Search result for sequence:
TACCAGCACCCCGAGTGGTCGGGACGATTATTGGGCCTAAAGCATCCGTAGCCGGTTTTACAAGTCCTCCGTTAAATCCAACTGCTTAACAGATGGGCCGCGGAGGATACTATAAGACTAGGAGGCAGGAGAGGCAAGCGGTACTCAGTG
common ontology terms
term enrichment score
TermScore
soil0.383798
rhizosphere0.244648
cultivated environment0.237443
china0.218574
depth 0-20cm0.213713
silt loam0.188841
shaanxi province0.185366
ph 7-80.177340
loess plateau0.169643
reforestation0.160804
robinia pseudoacacia0.160804
clay loam0.139410
citrus0.139410
tree0.130326
agricultural feature0.116402
grazing exclusion0.116402
haplic calcisol0.116402
calci-orthic aridisol0.116402
ningxia province0.116402
yunwushan national natural grassland protection zone0.116402
agricultural field0.114833
zea mays0.111628
limestone0.106952
fungicide0.106952
tobacco field0.106952
difenoconazole0.106952
river0.101523
united states0.097297
des moines0.097297
nicollet soil series0.097297
iowa0.092784
orchard0.092784
state of tennessee0.092166
mississippi river0.090056
songnen plain0.087432
da'an station0.087432
salic solonetz0.087432
low sodicity0.087432
10 years0.087432
glycine max0.082051
jiangsu province0.080402
low salinity0.080402
gleysol0.077348
sihong county0.077348
poplar0.077348
poplar plantation0.077348
chenwei forest0.077348
populus0.077348
depth 0-40cm0.077348
wheat0.077348
germany0.070922
taxus0.067039
shanghai proper0.064865
ph>70.064865
ph 90.064865
ph 6-70.064815
topsoil0.061856
root0.060914
ames0.056497
temperate0.056497
lushan mountain0.056497
30 years0.056497
north china plain0.056497
farm0.055470
united states of america0.055227
northeast china0.054945
forested area0.054945
ph 7.60.054945
jiangxi province0.053476
depth 0-10cm0.053004
triticum aestivum0.051414
biochar0.048309
depth 10-20cm0.046243
particles0.046243
ph 8.50.045714
taxus media0.045714
depth 60-90cm0.045714
without plants0.045714
tobacco plant present0.045714
depth 40-100cm0.045714
merlot0.045714
grapevine0.045714
0-9 years of grazing exclusion0.045714
27-35 years of grazing exclusion0.045714
wanning city0.045714
vanilla planifolia0.045714
soil from vanilla field0.045714
fusarium oxysporum f. sp. vanillae0.045714
fresh water0.045558
depth 5cm0.045198
vitis vinifera0.044693
npk fertilizer0.043716
pot expreiment0.043716
leaf0.041308
winter0.039683
kingdom of spain0.038647
state of new york0.038647
sediment0.036199
state of florida0.035242
populus deltoides0.034682
Fraction of dbbact annotations with this term covered by the query
TermScore
mississippi river0.750000
clay loam0.666667
citrus0.666667
LOWER IN depth 20-40cm0.666667
depth 10-20cm0.666667
particles0.666667
ph 7-90.500000
united states0.500000
ames0.500000
des moines0.500000
nicollet soil series0.500000
gleysol0.500000
sihong county0.500000
poplar0.500000
poplar plantation0.500000
chenwei forest0.500000
cultivated environment0.500000
agricultural feature0.500000
ph 7-80.500000
songnen plain0.500000
da'an station0.500000
salic solonetz0.500000
low sodicity0.500000
ph 8.50.500000
temperate0.500000
taxus0.500000
taxus media0.500000
depth 60-90cm0.500000
limestone0.500000
fungicide0.500000
tobacco field0.500000
difenoconazole0.500000
without plants0.500000
tobacco plant present0.500000
malvaviscus penduliflorus0.500000
seed structure0.500000
populus deltoides0.500000
LOWER IN populus trichocarpa x deltoides0.500000
populus0.500000
lapland0.500000
grassland0.500000
steppe0.500000
quarry0.500000
greenschist0.500000
LOWER IN taxus cuspidata0.500000
depth 0-40cm0.500000
LOWER IN depth 100-300cm0.500000
shaanxi province0.500000
guanajuato0.500000
agave0.500000
agave salmiana0.500000
depth 40-60cm0.500000
grazing exclusion0.500000
haplic calcisol0.500000
calci-orthic aridisol0.500000
ningxia province0.500000
