Search result for sequence:
TACAGAGGTCTCAAGCGTTGTTCGGATTCATTGGGCGTAAAGGGTGCGTAGGTGGCGCGCTAAGTCAGGTGTGAAATTTCGGAGCTTAACTCCGAAACTGCATTTGATACTGGCGTGCTTGAGGACTGGAGAGGAGACTGGAATTCACGG
common ontology terms
term enrichment score
TermScore
soil0.338235
rhizosphere0.281081
cultivated environment0.191489
mexico0.173913
brazil0.159645
citrus0.141176
silt loam0.136364
desert0.127660
depth (soil) 0-10cm0.125000
myrtillocactus geometrizans0.125000
opuntia robusta0.125000
minas gerais state0.125000
campos rupestres0.125000
cactus0.117647
semi-arid0.117647
root0.112676
topsoil0.108108
forest ecosystem0.108108
merlot0.102564
grapevine0.102564
guanajuato0.102564
wanning city0.102564
vanilla planifolia0.102564
soil from vanilla field0.102564
fusarium oxysporum f. sp. vanillae0.102564
kellogg biological station0.102564
mesic type hapludalf0.102564
kalamazoo loam0.102564
robinia pseudoacacia0.102564
reforestation0.102564
shaanxi province0.102564
glycine max0.100840
vitis vinifera0.097561
loess plateau0.097561
orchard0.093023
pot expreiment0.093023
state of tennessee0.088889
ph 7.60.085106
china0.080223
ph 6-6.50.078947
agave0.078947
barbacenia macrantha0.078947
greenhouse0.075949
depth (soil) 10-25cm0.075949
state of michigan0.072727
LOWER IN root0.070588
woodland area0.070175
leaf0.065934
state of new york0.065574
united states of america0.061611
soybean0.054795
tomato0.054054
arachis hypogaea0.054054
peanut0.054054
agave salmiana0.054054
populus0.054054
difenoconazole0.054054
fungicide0.054054
tobacco field0.054054
limestone0.054054
campinas0.054054
restored prairie0.054054
panicum virgatum0.054054
20 years0.054054
30 years0.054054
LOWER IN 10 years0.054054
leaf surface0.053333
depth (soil) 0-20cm0.052632
heilongjiang province0.052632
black soil0.052632
mollisol0.052632
ph>60.052632
depth 0-20cm0.052632
saccharum0.052632
sugarcane0.052632
high fusarium cumulative disease incidence 0.052632
low fusarium cumulative disease incidence 0.052632
corn0.052632
LOWER IN rhizosphere0.051282
depth (soil) 0-30 cm0.051282
ph 50.050000
ph 60.048780
solanum lycopersicum0.047619
zea mays0.044444
tree0.044444
LOWER IN zea mays0.044444
triticum aestivum0.043478
LOWER IN triticum aestivum0.043478
LOWER IN agricultural field0.042553
agricultural feature0.040816
skin0.038462
state of florida0.037736
farm0.037383
ph 7-80.037037
state of california0.032258
field soil0.027778
quincy, fl0.027778
gainesville, fl0.027778
central park0.027778
root zone soil0.027778
Fraction of dbbact annotations with this term covered by the query
TermScore
soybean0.666667
field soil0.500000
quincy, fl0.500000
gainesville, fl0.500000
central park0.500000
merlot0.500000
grapevine0.500000
myrtillocactus geometrizans0.500000
opuntia robusta0.500000
ph 6-6.50.500000
root zone soil0.500000
tomato0.500000
slit loam soil0.500000
slit loam0.500000
arachis hypogaea0.500000
peanut0.500000
ph 5.50.500000
ph 5.40.500000
moist tropical forest0.500000
ph>4.50.500000
LOWER IN ph<4.50.500000
montane forest0.500000
mediterranean forest biome0.500000
savanna0.500000
guanajuato0.500000
agave0.500000
agave salmiana0.500000
LOWER IN agave0.500000
reunion island0.500000
LOWER IN detph 30-75cm0.500000
LOWER IN silt clay loam0.500000
depth 30-75cm0.500000
silt clay loam0.500000
populus0.500000
sandstone0.500000
grand staircase-escalante national park0.500000
depth (soil) 0-1cm0.500000
minas gerais state0.500000
campos rupestres0.500000
ph 3.50.500000
barbacenia macrantha0.500000
tobacco plant present0.500000
difenoconazole0.500000
fungicide0.500000
tobacco field0.500000
limestone0.500000
presence of tobacco plants0.500000
LOWER IN absence of tobacco plants0.500000
campinas0.500000
wanning city0.500000
vanilla planifolia0.500000
soil from vanilla field0.500000
fusarium oxysporum f. sp. vanillae0.500000
organic fertilizer- chicken manure compost0.500000
bacterial enriched bio-fertilizer0.500000
