( high in bacterial enriched bio-fertilizer low fusarium cumulative disease incidence fungal enriched bio-fertilizer compared to chemical fertilization n,p,k high fusarium cumulative disease incidence organic fertilizer- chicken manure compost in wanning city vanilla planifolia ph 7.6 pot expreiment soil from vanilla field fusarium oxysporum f. sp. vanillae )2028-03-08v4No1 / 371
582amnon high in external acoustic meatus ear canal compared to rectum perianal skin in united states of america wild santa catalina island urocyon littoralis urocyon littoralis catalinae santa catalina island fox 2020-01-22v4No1 / 374
29amnon high in seed compared to seedling in brassica oleracea french republic 2016-12-05v4No1 / 379
412amnonhigh in pig manured soil with wheat-maize rotation compared to non-manured soil ( high in manured soil compared to non-manured soil in soil cambisol red soil zea mays triticum aestivum hunan province china )2018-11-26v4No1 / 395
360amnoncommon desert, soil, mexico, guanajuato2018-08-21v4No1 / 437
762sheryocommon in rhizosphere soil of a pot experiment with lettuce planted in organic fertilized haplic luvisol Switzerland (common soil, manured soil, rhizosphere, switzerland, thyrow, pot expreiment, manure fertilization, lettuce, organic fertilization, haplic luvisol, bio-dynamic fertilizer)2021-04-08v3No1 / 455
415amnonhigher in citrus from humid subtropical compared to mediterranean and semi-arid climate ( high in subtropical compared to mediterranean semi-arid in orchard soil rhizosphere citrus cultivated environment )2018-11-27v4No1 / 458
357amnoncommon soil, topsoil, depth 0-10cm, woodland area, forest ecosystem2018-08-19v4No1 / 474
360amnoncommon desert, soil, rhizosphere, mexico, guanajuato, agave, agave salmiana2018-08-21v4No1 / 484
360amnoncommon desert, leaf, mexico, guanajuato, agave, agave salmiana, leaf surface2018-08-21v4No1 / 492
259amnonhigher in manured soil compared to non-manured ( high in manured soil compared to non-manured in soil fertilized soil rhizosphere arachis hypogaea ph 5 peanut china )2017-12-02v4No1 / 497
357amnoncommon soil, topsoil, depth 0-10cm, southern temperate forest, temperate broadleaf and mixed forest biome, woodland area, forest ecosystem2018-08-19v4No1 / 499
360amnoncommon desert, soil, mexico, guanajuato, cultivated environment2018-08-21v4No1 / 500
801sheryoHigher at depth 0-15cm compared to depth 60-90cm in corn agriculture fields, Iowa USA ( high in depth 0-15cm compared to depth 60-90cm in soil zea mays iowa agricultural field united states des moines nicollet soil series kanawha )2021-06-15v4No1 / 501
829sheryoCommon in soil depth of 116-140cm in Mollisol soil, Dekalb, Illinois, united states of america (common united states of america, soil, state of illinois, mollisol, silt loam, dekalb county, illinois, depth 116-140cm)2021-08-26v3No1 / 516
762sheryocommin in bulk soil of a pot experiment with lettuce planted in npk fertilzed albic luvisol from Germany (common soil, bulk soil, germany, thyrow, pot expreiment, npk fertilization, albic luvisol, ph 6.4, lettuce, mineral fertilization)2021-04-07v3No1 / 531
98amnoncommon rhizosphere, state of florida, citrus, vero beach, fl, root2017-04-01v4No1 / 544
462amnon high in populus deltoides compared to populus trichocarpa x deltoides in united states of america state of tennessee leaf populus tree cultivated environment 2019-01-13v4No1 / 559
357amnoncommon soil, mediterranean forest biome, topsoil, depth 0-10cm, woodland area, forest ecosystem2018-08-19v4No1 / 564
254amnon high in summer autumn wet season compared to winter dry season in river water fresh water fujian province depth 0.5m jiulong river china 2017-11-23v4No1 / 571
762sheryoHigh in bulk soil comparedc to rhizosphere of a pot experiment with lettuce planted in haplic luvisol Switzerland ( high in bulk soil compared to rhizosphere in soil switzerland thyrow pot expreiment lettuce haplic luvisol )2021-04-08v3No1 / 577
762sheryoHigh in bulk soil compared to rhizosphere of a pot experiment with lettuce planted in albic luvisol Germany ( high in bulk soil compared to rhizosphere in soil germany thyrow pot expreiment albic luvisol lettuce haplic luvisol )2021-04-08v3No1 / 578
254amnon high in summer wet season compared to winter autumn dry season in river water fresh water fujian province depth 0.5m jiulong river china 2017-11-23v4No1 / 581
357amnoncommon soil, topsoil, depth 0-10cm, montane forest, woodland area, forest ecosystem2018-08-19v4No1 / 592
801sheryoCommon at depth 15-30cm in corn agriculture fields, Iowa USA (common soil, zea mays, iowa, agricultural field, united states, des moines, ph 7.7, nicollet soil series, depth 15-30cm, kanawha)2021-06-15v4No1 / 598
415amnoncommon orchard, soil, rhizosphere, south africa, citrus, cultivated environment2018-11-27v4No1 / 600
762sheryoCommon in bulk soil of a pot experiment with lettuce planted in organic fertilized haplic luvisol Switzerland (common soil, manured soil, bulk soil, switzerland, pot expreiment, manure fertilization, lettuce, organic fertilization, haplic luvisol, therwil, bio-dynamic fertilizer, ph 6.6)2021-04-07v3No1 / 602
788amnoncommon feces, united states of america, state of georgia, mesocosm, cherokia georgiana georgiana, millipede2021-05-31v4No1 / 607
357amnoncommon savanna, soil, topsoil, depth 0-10cm, woodland area, forest ecosystem2018-08-19v4No1 / 614