yunwushan national natural grassland protection zone0.500000
immokalee, fl0.500000
vero beach, fl0.500000
LOWER IN depth 2.5cm0.500000
lushan mountain0.500000
elevation 500-600m0.500000
elevation 200-300m0.500000
coniferous forest biome0.500000
elevation 1000-1100m0.500000
kelley0.500000
subsurface drainage0.500000
LOWER IN mussel0.500000
LOWER IN unionidae0.500000
freshwater biome0.500000
depth (soil) 80cm0.500000
LOWER IN depth 0cm0.500000
elevation 800-900m0.500000
LOWER IN depth 10-20cm0.500000
kanawha0.500000
ph 8.10.500000
silt clay loam0.500000
depth 30-75cm0.500000
taxus cuspidata0.500000
LOWER IN taxus mairei0.500000
LOWER IN southeast china0.500000
ph 8.30.500000
elevation 1300-1400m0.500000
depth 40-50cm0.500000
shrimp farm0.500000
LOWER IN depth 40-100cm0.500000
reforestation0.500000
robinia pseudoacacia0.500000
10 years0.500000
depth 30-4cm0.500000
ph 7.10.500000
compost biofilter0.500000
compost0.500000
pig manure0.500000
paenibacillus0.500000
nanjing county0.500000
chrysanthemum0.500000
chrysanthemum morifolium ramat.0.500000
paenibacillus polymyxa0.500000
myrtillocactus geometrizans0.500000
Fraction of annotations for the query sequences containing the term
TermScore
soil0.670659
china0.580838
rhizosphere0.239521
united states of america0.167665
cultivated environment0.155689
depth 0-20cm0.143713
silt loam0.131737
shaanxi province0.113772
loess plateau0.113772
ph 7-80.107784
reforestation0.095808
robinia pseudoacacia0.095808
clay loam0.077844
citrus0.077844
tree0.077844
zea mays0.071856
agricultural field0.071856
agricultural feature0.065868
grazing exclusion0.065868
haplic calcisol0.065868
calci-orthic aridisol0.065868
ningxia province0.065868
yunwushan national natural grassland protection zone0.065868
state of tennessee0.059880
limestone0.059880
fungicide0.059880
tobacco field0.059880
difenoconazole0.059880
river0.059880
germany0.059880
iowa0.053892
united states0.053892
des moines0.053892
nicollet soil series0.053892
orchard0.053892
farm0.053892
glycine max0.047904
jiangsu province0.047904
low salinity0.047904
songnen plain0.047904
da'an station0.047904
salic solonetz0.047904
low sodicity0.047904
mississippi river0.047904
10 years0.047904
ph 6-70.041916
gleysol0.041916
sihong county0.041916
poplar0.041916
poplar plantation0.041916
chenwei forest0.041916
populus0.041916
depth 0-40cm0.041916
wheat0.041916
shanghai proper0.035928
ph>70.035928
ph 90.035928
taxus0.035928
root0.035928
topsoil0.035928
ames0.029940
depth 0-10cm0.029940
temperate0.029940
northeast china0.029940
biochar0.029940
triticum aestivum0.029940
jiangxi province0.029940
forested area0.029940
lushan mountain0.029940
fresh water0.029940
ph 7.60.029940
30 years0.029940
winter0.029940
north china plain0.029940
npk fertilizer0.023952
ph 8.50.023952
taxus media0.023952
depth 60-90cm0.023952
kingdom of spain0.023952
without plants0.023952
tobacco plant present0.023952
leaf0.023952
state of florida0.023952
sediment0.023952
depth 5cm0.023952
depth 10-20cm0.023952
particles0.023952
depth 40-100cm0.023952
vitis vinifera0.023952
state of new york0.023952
merlot0.023952
grapevine0.023952
0-9 years of grazing exclusion0.023952
27-35 years of grazing exclusion0.023952
wanning city0.023952
vanilla planifolia0.023952
pot expreiment0.023952
soil from vanilla field0.023952
fusarium oxysporum f. sp. vanillae0.023952
depth 0-15cm0.017964
Exp. ID User ID Description Date Region Flag Sequences
175amnonhigh freq in heavy metal contaminated soils in china (dominant soil, heavy metal, ph 7-9, china)2017-07-29v4No1 / 1
801sheryoDominant in soybean and corn agriculture fields at depth 0-15cm, Iowa USA (dominant soil, zea mays, glycine max, iowa, agricultural field, united states, ames, des moines, ph 7.5, depth 0-15cm, nicollet soil series)2021-06-15v4No1 / 3