bacillus amyloliquefaciens w190.500000
fungal enriched bio-fertilizer0.500000
nanjing county0.500000
chrysanthemum0.500000
chrysanthemum morifolium ramat.0.500000
soil fumigation0.500000
dazomet0.500000
dendrobium huoshanense0.500000
lu'an city prefecture0.500000
flowerpot0.500000
temperate rainforest0.500000
olympic national park0.500000
kellogg biological station0.500000
mesic type hapludalf0.500000
kalamazoo loam0.500000
continuous corn0.500000
restored prairie0.500000
panicum virgatum0.500000
miscanthus0.500000
robinia pseudoacacia0.500000
reforestation0.500000
20 years0.500000
shaanxi province0.500000
30 years0.500000
LOWER IN 10 years0.500000
glycine max0.428571
citrus0.400000
leaf surface0.400000
cultivated environment0.375000
nicotiana tabacum0.333333
park0.333333
ph<60.333333
LOWER IN ph&gt;60.333333
vitis vinifera0.333333
cactus0.333333
semi-arid0.333333
ph 5.60.333333
foot0.333333
LOWER IN non-fertilized soil0.333333
state of idaho0.333333
LOWER IN soybean0.333333
hokkaido0.333333
venezuela0.333333
amerindian0.333333
heilongjiang province0.333333
Fraction of annotations for the query sequences containing the term
TermScore
soil0.657143
rhizosphere0.285714
united states of america0.271429
china0.228571
mexico0.142857
brazil0.128571
cultivated environment0.128571
citrus0.085714
depth (soil) 0-10cm0.085714
desert0.085714
silt loam0.085714
root0.071429
myrtillocactus geometrizans0.071429
opuntia robusta0.071429
cactus0.071429
semi-arid0.071429
topsoil0.071429
forest ecosystem0.071429
minas gerais state0.071429
campos rupestres0.071429
state of new york0.057143
merlot0.057143
vitis vinifera0.057143
grapevine0.057143
depth (soil) 0-20cm0.057143
glycine max0.057143
woodland area0.057143
guanajuato0.057143
orchard0.057143
state of tennessee0.057143
ph 7.60.057143
wanning city0.057143
pot expreiment0.057143
vanilla planifolia0.057143
soil from vanilla field0.057143
fusarium oxysporum f. sp. vanillae0.057143
state of michigan0.057143
kellogg biological station0.057143
mesic type hapludalf0.057143
kalamazoo loam0.057143
robinia pseudoacacia0.057143
reforestation0.057143
loess plateau0.057143
shaanxi province0.057143
LOWER IN root0.042857
leaf0.042857
ph 6-6.50.042857
LOWER IN rhizosphere0.042857
agave0.042857
barbacenia macrantha0.042857
greenhouse0.042857
depth (soil) 10-25cm0.042857
state of florida0.028571
solanum lycopersicum0.028571
tomato0.028571
ph 60.028571
homo sapiens0.028571
skin0.028571
ph 50.028571
arachis hypogaea0.028571
peanut0.028571
soybean0.028571
state of california0.028571
leaf surface0.028571
agave salmiana0.028571
heilongjiang province0.028571
agricultural feature0.028571
triticum aestivum0.028571
zea mays0.028571
black soil0.028571
mollisol0.028571
ph>60.028571
depth (soil) 0-30 cm0.028571
populus0.028571
tree0.028571
farm0.028571
difenoconazole0.028571
fungicide0.028571
ph 7-80.028571
tobacco field0.028571
limestone0.028571
depth 0-20cm0.028571
saccharum0.028571
sugarcane0.028571
campinas0.028571
high fusarium cumulative disease incidence 0.028571
low fusarium cumulative disease incidence 0.028571
corn0.028571
restored prairie0.028571
panicum virgatum0.028571
LOWER IN triticum aestivum0.028571
LOWER IN zea mays0.028571
LOWER IN agricultural field0.028571
20 years0.028571
30 years0.028571
LOWER IN 10 years0.028571
field soil0.014286
nicotiana tabacum0.014286
quincy, fl0.014286
gainesville, fl0.014286
Exp. ID User ID Description Date Region Flag Sequences
129amnondominant ph 6-6.5, mexico, myrtillocactus geometrizans, opuntia robusta, cactus, semi-arid, soil2017-04-15v4No1 / 9
609sheryohigher in soil with tobacco plants and with difenoconazole fungicide ( high in presence of tobacco plants compared to absence of tobacco plants in difenoconazole fungicide ph 7-8 china tobacco field limestone depth 0-20cm soil )2020-04-21v4No1 / 131