609sheryoCommon in soil with tobacco plants amended with difenoconazole fungicide and biochar (common soil, ph 7-8, depth 0-20cm, limestone, biochar, fungicide, china, tobacco field, difenoconazole, tobacco plant present)2020-04-21v4No1 / 634
762sheryoCommon in bulk soil of a pot experiment with lettuce planted in npk fertilized haplic luvisol Switzerland (common soil, bulk soil, switzerland, ph 5.6, pot expreiment, npk fertilization, lettuce, mineral fertilization, haplic luvisol, therwil)2021-04-07v3No1 / 648
801sheryoCommon in soybean and corn agriculture fields at depth 60-90cm, Iowa USA (common soil, zea mays, glycine max, iowa, agricultural field, united states, ames, des moines, ph 7.7, nicollet soil series, depth 60-90cm)2021-06-15v4No1 / 650
801sheryoCommon at depth 60-90cm in corn and soybean agriculture fields, Iowa USA (common soil, zea mays, glycine max, iowa, agricultural field, united states, des moines, ph 7.9, nicollet soil series, depth 60-90cm, kelley, subsurface drainage)2021-06-16v4No1 / 667
609sheryocommon in soil with tobacco plants amended with difenoconazole fungicide (common soil, ph 7-8, depth 0-20cm, limestone, fungicide, china, tobacco field, difenoconazole, tobacco plant present)2020-04-21v4No1 / 671
357amnoncommon in temperate deciduous forests around the world (common soil, temperate woodland biome, topsoil, depth 0-10cm, temperate deciduos forest, woodland area, forest ecosystem)2018-08-18v4No1 / 681
422amnoncommon soil, paddy field soil, oryza sativa, heilongjiang province, ph 6-7, cultivated environment, china2018-12-04v4No1 / 682
100amnoncommon park, soil, urban biome, new york city, central park2017-04-03v4No1 / 685
829sheryohigher soil depth of 0-12cm compared to 12-44cm in Alfisol soil, Dekalb, Illinois, united states of america ( high in depth 0-12cm compared to depth 12-44cm in united states of america soil state of illinois sandy loam soil dekalb county illinois alfisol hapludalf sandy loam )2021-08-26v3No1 / 685
506amnoncommon soil, peat soil, northeast china, depth 0-10cm, boreal wetland, seasonal frozen marsh, wetland area, china2019-03-16v4No1 / 690
134amnon high in subtropical taxus mairei southeast china compared to temperate taxus media taxus cuspidata northeast china in rhizosphere tree taxus china 2017-04-16v4No1 / 694
801sheryoCommon at depth 30-60cm in corn agriculture fields, Iowa USA (common soil, zea mays, iowa, agricultural field, united states, des moines, depth (soil) 30-60cm, nicollet soil series, kanawha, ph 8.1)2021-06-15v4No1 / 703
762sheryoCommon in bulk soil of a pot experiment with lettuce planted in organic fertilized albic luvisol from Germany (common soil, manured soil, bulk soil, germany, thyrow, pot expreiment, manure fertilization, albic luvisol, ph 6.4, lettuce, organic fertilization)2021-04-07v3No1 / 704
357amnon high in ph>3 compared to ph<3 in soil subpolar coniferous forest biome topsoil depth 0-10cm boreal forest woodland area forest ecosystem 2018-08-19v4No1 / 719
415amnoncommon orchard, soil, rhizosphere, reunion island, citrus, cultivated environment2018-11-27v4No1 / 721
422amnoncommon soil, paddy field soil, oryza sativa, heilongjiang province, ph 5-6, cultivated environment, china2018-12-04v4No1 / 726
821sheryoComoon in soil of miscanthus field at 50-100cm depth, Michigan USA (common united states of america, soil, state of michigan, depth 50-100m, miscanthus, kalamazoo loam, mesic type hapludalf, kellogg biological station, restored prairie)2021-08-02v4No1 / 726
462amnoncommon united states of america, state of tennessee, soil, silt clay loam, depth 30-75cm, cultivated environment2019-01-13v4No1 / 728
823sheryoCommon at 0-10cm depth in ultisol soil in auburn, alabama (common soil, depth 0-10cm, agricultural field, ultisol, upland soil, auburn, alabama)2021-08-07v3No1 / 730
829sheryoCommon in soil depth of 0-12m in Alfisol soil, Dekalb, Illinois, united states of america (common united states of america, soil, state of illinois, sandy loam soil, dekalb county, illinois, depth 0-12cm, alfisol, hapludalf, sandy loam)2021-08-26v3No1 / 737
813amnoncommon united states of america, soil, state of washington, forested area, olympic national park, temperate rainforest2021-06-22v4No1 / 740
415amnoncommon orchard, soil, rhizosphere, australia, citrus, cultivated environment2018-11-27v4No1 / 743
821sheryoCommon in soil of restored prairie at 50-100cm depth, Michigan USA (common united states of america, soil, state of michigan, depth 50-100m, kalamazoo loam, mesic type hapludalf, kellogg biological station, restored prairie)2021-07-28v4No1 / 744
600sheryoDecreases after 12 days of stover ammendment in soil ( high in day 1 compared to day 12 in united states of america soil state of new york depth 0-5cm ph 6 coarse-loamy soil stover ammendment soil )2020-03-27v4No1 / 747
801sheryoCommon at depth 30-60cm in corn and soybean agriculture fields, Iowa USA (common soil, zea mays, glycine max, iowa, agricultural field, united states, des moines, ph 6.7, depth (soil) 30-60cm, nicollet soil series, kelley, subsurface drainage)2021-06-15v4No1 / 760
801sheryoCommon at depth 60-90cm in corn agriculture fields, Iowa USA (common soil, zea mays, iowa, agricultural field, united states, des moines, nicollet soil series, depth 60-90cm, kanawha, ph 8.3)2021-06-15v4No1 / 764
821sheryoCommon in soil of continuous corn field at 50-100cm depth, Michigan USA (common united states of america, soil, state of michigan, corn, depth 50-100m, continuous corn, kalamazoo loam, mesic type hapludalf, kellogg biological station)2021-07-28v4No1 / 769