828sheryoDominant in gleysol soil of poplar plantation at 0-10cm depth, sihong, china (dominant soil, jiangsu province, depth 0-10cm, clay loam, ph 6-7, gleysol, china, sihong county, poplar, poplar plantation, chenwei forest)2021-08-25v4No1 / 3
415amnondominant orchard, soil, rhizosphere, italy, citrus, cultivated environment2018-11-27v4No1 / 4
420amnonhigh freq. in soil of vegetable open field (dominant agricultural feature, farm, soil, shanghai proper, ph>7, ph 7-8, npk fertilizer, clay loam, cultivated environment, china)2018-12-02v4No1 / 4
462amnondominant united states of america, state of tennessee, soil, depth 0-30cm, silt loam, cultivated environment2019-01-13v4No1 / 4
420amnonhigh freq. in soil of vegetable in plastic tunnel (dominant agricultural feature, farm, soil, greenhouse soil, shanghai proper, ph>7, ph 7-8, npk fertilizer, clay loam, cultivated environment, china)2018-12-02v4No1 / 5
791sheryoDominant at 20cm depth in low saline low sodicity soil in China (dominant soil, depth 20cm, low salinity, china, songnen plain, da'an station, salic solonetz, low sodicity, ph 8.5, ph 9)2021-06-08v4No1 / 5
415amnondominant united states of america, orchard, soil, rhizosphere, citrus, cultivated environment2018-11-27v4No1 / 6
134amnondominant rhizosphere, temperate, tree, taxus, taxus media, northeast china, china2017-04-16v4No1 / 8
801sheryoDominant in soybean and corn agriculture fields at depth 60-90cm, Iowa USA (dominant soil, zea mays, glycine max, iowa, agricultural field, united states, ames, des moines, ph 7.7, nicollet soil series, depth 60-90cm)2021-06-15v4No1 / 8
415amnondominant orchard, soil, rhizosphere, kingdom of spain, citrus, cultivated environment2018-11-27v4No1 / 9
609sheryoDominant in soil without tobacco plants with difenoconazole fungicide amended with biochar (dominant soil, ph 7-8, depth 0-20cm, limestone, biochar, fungicide, china, tobacco field, difenoconazole)2020-04-21v4No1 / 9
609sheryoDominant in soil without tobacco plants amended with difenoconazole fungicide and biochar (dominant soil, ph 7-8, depth 0-20cm, limestone, biochar, fungicide, china, tobacco field, difenoconazole, without plants)2020-07-05v4No1 / 9
609sheryoDominant in soil without tobacco plants with difenoconazole fungicide amended and without biochar (dominant soil, ph 7-8, depth 0-20cm, limestone, fungicide, china, tobacco field, difenoconazole)2020-04-21v4No1 / 12
609sheryoDominant in soil without tobacco plants amended with difenoconazole fungicide (dominant soil, ph 7-8, depth 0-20cm, limestone, fungicide, china, tobacco field, difenoconazole, without plants)2020-07-05v4No1 / 12
609sheryoDominant in soil with tobacco plants amended with difenoconazole fungicide (dominant soil, ph 7-8, depth 0-20cm, limestone, fungicide, china, tobacco field, difenoconazole, tobacco plant present)2020-04-21v4No1 / 13
609sheryoDominant in soil with tobacco plants amended with difenoconazole fungicide and biochar (dominant soil, ph 7-8, depth 0-20cm, limestone, biochar, fungicide, china, tobacco field, difenoconazole, tobacco plant present)2020-04-21v4No1 / 13
361amnoncommon leaf, austria, plant, greenhouse, malvaviscus penduliflorus2018-08-21v4No1 / 102
192amnoncommon seed structure, brassica napus, seed2017-09-05v4No1 / 161
462amnon high in populus deltoides compared to populus trichocarpa x deltoides in united states of america state of tennessee stem populus tree cultivated environment 2019-01-13v4No1 / 166
511amnoncommon kingdom of norway, sweden, finland, lapland, depth 0-5cm, snow2019-03-20v4No1 / 213
279amnoncommon grassland, steppe, soil, mongolia, china2018-01-24v4No1 / 235