514amnoncommon united states of america, state of utah, sandstone, grand staircase-escalante national park, desert, depth (soil) 0-1cm2019-03-25v4No1 / 139
259amnonhigher in fertilized soil (npk) compared to non-fertilized ( high in fertilized soil compared to non-fertilized soil in soil rhizosphere ph 5 arachis hypogaea peanut china )2017-12-02v4No1 / 280
129amnoncommon mexico, myrtillocactus geometrizans, opuntia robusta, cactus, rhizosphere, semi-arid2017-04-15v4No1 / 338
360amnoncommon desert, soil, mexico, guanajuato2018-08-21v4No1 / 437
360amnoncommon desert, soil, rhizosphere, agave, agave salmiana, mexico, guanajuato2018-08-21v4No1 / 484
360amnoncommon agave, desert, leaf, leaf surface, agave salmiana, mexico, guanajuato2018-08-21v4No1 / 492
415amnoncommon rhizosphere, soil, citrus, orchard, united states of america, cultivated environment2018-11-27v4No1 / 494
548amnoncommon in leaf surface of barbacenia macrantha (common minas gerais state, campos rupestres, brazil, barbacenia macrantha, leaf, leaf surface)2019-08-17v4No1 / 550
129amnoncommon mexico, myrtillocactus geometrizans, opuntia robusta, cactus, semi-arid, leaf2017-04-15v4No1 / 562
357amnoncommon soil, topsoil, depth (soil) 0-10cm, mediterranean forest biome, forest ecosystem, woodland area2018-08-19v4No1 / 564
548amnoncommon minas gerais state, campos rupestres, brazil, barbacenia macrantha, root endosphere, root2019-08-17v4No1 / 575
357amnoncommon soil, topsoil, depth (soil) 0-10cm, montane forest, woodland area, forest ecosystem2018-08-19v4No1 / 592
357amnoncommon soil, topsoil, depth (soil) 0-10cm, savanna, forest ecosystem, woodland area2018-08-19v4No1 / 614
548amnoncommon minas gerais state, campos rupestres, brazil, barbacenia macrantha, rhizosphere2019-08-17v4No1 / 651
609sheryocommon in soil with tobacco plants amended with difenoconazole fungicide (common tobacco plant present, difenoconazole, fungicide, ph 7-8, china, tobacco field, limestone, depth 0-20cm, soil)2020-04-21v4No1 / 671
232amnonlower in diabetec patient foot skin compared to healthy controls ( high in control compared to diabetes mellitus in homo sapiens skin australia foot )2017-11-05v4No1 / 708
415amnoncommon rhizosphere, soil, citrus, orchard, reunion island, cultivated environment2018-11-27v4No1 / 721
813amnoncommon forested area, temperate rainforest, united states of america, state of washington, olympic national park, soil2021-06-22v4No1 / 740
615amnoncommon endosphere, root, saccharum, sugarcane, campinas, brazil, greenhouse2020-04-27v4No1 / 776
415amnoncommon rhizosphere, soil, citrus, orchard, china, cultivated environment2018-11-27v4No1 / 830
356amnoncommon in deciduous broad leaved forest top soil in japan (common soil, depth (soil) 0-10cm, hokkaido, topsoil, ph 5.4, japan, forest ecosystem)2018-08-15v4No1 / 834
371amnonhigher in skin of amerindians compared to western visitors ( high in venezuela hunter gatherer amerindian compared to city united states of america in homo sapiens skin )2018-09-06v4No1 / 854
129amnoncommon ph 6-6.5, mexico, myrtillocactus geometrizans, opuntia robusta, cactus, semi-arid, soil2017-04-15v4No1 / 884
462amnoncommon depth (soil) 20-60cm, united states of america, state of tennessee, depth 30-75cm, silt clay loam, rhizosphere, populus, tree, cultivated environment2019-01-13v4No1 / 908
548amnoncommon minas gerais state, campos rupestres, brazil, rock2019-08-17v4No1 / 924
462amnoncommon depth (soil) 0-30 cm, depth (soil) 0-20cm, united states of america, state of tennessee, soil, silt loam, cultivated environment2019-01-13v4No1 / 938
767sheryoCommon in soil planted with Chrysanthemum, amended with soil fumigant 'Dazomet' in Nanjing China (common nanjing county, china, chrysanthemum, chrysanthemum morifolium ramat., ph 6.9, soil, soil fumigation, dazomet)2021-04-14v4No1 / 946
98amnoncommon citrus, rhizosphere, quincy, fl, root, state of florida2017-04-01v4No1 / 950