615amnoncommon brazil, endosphere, greenhouse, root, campinas, saccharum, sugarcane2020-04-27v4No1 / 776
823sheryoCommon at 90-100cm depth in foot slope ultisol soil in auburn, alabama (common soil, agricultural field, ultisol, auburn, alabama, foot slope , depth 90-100cm)2021-08-08v3No1 / 782
821sheryoHigher at 25-50cm depth compared to 50-100cm depth in soil in Michigan USA ( high in depth 25-50cm compared to depth 50-100m in united states of america soil state of michigan corn panicum virgatum miscanthus kalamazoo loam mesic type hapludalf kellogg biological station restored prairie )2021-08-05v4No1 / 784
828sheryoCommon in gleysol soil of poplar plantation at 40-50cm depth, sihong, china (common soil, jiangsu province, clay loam, ph 6-7, gleysol, china, sihong county, poplar, poplar plantation, chenwei forest, depth 40-50cm)2021-08-25v4No1 / 790
384amnon high in nasal cavity pair of nares compared to saliva oral cavity mouth in farm equus caballus canada horse 2018-10-22v4No1 / 791
478amnoncommon farm, intestine, litopenaeus vannamei, pacific white shrimp, china2019-02-19v4No1 / 795
829sheryoCommon in soil depth of 0-27cm in Mollisol soil, Dekalb, Illinois, united states of america (common united states of america, soil, state of illinois, mollisol, silt loam, dekalb county, illinois, depth 0-27cm)2021-08-26v3No1 / 798
478amnoncommon farm, water, saline water, shrimp farm, china2019-02-19v4No1 / 799
480amnoncommon farm, pasture, soil, ireland2019-02-05v4No1 / 816
422amnoncommon soil, paddy field soil, oryza sativa, yunnan province, cultivated environment, china2018-12-02v4No1 / 821
415amnoncommon orchard, soil, rhizosphere, citrus, cultivated environment, china2018-11-27v4No1 / 830
356amnoncommon in deciduous broad leaved forest top soil in japan (common soil, topsoil, hokkaido, depth 0-10cm, ph 5.4, forest ecosystem, japan)2018-08-15v4No1 / 834
801sheryoCommon in soybean and corn agriculture fields at depth 30-60cm, Iowa USA (common soil, zea mays, glycine max, iowa, agricultural field, united states, ames, des moines, depth (soil) 30-60cm, nicollet soil series, ph 7.4)2021-06-15v4No1 / 839
801sheryoCommon at depth 15-30cm in corn and soybean agriculture fields, Iowa USA (common soil, zea mays, glycine max, iowa, ph 6, agricultural field, united states, des moines, nicollet soil series, depth 15-30cm, kelley, subsurface drainage)2021-06-15v4No1 / 841
266amnoncommon in roots in JAM garden (common united states of america, state of idaho, plant, brassicaceae, boechera stricta, root)2017-12-19v4No1 / 843
828sheryoCommon in gleysol soil of poplar plantation at 30-40cm depth, sihong, china (common soil, jiangsu province, clay loam, ph 6-7, gleysol, china, sihong county, poplar, poplar plantation, chenwei forest, depth 30-4cm)2021-08-25v4No1 / 844
698amnoncommon park, rhizosphere, disease, ph 5-6, depth 0-30cm, united kingdom, quercus, oak, acute oak decline, plant disease2028-04-01v3No1 / 848
412amnoncommon soil, cambisol, red soil, zea mays, triticum aestivum, hunan province, ph>5, china2018-11-26v4No1 / 856
801sheryoCommon at depth 0-15cm in corn agriculture fields, Iowa USA (common soil, zea mays, iowa, agricultural field, united states, des moines, depth 0-15cm, nicollet soil series, ph 7.1, kanawha)2021-06-15v4No1 / 862
767sheryoCommon in soil planted with Chrysanthemum, fertilized with bio-organic fertilizer in Nanjing China (common soil, compost biofilter, compost, pig manure, paenibacillus, china, nanjing county, chrysanthemum, bio-organic fertilizer, chrysanthemum morifolium ramat., ph 6.9, paenibacillus polymyxa)2021-04-14v4No1 / 866
829sheryoCommon in soil depth of 108-140cm in Alfisol soil, Dekalb, Illinois, united states of america (common united states of america, soil, state of illinois, sandy loam soil, dekalb county, illinois, alfisol, hapludalf, sandy loam, depth 108-140cm)2021-08-26v3No1 / 871
821sheryoCommon in soil of switchgrass field at 50-100cm depth, Michigan USA (common united states of america, soil, state of michigan, depth 50-100m, panicum virgatum, kalamazoo loam, mesic type hapludalf, kellogg biological station)2021-08-03v4No1 / 872
786sheryoCommon in flood plain soil near cosumnes river, california, at 60-100cm depth (common united states of america, soil, state of california, flood plain, sacramento, cosumnes river preserve, depth (soil) 60-100cm)2021-05-18v3No1 / 878
129amnoncommon soil, mexico, myrtillocactus geometrizans, opuntia robusta, cactus, semi-arid, ph 6-6.52017-04-15v4No1 / 884
171amnoncommon in soil with rice growth irrigation protocol (common united states of america, soil, state of california, depth 5cm)2017-07-25v4No1 / 890
462amnon high in leaf compared to stem in united states of america state of tennessee populus tree cultivated environment 2019-01-13v4No1 / 890
146amnoncommon united states of america, rhizosphere, solanum lycopersicum, tomato, slit loam soil, ph 62017-04-20v4No1 / 894
788amnoncommon united states of america, soil, state of georgia, mesocosm2021-05-31v4No1 / 897
786sheryoCommon in flood plain soil near cosumnes river, california, at 133-166cm depth (common united states of america, soil, state of california, flood plain, sacramento, cosumnes river preserve, depth (soil) 133-166cm)2021-05-18v3No1 / 898
479amnoncommon united states of america, rhizosphere, state of california, ph 6-7, ceanothus jepsonii2019-02-05v4No1 / 900
