Search result for sequence:
TACATAGGTGGCAAGCGTTATCCGGATTTATTGGGCGTAAAGGGTGCGTAGACGGTTTTGCAAGTCTGAGGTTAAATTTAGGAGCTCAACTCCTAATCGCCTTGGAAACTACAAGACTAGAGTATAGGAGAGGTTAGTGGAATTCCATGT
common ontology terms
term enrichment score
TermScore
fungus growing ant0.666667
panama0.333333
trachymyrmex cornetzi0.190476
sericomyrmex amabilis0.190476
trachymyrmex zeteki0.190476
atta colombica0.190476
apterostigma dentigerum0.190476
atta sexdens0.190476
mycocepurus smithii0.190476
acromyrmex octospinosus0.105263
atta cephalotes0.105263
myrmicocrypta ednaella0.105263
intestine0.080000
digestive system0.068966
Fraction of dbbact annotations with this term covered by the query
TermScore
fungus growing ant0.500000
trachymyrmex cornetzi0.500000
sericomyrmex amabilis0.500000
trachymyrmex zeteki0.500000
acromyrmex octospinosus0.500000
atta colombica0.500000
apterostigma dentigerum0.500000
atta sexdens0.500000
atta cephalotes0.500000
mycocepurus smithii0.500000
myrmicocrypta ednaella0.500000
panama0.200000
intestine0.041667
digestive system0.035714
Fraction of annotations for the query sequences containing the term
TermScore
digestive system1.000000
intestine1.000000
panama1.000000
fungus growing ant1.000000
trachymyrmex cornetzi0.117647
sericomyrmex amabilis0.117647
trachymyrmex zeteki0.117647
atta colombica0.117647
apterostigma dentigerum0.117647
atta sexdens0.117647
mycocepurus smithii0.117647
acromyrmex octospinosus0.058824
atta cephalotes0.058824
myrmicocrypta ednaella0.058824
Exp. ID User ID Description Date Region Flag Sequences
397amnoncommon digestive system, intestine, panama, fungus growing ant, trachymyrmex cornetzi2018-11-14v4No1 / 4
397amnoncommon digestive system, intestine, panama, fungus growing ant, sericomyrmex amabilis2018-11-14v4No1 / 4
397amnondominant digestive system, intestine, panama, trachymyrmex zeteki, fungus growing ant2018-11-14v4No1 / 6
397amnondominant digestive system, intestine, panama, fungus growing ant, trachymyrmex cornetzi2018-11-14v4No1 / 6
397amnondominant digestive system, intestine, panama, fungus growing ant, acromyrmex octospinosus2018-11-14v4No1 / 6
397amnoncommon digestive system, intestine, panama, trachymyrmex zeteki, fungus growing ant2018-11-14v4No1 / 7
397amnoncommon digestive system, intestine, panama, fungus growing ant, atta colombica2018-11-14v4No1 / 7
397amnondominant digestive system, intestine, panama, fungus growing ant, apterostigma dentigerum2018-11-14v4No1 / 7
397amnoncommon digestive system, intestine, panama, fungus growing ant, atta sexdens2018-11-14v4No1 / 8
397amnondominant digestive system, intestine, panama, fungus growing ant, sericomyrmex amabilis2018-11-14v4No1 / 9
397amnoncommon digestive system, intestine, panama, fungus growing ant, apterostigma dentigerum2018-11-14v4No1 / 9
397amnondominant digestive system, intestine, panama, fungus growing ant, atta cephalotes2018-11-14v4No1 / 11
397amnondominant digestive system, intestine, panama, fungus growing ant, mycocepurus smithii2018-11-14v4No1 / 11
397amnondominant digestive system, intestine, panama, fungus growing ant, atta colombica2018-11-14v4No1 / 12
397amnoncommon digestive system, intestine, panama, fungus growing ant, mycocepurus smithii2018-11-14v4No1 / 14
397amnondominant digestive system, intestine, panama, fungus growing ant, atta sexdens2018-11-14v4No1 / 16
397amnoncommon digestive system, intestine, panama, fungus growing ant, myrmicocrypta ednaella2018-11-14v4No1 / 28

Problems / suggestions? Please email info AT dbbact DOT org