129amnoncommon ph 6-6.5, mexico, myrtillocactus geometrizans, opuntia robusta, cactus, semi-arid, soil, root zone soil2017-04-15v4No1 / 968
480amnoncommon soil, pasture, farm, new zealand2019-02-05v4No1 / 970
474amnoncommon soil, farm, glycine max, soybean, ph 4-6, brazil, cultivated environment2019-01-16v4No1 / 974
615amnoncommon saccharum, sugarcane, rhizosphere, campinas, brazil, greenhouse2020-04-27v4No1 / 974
360amnon high in soil compared to agave rhizosphere in desert mexico state of california 2018-08-21v4No1 / 992
415amnoncommon rhizosphere, soil, citrus, orchard, brazil, cultivated environment2018-11-27v4No1 / 1091
101amnoncommon state of new york, merlot, vitis vinifera, grapevine, united states of america, root2017-04-03v4No1 / 1106
360amnonlower in leaf surface compared to soil in agave plants ( high in soil compared to leaf leaf surface in desert state of california mexico guanajuato agave )2018-08-21v4No1 / 1108
146amnon high in soil compared to rhizosphere in united states of america solanum lycopersicum tomato slit loam ph 6 2017-04-20v4No1 / 1135
146amnoncommon united states of america, solanum lycopersicum, tomato, soil, slit loam soil, ph 62017-04-20v4No1 / 1144
821sheryoCommon in soil of restored prairie at 10-25cm depth, Michigan USA (common depth (soil) 10-25cm, restored prairie, united states of america, state of michigan, kellogg biological station, mesic type hapludalf, kalamazoo loam, soil)2021-07-28v4No1 / 1241
414amnoncommon soil, heilongjiang province, agricultural feature, triticum aestivum, glycine max, zea mays, black soil, mollisol, ph>6, china2018-11-26v4No1 / 1282
259amnoncommon in soil and rhizpsphere of peanut plants (common soil, rhizosphere, ph 5, arachis hypogaea, peanut, china)2017-12-02v4No1 / 1334
809amnoncommon dendrobium huoshanense, lu'an city prefecture, flowerpot, research facility, greenhouse, rhizosphere, china2021-06-20v4No1 / 1356
98amnoncommon citrus, rhizosphere, gainesville, fl, root, state of florida2017-04-01v4No1 / 1371
40amnoncommon soil, field soil, nicotiana tabacum, rhizosphere, china2016-12-09v4No1 / 1420
414amnon high in ph>6 compared to ph<6 npk fertilizer in soil heilongjiang province agricultural feature triticum aestivum glycine max zea mays black soil mollisol china 2018-11-26v4No1 / 1451
266amnoncommon in soil from JAM garden (common soil, united states of america, state of idaho, ph 5.5)2017-12-18v4No1 / 1456
686sheryoCommon in vanilla field soil infected with Fusarium oxysporum, fertilized with chemical fertilizer and had high Fusarium cumulative disease incidence (common ph 7.6, wanning city, pot expreiment, vanilla planifolia, soil from vanilla field, fusarium oxysporum f. sp. vanillae, chemical fertilization n,p,k, high fusarium cumulative disease incidence )2028-03-08v4No1 / 1456
548amnoncommon in phosphorus impoverished soil (common soil, minas gerais state, campos rupestres, brazil, ph 3.5)2019-08-15v4No1 / 1483
145amnoncommon soil, rhizosphere, oryza sativa, rice, united states of america, ph 5.62017-04-19v4No1 / 1515
101amnon high in rhizosphere compared to root in state of new york vitis vinifera united states of america merlot grapevine 2017-04-03v4No1 / 1588
462amnon high in depth (soil) 0-30 cm depth (soil) 0-20cm silt loam compared to detph 30-75cm silt clay loam in soil united states of america state of tennessee cultivated environment 2019-01-12v4No1 / 1648
821sheryoCommon in soil of continuous corn field at 10-25cm depth, Michigan USA (common depth (soil) 10-25cm, united states of america, state of michigan, kellogg biological station, mesic type hapludalf, kalamazoo loam, continuous corn, corn, soil)2021-07-28v4No1 / 1649