821sheryoCommon in soil of miscanthus field at 25-50cm depth, Michigan USA (common united states of america, soil, state of michigan, miscanthus, kalamazoo loam, mesic type hapludalf, kellogg biological station, depth 25-50cm, restored prairie)2021-08-02v4No1 / 901
801sheryoCommon in soybean and corn agriculture fields at depth 15-30cm, Iowa USA (common soil, zea mays, glycine max, iowa, agricultural field, united states, ames, des moines, nicollet soil series, depth 15-30cm, ph 7.4)2021-06-15v4No1 / 905
462amnoncommon united states of america, state of tennessee, rhizosphere, populus, tree, silt clay loam, depth 30-75cm, cultivated environment2019-01-13v4No1 / 908
103amnoncommon united states of america, river, aquatic biome, fresh water, mississippi river, particles2017-04-05v4No1 / 909
103amnoncommon united states of america, river, aquatic biome, fresh water, mississippi river, free floating2017-04-05v4No1 / 909
609sheryoCommon in soil without tobacco plants amended with difenoconazole fungicide and biochar (common soil, ph 7-8, depth 0-20cm, limestone, biochar, fungicide, china, tobacco field, difenoconazole, without plants)2020-07-05v4No1 / 910
609sheryoCommon in soil without tobacco plants amended with difenoconazole fungicide (common soil, ph 7-8, depth 0-20cm, limestone, fungicide, china, tobacco field, difenoconazole, without plants)2020-07-05v4No1 / 915
126amnoncommon rhizosphere, hordeum vulgare, germany, winter barley2017-04-14v4No1 / 925
821sheryoHigher at 10-25cm depth compared to 0-10cm depth in soil in Michigan USA ( high in depth 10-25cm compared to depth 0-10cm in united states of america soil state of michigan corn panicum virgatum miscanthus kalamazoo loam mesic type hapludalf kellogg biological station restored prairie )2021-08-05v4No1 / 930
462amnoncommon united states of america, state of tennessee, soil, depth 0-30cm, silt loam, cultivated environment2019-01-13v4No1 / 938
444amnoncommon in uncultivated soil plot (common soil, nanjing city prefecture, yellow brown soil, china)2019-01-07v4No1 / 946
767sheryoCommon in soil planted with Chrysanthemum, amended with soil fumigant 'Dazomet' in Nanjing China (common soil, china, nanjing county, chrysanthemum, chrysanthemum morifolium ramat., ph 6.9, soil fumigation, dazomet)2021-04-14v4No1 / 946
37amnonlower in tomato plant leaves compared to plastic control ( high in control compared to solanum lycopersicum in leaf maryland county )2016-12-09v4No1 / 950
98amnoncommon rhizosphere, state of florida, citrus, quincy, fl, root2017-04-01v4No1 / 950
422amnoncommon soil, paddy field soil, oryza sativa, jiangsu province, cultivated environment, china2018-12-02v4No1 / 957
821sheryoCommon in soil of continuous corn field at 25-50cm depth, Michigan USA (common united states of america, soil, state of michigan, corn, continuous corn, kalamazoo loam, mesic type hapludalf, kellogg biological station, depth 25-50cm)2021-07-28v4No1 / 963
129amnoncommon soil, mexico, myrtillocactus geometrizans, opuntia robusta, cactus, semi-arid, root zone soil, ph 6-6.52017-04-15v4No1 / 968
821sheryoCommon in soil of restored prairie at 25-50cm depth, Michigan USA (common united states of america, soil, state of michigan, kalamazoo loam, mesic type hapludalf, kellogg biological station, depth 25-50cm, restored prairie)2021-07-28v4No1 / 968
480amnoncommon farm, pasture, soil, new zealand2019-02-05v4No1 / 970
134amnoncommon rhizosphere, temperate, tree, taxus, taxus mairei, northeast china, china2017-04-16v4No1 / 973
474amnoncommon farm, soil, glycine max, brazil, soybean, ph 4-6, cultivated environment2019-01-16v4No1 / 974
615amnoncommon rhizosphere, brazil, greenhouse, campinas, saccharum, sugarcane2020-04-27v4No1 / 974
821sheryoCommon in soil of switchgrass field at 25-50cm depth, Michigan USA (common united states of america, soil, state of michigan, panicum virgatum, kalamazoo loam, mesic type hapludalf, kellogg biological station, depth 25-50cm)2021-08-03v4No1 / 974
821sheryoCommon in soil of switchgrass field at 25-50cm depth, Michigan USA (common united states of america, soil, state of michigan, panicum virgatum, kalamazoo loam, mesic type hapludalf, kellogg biological station, depth 25-50cm)2021-08-03v4No1 / 974
828sheryoCommon in gleysol soil of poplar plantation at 20-30cm depth, sihong, china (common soil, jiangsu province, depth (soil) 20-30cm, clay loam, ph 6-7, gleysol, china, sihong county, poplar, poplar plantation, chenwei forest)2021-08-25v4No1 / 989
462amnoncommon united states of america, state of tennessee, rhizosphere, populus, tree, depth 0-30cm, silt loam, cultivated environment2019-01-13v4No1 / 997
610sheryoCommon in agricultural field soil amended with straw (common soil, triticum aestivum, kingdom of denmark, wheat, ph 7, agricultural field, straw)2020-04-21v3No1 / 998
412amnon high in ph>5 compared to ph<5 in soil cambisol red soil zea mays triticum aestivum hunan province china 2018-11-26v4No1 / 1005
479amnoncommon united states of america, rhizosphere, state of california, ph 6-7, heteromeles arbutifolia2019-02-05v4No1 / 1006
610sheryoCommon in agricultural field soil amended with low biochar (common soil, triticum aestivum, kingdom of denmark, wheat, ph 7, agricultural field, low biochar)2020-04-21v3No1 / 1009
786sheryoCommon in flood plain soil near cosumnes river, california, at 100-133cm depth (common united states of america, soil, state of california, flood plain, sacramento, cosumnes river preserve, depth (soil) 100-133cm)2021-05-18v3No1 / 1015