462amnon high in populus deltoides compared to populus trichocarpa x deltoides in united states of america state of tennessee populus tree cultivated environment root 2019-01-13v4No1 / 254
205amnoncommon in Ely Greenstone rock piles (common united states of america, quarry, rock, state of minnesota, ph 7, greenschist)2017-10-03v4No1 / 255
828sheryoHigher at 0-20cm depth compared to 20-40cm depth in gleysol soil of poplar plantation, sihong, china ( high in depth 0-20cm compared to depth 20-40cm in soil jiangsu province clay loam ph 6-7 gleysol china sihong county poplar poplar plantation chenwei forest )2021-08-25v4No1 / 312
134amnon high in taxus media compared to taxus cuspidata in rhizosphere tree taxus china 2017-04-16v4No1 / 358
837sheryoHigher in agricultural field at depths 0-40cm compared to 100-300cm, shaanxi, China ( high in depth 0-40cm compared to depth 100-300cm in soil zea mays triticum aestivum silt loam agricultural field china shaanxi province loess plateau )2021-09-26v4No1 / 431
360amnoncommon desert, leaf, mexico, guanajuato, agave, agave salmiana, leaf surface2018-08-21v4No1 / 492
415amnoncommon united states of america, orchard, soil, rhizosphere, citrus, cultivated environment2018-11-27v4No1 / 494
824sheryoHigher at 40-60cm depth compared to 20-40cm depth in soil after grazing exclusion, Ningxia china ( high in depth 40-60cm compared to depth 20-40cm in soil china grazing exclusion haplic calcisol calci-orthic aridisol ningxia province yunwushan national natural grassland protection zone )2021-08-08v4No1 / 520
98amnoncommon rhizosphere, state of florida, citrus, immokalee, fl, root2017-04-01v4No1 / 543
98amnoncommon rhizosphere, state of florida, citrus, vero beach, fl, root2017-04-01v4No1 / 544
462amnon high in populus deltoides compared to populus trichocarpa x deltoides in united states of america state of tennessee leaf populus tree cultivated environment 2019-01-13v4No1 / 559
205amnonhigher in depth 15cm compared to 2.5cm in Ely Greenstone rock piles ( high in depth depth (soil) 15cm compared to depth 2.5cm in united states of america quarry rock state of minnesota ph 7 greenschist )2017-10-03v4No1 / 562
667amnoncommon soil, topsoil, jiangxi province, ph 4.5, depth 0-20cm, forested area, china, lushan mountain, elevation 500-600m2020-09-25v4No1 / 575
415amnoncommon orchard, soil, rhizosphere, south africa, citrus, cultivated environment2018-11-27v4No1 / 600
667amnoncommon soil, topsoil, jiangxi province, ph 4.5, depth 0-20cm, forested area, china, elevation 200-300m, lushan mountain2020-09-25v4No1 / 613
667amnoncommon soil, topsoil, jiangxi province, depth 0-20cm, forested area, coniferous forest biome, china, lushan mountain, elevation 1000-1100m, ph 4-4.52020-09-25v4No1 / 630
609sheryoCommon in soil with tobacco plants amended with difenoconazole fungicide and biochar (common soil, ph 7-8, depth 0-20cm, limestone, biochar, fungicide, china, tobacco field, difenoconazole, tobacco plant present)2020-04-21v4No1 / 634
801sheryoCommon in soybean and corn agriculture fields at depth 60-90cm, Iowa USA (common soil, zea mays, glycine max, iowa, agricultural field, united states, ames, des moines, ph 7.7, nicollet soil series, depth 60-90cm)2021-06-15v4No1 / 650
801sheryoCommon at depth 60-90cm in corn and soybean agriculture fields, Iowa USA (common soil, zea mays, glycine max, iowa, agricultural field, united states, des moines, ph 7.9, nicollet soil series, depth 60-90cm, kelley, subsurface drainage)2021-06-16v4No1 / 667
166amnonlower in river sediment under mussles compared to control ( high in control compared to mussel unionidae in united states of america river sediment freshwater biome mississippi river depth 5cm upper mississippi river )2017-07-18v4No1 / 671