686sheryoCommon in vanilla field soil infected with Fusarium oxysporum, fertilized with fungal bio-fertilizer and had low Fusarium cumulative disease incidence (common trichoderma guizhouense njau 4742, fungal enriched bio-fertilizer, fusarium oxysporum f. sp. vanillae, soil from vanilla field, vanilla planifolia, pot expreiment, wanning city, ph 7.6, low fusarium cumulative disease incidence )2028-03-08v4No1 / 1661
821sheryoHigher at 10-25cm depth compared to 25-50cm depth in soil in Michigan USA ( high in depth (soil) 10-25cm compared to depth (soil) 25-50cm in restored prairie corn miscanthus panicum virgatum kellogg biological station mesic type hapludalf kalamazoo loam state of michigan soil united states of america )2021-08-05v4No1 / 1704
686sheryoCommon in vanilla field soil infected with Fusarium oxysporum, fertilized with bacterial bio-fertilizer and had low Fusarium cumulative disease incidence (common fusarium oxysporum f. sp. vanillae, soil from vanilla field, vanilla planifolia, pot expreiment, wanning city, ph 7.6, bacterial enriched bio-fertilizer, bacillus amyloliquefaciens w19, low fusarium cumulative disease incidence )2028-03-08v4No1 / 1726
686sheryoCommon in vanilla field soil infected with Fusarium oxysporum, fertilized with organic fertilizer and had high Fusarium cumulative disease incidence (common organic fertilizer- chicken manure compost, ph 7.6, wanning city, pot expreiment, vanilla planifolia, soil from vanilla field, fusarium oxysporum f. sp. vanillae, high fusarium cumulative disease incidence )2028-03-08v4No1 / 1765
101amnoncommon state of new york, vitis vinifera, united states of america, merlot, grapevine, rhizosphere2017-04-03v4No1 / 1980
821sheryoCommon in soil of switchgrass field at 0-10cm depth, Michigan USA (common kellogg biological station, mesic type hapludalf, kalamazoo loam, panicum virgatum, depth (soil) 0-10cm, state of michigan, soil, united states of america)2021-08-02v4No1 / 2067
101amnoncommon state of new york, vitis vinifera, united states of america, merlot, grapevine, soil2017-04-03v4No1 / 2537
357amnon high in ph>4.5 compared to ph<4.5 in soil topsoil depth (soil) 0-10cm moist tropical forest woodland area forest ecosystem 2018-08-18v4No1 / 2773
462amnon high in rhizosphere compared to root in united states of america state of tennessee populus tree cultivated environment 2019-01-13v4No1 / 4630
271amnon high in soil compared to rhizosphere glycine max soybean in depth (soil) 0-20cm china 2018-01-09v4No1 / 4853
837sheryoHigher in soil after 30 years compared to 10 years of reforestation with Black locust trees, shaanxi, China ( high in 30 years compared to 10 years in robinia pseudoacacia reforestation silt loam china loess plateau shaanxi province soil )2021-09-27v4No1 / 5245
837sheryoHigher in soil after 20 years compared to 10 years of reforestation with Black locust trees, shaanxi, China ( high in 20 years compared to 10 years in robinia pseudoacacia reforestation silt loam china loess plateau shaanxi province soil )2021-09-27v4No1 / 5270
837sheryoHigher in soil after 30 years reforestation with Black locust trees compared to agricultural feild, shaanxi, China ( high in robinia pseudoacacia reforestation 30 years compared to zea mays triticum aestivum agricultural field in silt loam china loess plateau shaanxi province soil )2021-09-27v4No1 / 5596
837sheryoHigher in soil after 20 years reforestation with Black locust trees compared agricultural feild, shaanxi, China ( high in robinia pseudoacacia reforestation 20 years compared to triticum aestivum zea mays agricultural field in silt loam china loess plateau shaanxi province soil )2021-09-26v4No1 / 5661
100amnon high in ph ph<6 compared to ph>6 in soil urban biome park new york city central park 2017-04-03v4No1 / 5770
271amnon high in soil rhizosphere compared to root structure root in depth (soil) 0-20cm glycine max soybean china 2018-01-09v4No1 / 7954

Problems / suggestions? Please email info AT dbbact DOT org