628sheryocommon in bulk soil with barley plants after 180 days in treatments amended with biochar (common soil, bulk soil, hordeum vulgare, zhejiang province, depth (soil) 15cm, ph 4-5, biochar, china, quzhou county, days 180, mature barley plants)2020-05-18v4No1 / 1023
266amnoncommon in soil from PAR garden (common united states of america, soil, state of idaho, ph 5.5)2017-12-18v4No1 / 1032
801sheryoHigher at depth 0-15cm compared to depth 60-90cm in corn and soybean agriculture fields, Iowa USA ( high in depth 0-15cm compared to depth 60-90cm in soil zea mays glycine max iowa agricultural field united states des moines nicollet soil series kelley subsurface drainage )2021-06-16v4No1 / 1036
786sheryocommon in flood plain soil near cosumnes river, california, at 0-30cm depth (common united states of america, soil, state of california, depth 0-30cm, flood plain, sacramento, cosumnes river preserve)2021-05-18v3No1 / 1048
422amnoncommon soil, paddy field soil, oryza sativa, heilongjiang province, cultivated environment, china2018-12-02v4No1 / 1049
610sheryoCommon in agricultural field soil (common soil, triticum aestivum, kingdom of denmark, wheat, ph 7, agricultural field)2020-04-21v3No1 / 1053
828sheryoCommon in gleysol soil of poplar plantation at 0-10cm depth, sihong, china (common soil, jiangsu province, depth 0-10cm, clay loam, ph 6-7, gleysol, china, sihong county, poplar, poplar plantation, chenwei forest)2021-08-25v4No1 / 1069
610sheryoCommon in agricultural field soil amended with high biochar (common soil, triticum aestivum, kingdom of denmark, wheat, ph 7, agricultural field, high biochar)2020-04-21v3No1 / 1079
478amnoncommon farm, sediment, shrimp farm, china2019-02-19v4No1 / 1085
415amnoncommon orchard, soil, rhizosphere, brazil, citrus, cultivated environment2018-11-27v4No1 / 1091
414amnoncommon agricultural feature, soil, zea mays, glycine max, triticum aestivum, heilongjiang province, ph<6, black soil, mollisol, npk fertilizer, china2018-11-26v4No1 / 1105
101amnoncommon united states of america, vitis vinifera, state of new york, merlot, grapevine, root2017-04-03v4No1 / 1106
767sheryocommon in soil planted with Chrysanthemum, fertilized with bio-organic fertilizer, amended with soil fumigant 'Dazomet' and deep plough in Nanjing China (common soil, compost biofilter, pig manure, compost soil, paenibacillus, china, nanjing county, chrysanthemum, bio-organic fertilizer, conventional tillage, chrysanthemum morifolium ramat., ph 6.9, paenibacillus polymyxa, soil fumigation, dazomet, deep plough)2021-04-18v4No1 / 1109
827sheryoCommon in soil at 25cm depth in clayey till loam soil, Lund Denmark (common kingdom of denmark, depth (soil) 20-30cm, agricultural field, lund, loam soil, clayey till, late weichselian glaciation, plough layer )2021-08-24v3No1 / 1111
698amnoncommon control, park, rhizosphere, ph 6-7, depth 0-30cm, united kingdom, quercus, oak2028-04-01v3No1 / 1115
828sheryoCommon in gleysol soil of poplar plantation at 10-20cm depth, sihong, china (common soil, jiangsu province, clay loam, ph 6-7, gleysol, china, sihong county, poplar, depth 10-20cm, poplar plantation, chenwei forest)2021-08-25v4No1 / 1123
515amnon high in carabidae compared to staphylinidae in river poland whole body beetle carnivorous beetle 2019-04-19v4No1 / 1130
146amnon high in soil compared to rhizosphere in united states of america solanum lycopersicum tomato ph 6 slit loam 2017-04-20v4No1 / 1135
628sheryocommon in bulk soil with barley plants after 180 days in treatments unamended with biochar (common soil, bulk soil, hordeum vulgare, zhejiang province, depth (soil) 15cm, ph 4-5, china, quzhou county, days 180, mature barley plants)2020-05-18v4No1 / 1136
146amnoncommon united states of america, soil, solanum lycopersicum, tomato, slit loam soil, ph 62017-04-20v4No1 / 1144
422amnoncommon soil, paddy field soil, oryza sativa, heilongjiang province, ph 7-8, cultivated environment, china2018-12-04v4No1 / 1169
786sheryoCommon in flood plain soil near cosumnes river, california, at 30-60cm depth (common united states of america, soil, state of california, flood plain, sacramento, cosumnes river preserve, depth (soil) 30-60cm)2021-05-18v3No1 / 1180
615amnon high in rhizosphere compared to soil in brazil greenhouse campinas saccharum sugarcane 2020-04-27v4No1 / 1181
628sheryocommon in rhizosphere of barley roots after 180 days in treatments amended with biochar (common soil, rhizosphere, hordeum vulgare, zhejiang province, depth (soil) 15cm, ph 4-5, biochar, china, quzhou county, days 180, mature barley plants)2020-05-18v4No1 / 1192
421amnoncommon soil, paddy field soil, zhejiang province, china2018-12-04v4No1 / 1194
823sheryoCommon at 0-15cm depth in foot slope ultisol soil in auburn, alabama (common soil, agricultural field, ultisol, auburn, alabama, depth 0-15cm, foot slope )2021-08-08v3No1 / 1199
801sheryoCommon at depth 0-15cm in corn and soybean agriculture fields, Iowa USA (common soil, zea mays, glycine max, iowa, agricultural field, united states, des moines, depth 0-15cm, nicollet soil series, kelley, ph 6.2, subsurface drainage)2021-06-15v4No1 / 1202
628sheryocommon in rhizosphere of barley roots after 180 days in treatments unamended with biochar (common soil, rhizosphere, hordeum vulgare, zhejiang province, depth (soil) 15cm, ph 4-5, china, quzhou county, days 180, mature barley plants)2020-05-18v4No1 / 1209
