Search result for sequence:
TACATAGGTCACAAGCGTTATCCGGAATTATTGGGCGTAAAGCGTTCGTAGGCGGTTTGTTAAGTCTAGAGTTAAAGACTGGGGCTCAACCCCAGCCCGCTCTGGATACTGGCTGACTAGAGTTACATAGAGGTAAGCGGAATTCTTAGT
common ontology terms
term enrichment score
TermScore
rainbow trout0.666667
oncorhynchus mykiss0.666667
gut content0.470588
warm temperature habitat0.470588
18c0.470588
gastrointestinal system mucosa0.470588
12c0.470588
cold environment0.470588
fish0.307692
sweden0.197531
england0.181818
LOWER IN common carp0.181818
LOWER IN cyprinus carpio0.181818
digestive system0.137931
intestine0.076923
research facility0.020382
Fraction of dbbact annotations with this term covered by the query
TermScore
rainbow trout0.500000
oncorhynchus mykiss0.500000
gut content0.500000
warm temperature habitat0.500000
18c0.500000
gastrointestinal system mucosa0.500000
12c0.500000
cold environment0.500000
england0.500000
LOWER IN common carp0.500000
LOWER IN cyprinus carpio0.500000
fish0.181818
sweden0.111111
digestive system0.074074
intestine0.058824
research facility0.010309
Fraction of annotations for the query sequences containing the term
TermScore
fish1.000000
rainbow trout1.000000
oncorhynchus mykiss1.000000
digestive system1.000000
sweden0.888889
research facility0.888889
gut content0.444444
warm temperature habitat0.444444
18c0.444444
gastrointestinal system mucosa0.444444
12c0.444444
cold environment0.444444
england0.111111
intestine0.111111
LOWER IN common carp0.111111
LOWER IN cyprinus carpio0.111111
Exp. ID User ID Description Date Region Flag Sequences
313amnonhigh freq. in rainbow trout gut content grown in 18C water (highfreq sweden, fish, rainbow trout, oncorhynchus mykiss, research facility, digestive system, gut content, warm temperature habitat, 18c)2018-04-10v4No1 / 5
313amnonhigh freq. in rainbow trout gut mucosa grown in 18C water (highfreq sweden, fish, rainbow trout, oncorhynchus mykiss, research facility, digestive system, warm temperature habitat, 18c, gastrointestinal system mucosa)2018-04-10v4No1 / 5
313amnonhigh freq. in rainbow trout gut mucosa grown in 12C water (highfreq sweden, fish, rainbow trout, oncorhynchus mykiss, research facility, digestive system, gastrointestinal system mucosa, 12c, cold environment)2018-04-10v4No1 / 6
313amnoncommon in rainbow trout gut mucosa grown in 18C water (common sweden, fish, rainbow trout, oncorhynchus mykiss, research facility, digestive system, warm temperature habitat, 18c, gastrointestinal system mucosa)2018-04-10v4No1 / 8
313amnoncommon in rainbow trout gut content grown in 18C water (common sweden, fish, rainbow trout, oncorhynchus mykiss, research facility, digestive system, gut content, warm temperature habitat, 18c)2018-04-10v4No1 / 9
313amnonhigh freq. in rainbow trout gut content grown in 12C water (highfreq sweden, fish, rainbow trout, oncorhynchus mykiss, research facility, digestive system, gut content, 12c, cold environment)2018-04-10v4No1 / 10
313amnoncommon in rainbow trout gut mucosa grown in 12C water (common sweden, fish, rainbow trout, oncorhynchus mykiss, research facility, digestive system, gastrointestinal system mucosa, 12c, cold environment)2018-04-10v4No1 / 13
313amnoncommon in rainbow trout gut content grown in 12C water (common sweden, fish, rainbow trout, oncorhynchus mykiss, research facility, digestive system, gut content, 12c, cold environment)2018-04-10v4No1 / 31
396amnon high in rainbow trout oncorhynchus mykiss compared to common carp cyprinus carpio in fish england intestine digestive system 2018-11-14v4No1 / 142

Problems / suggestions? Please email info AT dbbact DOT org