823sheryoCommon at 15-30cm depth in foot slope ultisol soil in auburn, alabama (common soil, agricultural field, ultisol, auburn, alabama, depth 15-30cm, foot slope )2021-08-08v3No1 / 1218
444amnonlower in continuously cropped strawberry soil ( high in age 1 year compared to age 5 years age 10 years continuous cropping in farm greenhouse soil rhizosphere fragaria x ananassa nanjing city prefecture strawberry yellow brown soil cultivated environment china )2019-01-07v4No1 / 1221
801sheryoCommon in soybean and corn agriculture fields at depth 0-15cm, Iowa USA (common soil, zea mays, glycine max, iowa, agricultural field, united states, ames, des moines, ph 7.5, depth 0-15cm, nicollet soil series)2021-06-15v4No1 / 1226
423amnon high in no human contact chernobyl exclusion zone compared to human contact in skin ukraine bank vole myodes glareolus 2018-12-05v4No1 / 1229
798amnoncommon orchard, soil, italy, depth 10 cm, ph 7-8, apennine mountains, prunus armeniaca, apricot2021-06-13v3No1 / 1230
821sheryoCommon in soil of restored prairie at 10-25cm depth, Michigan USA (common united states of america, soil, state of michigan, kalamazoo loam, mesic type hapludalf, kellogg biological station, depth 10-25cm, restored prairie)2021-07-28v4No1 / 1241
837sheryoCommon in agricultural field at depths 40-100cm, shaanxi, China (common soil, zea mays, triticum aestivum, silt loam, agricultural field, china, shaanxi province, loess plateau, depth 40-100cm)2021-09-26v4No1 / 1263
415amnoncommon orchard, soil, rhizosphere, italy, citrus, cultivated environment2018-11-27v4No1 / 1279
788amnon high in soil compared to plant litter in united states of america state of georgia mesocosm 2021-05-31v4No1 / 1280
414amnoncommon agricultural feature, soil, zea mays, glycine max, triticum aestivum, heilongjiang province, ph>6, black soil, mollisol, china2018-11-26v4No1 / 1282
798amnon high in soil ph 7-8 compared to hay plant litter litter bag in orchard italy depth 10 cm apennine mountains prunus armeniaca apricot 2021-06-13v3No1 / 1285
821sheryoCommon in soil of restored prairie at 0-10cm depth, Michigan USA (common united states of america, soil, state of michigan, depth 0-10cm, ph 6.5, kalamazoo loam, mesic type hapludalf, kellogg biological station, restored prairie)2021-07-28v4No1 / 1291
837sheryoCommon in soil at 0-40-100cm depth after 20 years reforestation with Black locust trees, shaanxi, China (common soil, silt loam, reforestation, china, shaanxi province, loess plateau, robinia pseudoacacia, depth 40-100cm, 20 years)2021-09-26v4No1 / 1294
266amnonCommon in soil from MAH garden (common united states of america, soil, state of idaho, ph 6)2017-12-18v4No1 / 1299
837sheryoCommon in soil at 40-100cm depth after 30 years reforestation with Black locust trees, shaanxi, China (common soil, silt loam, reforestation, china, shaanxi province, loess plateau, robinia pseudoacacia, depth 40-100cm, 30 years)2021-09-26v4No1 / 1311
101amnon high in rhizosphere compared to root in united states of america vitis vinifera state of new york merlot grapevine 2017-04-03v4No1 / 1315
837sheryoCommon in soil at 100-300cm depth after 20 years reforestation with Black locust trees, shaanxi, China (common soil, silt loam, reforestation, china, shaanxi province, loess plateau, robinia pseudoacacia, depth 100-300cm, 20 years)2021-09-26v4No1 / 1317
837sheryoבCommon in soil at 0-40cm depth after 20 years reforestation with Black locust trees, shaanxi, China (common soil, silt loam, reforestation, china, shaanxi province, loess plateau, robinia pseudoacacia, depth 0-40cm, 20 years)2021-09-26v4No1 / 1323
600sheryoCommon in biochar ammended soil after 82 days (common united states of america, soil, state of new york, depth 0-5cm, ph 6, biochar, coarse-loamy soil, day 82)2020-03-27v4No1 / 1326
600sheryoCommon in stover ammended soil after 82 days (common united states of america, soil, state of new york, depth 0-5cm, ph 6, coarse-loamy soil, day 82, stover ammendment )2020-03-27v4No1 / 1327
259amnoncommon in soil and rhizpsphere of peanut plants (common soil, rhizosphere, arachis hypogaea, ph 5, peanut, china)2017-12-02v4No1 / 1334
98amnoncommon rhizosphere, state of florida, citrus, ft. pierce, fl, root2017-04-01v4No1 / 1340
837sheryoCommon in soil at 0-40 cm depth after 30 years reforestation with Black locust trees, shaanxi, China (common soil, silt loam, reforestation, china, shaanxi province, loess plateau, robinia pseudoacacia, depth 0-40cm, 30 years)2021-09-26v4No1 / 1346
837sheryoCommon in soil at 100-300cm depth after 30 years reforestation with Black locust trees, shaanxi, China (common soil, silt loam, reforestation, china, shaanxi province, loess plateau, robinia pseudoacacia, depth 100-300cm, 30 years)2021-09-26v4No1 / 1354
809amnoncommon research facility, rhizosphere, greenhouse, china, lu'an city prefecture, dendrobium huoshanense, flowerpot2021-06-20v4No1 / 1356
821sheryoCommon in soil of miscanthus field at 10-25cm depth, Michigan USA (common united states of america, soil, state of michigan, miscanthus, kalamazoo loam, mesic type hapludalf, kellogg biological station, depth 10-25cm, restored prairie)2021-08-02v4No1 / 1377
821sheryoCommon in soil of continuous corn field at 0-10cm depth, Michigan USA (common united states of america, soil, state of michigan, depth 0-10cm, corn, ph 5.9, continuous corn, kalamazoo loam, mesic type hapludalf, kellogg biological station)2021-07-28v4No1 / 1380
821sheryoCommon in soil of switchgrass field at 10-25cm depth, Michigan USA (common united states of america, soil, state of michigan, panicum virgatum, kalamazoo loam, mesic type hapludalf, kellogg biological station, depth 10-25cm)2021-08-02v4No1 / 1387
266amnoncommon in soil from SIL garden (common united states of america, soil, state of idaho, ph 6)2017-12-18v4No1 / 1389
600sheryoCommon in unammended soil after 82 days (common united states of america, soil, state of new york, depth 0-5cm, ph 6, coarse-loamy soil, day 82)2020-03-27v4No1 / 1395
788amnon high in soil compared to feces cherokia georgiana georgiana millipede in united states of america state of georgia mesocosm 2021-05-31v4No1 / 1395
422amnoncommon soil, paddy field soil, oryza sativa, hubei province, hunan province, cultivated environment, china2018-12-02v4No1 / 1399
76amnoncommon in non-seleniferous soil (common united states of america, soil, rhizosphere, state of florida, non-seleniferous)2017-02-28v4No1 / 1414
40amnoncommon soil, field soil, rhizosphere, nicotiana tabacum, china2016-12-09v4No1 / 1420
444amnoncommon farm, greenhouse soil, rhizosphere, fragaria x ananassa, nanjing city prefecture, age 1 year, strawberry, yellow brown soil, cultivated environment, china2019-01-07v4No1 / 1439
821sheryoCommon in soil of miscanthus field at 0-10cm depth, Michigan USA (common united states of america, soil, state of michigan, depth 0-10cm, miscanthus, kalamazoo loam, mesic type hapludalf, kellogg biological station, restored prairie)2021-07-28v4No1 / 1447
266amnoncommon in soil from JAM garden (common united states of america, soil, state of idaho, ph 5.5)2017-12-18v4No1 / 1456
271amnoncommon rhizosphere, glycine max, soybean, depth 0-20cm, china2018-01-09v4No1 / 1459
760sheryoCommon in rhizosphere soil of rice plants with NPK fertilization in a long term fertilization experiment (common soil, rhizosphere, oryza sativa, hunan province, npk fertilizer, china, qiyang county, quaternary red clay, ph 5.9, npk fertilization)2021-04-06v4No1 / 1491
760sheryoCommon in rhizosphere soil of rice plants without fertilization in a long term fertilization experiment (common soil, rhizosphere, oryza sativa, hunan province, china, qiyang county, quaternary red clay, no fertilization, ph 5.9)2021-04-06v4No1 / 1506
145amnoncommon united states of america, soil, rhizosphere, oryza sativa, rice, ph 5.62017-04-19v4No1 / 1515
515amnon high in bulgaria detritivorous beetle compared to poland herbivorous beetle in whole body beetle 2019-04-19v4No1 / 1543
600sheryolower in stover ammendment soil ( high in unamended soil compared to stover amended in united states of america soil state of new york depth 0-5cm ph 6 coarse-loamy soil day 82 )2020-03-27v4No1 / 1612
76amnonhigher in non-seleniferous soil compared to seleniferous soil ( high in non-seleniferous compared to selenium seleniferous in united states of america soil rhizosphere woodland area )2017-02-28v4No1 / 1621
631sheryocommon in maize field unamended rhizosphere soil (common soil, rhizosphere, maize field, china, guizhou province, kaiyang county, unamended soil, after 6 years, ph 7.6)2020-06-02v3No1 / 1637
821sheryoCommon in soil of continuous corn field at 10-25cm depth, Michigan USA (common united states of america, soil, state of michigan, corn, continuous corn, kalamazoo loam, mesic type hapludalf, kellogg biological station, depth 10-25cm)2021-07-28v4No1 / 1649
686sheryoCommon in vanilla field soil infected with Fusarium oxysporum, fertilized with fungal bio-fertilizer and had low Fusarium cumulative disease incidence (common wanning city, vanilla planifolia, ph 7.6, pot expreiment, soil from vanilla field, fusarium oxysporum f. sp. vanillae, low fusarium cumulative disease incidence , fungal enriched bio-fertilizer, trichoderma guizhouense njau 4742)2028-03-08v4No1 / 1661
760sheryoCommon in rhizosphere soil of rice plants with manure fertilization in a long term fertilization experiment (common soil, manured soil, rhizosphere, oryza sativa, hunan province, china, qiyang county, quaternary red clay, ph 5.9, manure fertilization)2021-04-06v4No1 / 1670
507amnonhigher in mine tailing contaminated sediment compared to uncontaminated control ( high in contaminated sediment compared to control in lake sediment sediment canada province of british columbia quesnel lake )2019-03-17v4No1 / 1681
686sheryoCommon in vanilla field soil infected with Fusarium oxysporum, fertilized with bacterial bio-fertilizer and had low Fusarium cumulative disease incidence (common wanning city, vanilla planifolia, ph 7.6, pot expreiment, soil from vanilla field, fusarium oxysporum f. sp. vanillae, bacterial enriched bio-fertilizer, bacillus amyloliquefaciens w19, low fusarium cumulative disease incidence )2028-03-08v4No1 / 1726
686sheryoCommon in vanilla field soil infected with Fusarium oxysporum, fertilized with organic fertilizer and had high Fusarium cumulative disease incidence (common wanning city, vanilla planifolia, ph 7.6, pot expreiment, soil from vanilla field, fusarium oxysporum f. sp. vanillae, high fusarium cumulative disease incidence , organic fertilizer- chicken manure compost)2028-03-08v4No1 / 1765
156amnoncommon soil, rhizosphere, brassica oleracea, brassica, china2017-07-27v4No1 / 1885
296amnoncommon agricultural feature, soil, winter, wheat, depth 0-20cm, north china plain, ph>4, ph<5, china2018-02-11v4No1 / 1886
155amnoncommon in soil tightly bound to wheat root (common soil, triticum aestivum, wheat, root, china)2017-07-02v4No1 / 1977
101amnoncommon united states of america, rhizosphere, vitis vinifera, state of new york, merlot, grapevine2017-04-03v4No1 / 1980
821sheryoCommon in soil of switchgrass field at 0-10cm depth, Michigan USA (common united states of america, soil, state of michigan, depth 0-10cm, panicum virgatum, kalamazoo loam, mesic type hapludalf, kellogg biological station)2021-08-02v4No1 / 2067
296amnoncommon agricultural feature, soil, winter, wheat, depth 0-20cm, north china plain, ph>7, ph<8, china2018-02-11v4No1 / 2160
296amnoncommon agricultural feature, soil, winter, wheat, depth 0-20cm, north china plain, ph>6, ph<7, china2018-02-11v4No1 / 2223
166amnoncommon in river sediment (5cm) with mussels (common united states of america, river, sediment, freshwater biome, mississippi river, depth 5cm, upper mississippi river, mussel, unionidae)2017-07-18v4No1 / 2254
443amnon high in particles filtered 2.7um compared to free floating filtered 0.2um in united states of america river water fresh water mississippi river depth 1m 2019-01-07v4No1 / 2266
296amnoncommon in wheat field soil (common agricultural feature, soil, winter, depth 5cm, wheat, north china plain, china)2018-02-11v4No1 / 2341
155amnoncommon in soil loosely bound to wheat root (common soil, rhizosphere, triticum aestivum, wheat, china)2017-07-02v4No1 / 2425
101amnoncommon united states of america, soil, vitis vinifera, state of new york, merlot, grapevine2017-04-03v4No1 / 2537
155amnoncommon in bulk soil in wheat field (common soil, bulk soil, triticum aestivum, wheat, china)2017-07-02v4No1 / 2594
296amnoncommon agricultural feature, soil, winter, wheat, depth 0-20cm, north china plain, ph>8, china2018-02-11v4No1 / 2646
357amnon high in ph>4.5 compared to ph<4.5 in soil topsoil depth 0-10cm moist tropical forest woodland area forest ecosystem 2018-08-18v4No1 / 2773
271amnoncommon soil, depth 0-20cm, china2018-01-09v4No1 / 2856
84amnoncommon fen, soil, peat soil, temperate grassland biome, flooded grassland biome, depth 20 cm, united kingdom2017-03-06v4No1 / 2866
166amnoncommon in river sediment (5cm) without mussels (common united states of america, river, sediment, freshwater biome, mississippi river, depth 5cm, upper mississippi river)2017-07-18v4No1 / 2877
837sheryoHigher in soil in agricultural feild compared after 10 years reforestation with Black locust trees, shaanxi, China ( high in zea mays triticum aestivum agricultural field compared to reforestation robinia pseudoacacia 10 years in soil silt loam china shaanxi province loess plateau )2021-09-26v4No1 / 2994
265amnon high in water soilwater compared to soil in canada province of quebec 2017-12-11v4No1 / 3277
84amnoncommon fen, soil, peat soil, temperate grassland biome, flooded grassland biome, depth 5 cm, united kingdom2017-03-07v4No1 / 3434
296amnoncommon agricultural feature, soil, winter, wheat, depth 0-20cm, north china plain, ph>5, ph<6, china2018-02-11v4No1 / 3508
103amnonhigher in particle bound fraction compared to free floating bacteria in mississippi river ( high in particles compared to free floating in united states of america river aquatic biome fresh water mississippi river )2017-04-05v4No1 / 3559
837sheryoHigher in soil after 20 years compared to 30 years of reforestation with Black locust trees, shaanxi, China ( high in 20 years compared to 30 years in soil silt loam reforestation china shaanxi province loess plateau robinia pseudoacacia )2021-09-27v4No1 / 3893
462amnon high in rhizosphere compared to root in united states of america state of tennessee populus tree cultivated environment 2019-01-13v4No1 / 4630
271amnon high in soil compared to rhizosphere glycine max soybean in depth 0-20cm china 2018-01-09v4No1 / 4853
837sheryoHigher in soil after 30 years compared to 10 years of reforestation with Black locust trees, shaanxi, China ( high in 30 years compared to 10 years in soil silt loam reforestation china shaanxi province loess plateau robinia pseudoacacia )2021-09-27v4No1 / 5245
837sheryoHigher in soil after 20 years compared to 10 years of reforestation with Black locust trees, shaanxi, China ( high in 20 years compared to 10 years in soil silt loam reforestation china shaanxi province loess plateau robinia pseudoacacia )2021-09-27v4No1 / 5270
837sheryoHigher in soil after 30 years reforestation with Black locust trees compared to agricultural feild, shaanxi, China ( high in reforestation robinia pseudoacacia 30 years compared to zea mays triticum aestivum agricultural field in soil silt loam china shaanxi province loess plateau )2021-09-27v4No1 / 5596
837sheryoHigher in soil after 20 years reforestation with Black locust trees compared agricultural feild, shaanxi, China ( high in reforestation robinia pseudoacacia 20 years compared to zea mays triticum aestivum agricultural field in soil silt loam china shaanxi province loess plateau )2021-09-26v4No1 / 5661
266amnon high in root compared to leaf in united states of america state of idaho plant brassicaceae boechera stricta 2017-12-19v4No1 / 5886
171amnonlower in roots compared to rhizosphere soil in rice ( high in soil rhizosphere compared to root in united states of america oryza sativa state of california rice )2017-07-25v4No1 / 7628
271amnon high in soil rhizosphere compared to root structure root in glycine max soybean depth 0-20cm china 2018-01-09v4No1 / 7954

Problems / suggestions? Please email info AT dbbact DOT org