609sheryocommon in soil with tobacco plants amended with difenoconazole fungicide (common soil, ph 7-8, depth 0-20cm, limestone, fungicide, china, tobacco field, difenoconazole, tobacco plant present)2020-04-21v4No1 / 671
791sheryoHigher at 80cm depth compared to 0cm depth in low saline low sodicity soil in China ( high in depth (soil) 80cm compared to depth 0cm in soil low salinity china songnen plain da'an station salic solonetz low sodicity ph 9 )2021-06-08v4No1 / 675
667amnoncommon soil, topsoil, jiangxi province, ph 4.5, depth 0-20cm, forested area, china, lushan mountain, elevation 800-900m2020-09-25v4No1 / 694
824sheryoHigher at 20-40cm depth compared to 10-20cm depth in soil after grazing exclusion, Ningxia china ( high in depth 20-40cm compared to depth 10-20cm in soil china grazing exclusion haplic calcisol calci-orthic aridisol ningxia province yunwushan national natural grassland protection zone )2021-08-08v4No1 / 695
801sheryoCommon at depth 30-60cm in corn agriculture fields, Iowa USA (common soil, zea mays, iowa, agricultural field, united states, des moines, depth (soil) 30-60cm, nicollet soil series, kanawha, ph 8.1)2021-06-15v4No1 / 703
462amnoncommon united states of america, state of tennessee, soil, silt clay loam, depth 30-75cm, cultivated environment2019-01-13v4No1 / 728
134amnon high in temperate taxus media taxus cuspidata northeast china compared to subtropical taxus mairei southeast china in rhizosphere tree taxus china 2017-04-16v4No1 / 734
824sheryoHigher at 10-20cm depth compared to 0-10cm depth in soil after grazing exclusion, Ningxia china ( high in depth 10-20cm compared to depth 0-10cm in soil china grazing exclusion haplic calcisol calci-orthic aridisol ningxia province yunwushan national natural grassland protection zone )2021-08-08v4No1 / 734
801sheryoCommon at depth 60-90cm in corn agriculture fields, Iowa USA (common soil, zea mays, iowa, agricultural field, united states, des moines, nicollet soil series, depth 60-90cm, kanawha, ph 8.3)2021-06-15v4No1 / 764
667amnoncommon soil, topsoil, jiangxi province, ph 4, depth 0-20cm, forested area, coniferous forest biome, china, lushan mountain, elevation 1300-1400m2020-09-25v4No1 / 777
828sheryoCommon in gleysol soil of poplar plantation at 40-50cm depth, sihong, china (common soil, jiangsu province, clay loam, ph 6-7, gleysol, china, sihong county, poplar, poplar plantation, chenwei forest, depth 40-50cm)2021-08-25v4No1 / 790
478amnoncommon farm, intestine, litopenaeus vannamei, pacific white shrimp, china2019-02-19v4No1 / 795
478amnoncommon farm, water, saline water, shrimp farm, china2019-02-19v4No1 / 799
415amnoncommon orchard, soil, rhizosphere, citrus, cultivated environment, china2018-11-27v4No1 / 830
837sheryoHigher at 0-40cm depth compared to 40-100cm in soil after 10 years reforestation with Black locust trees, shaanxi, China ( high in depth 0-40cm compared to depth 40-100cm in soil silt loam reforestation china shaanxi province loess plateau robinia pseudoacacia 10 years )2021-09-26v4No1 / 831
828sheryoCommon in gleysol soil of poplar plantation at 30-40cm depth, sihong, china (common soil, jiangsu province, clay loam, ph 6-7, gleysol, china, sihong county, poplar, poplar plantation, chenwei forest, depth 30-4cm)2021-08-25v4No1 / 844
801sheryoCommon at depth 0-15cm in corn agriculture fields, Iowa USA (common soil, zea mays, iowa, agricultural field, united states, des moines, depth 0-15cm, nicollet soil series, ph 7.1, kanawha)2021-06-15v4No1 / 862
837sheryoHigher at 0-40cm depth compared 100-300cm to in soil after 10 years reforestation with Black locust trees, shaanxi, China ( high in depth 0-40cm compared to depth 100-300cm in soil silt loam reforestation china shaanxi province loess plateau robinia pseudoacacia 10 years )2021-09-26v4No1 / 863
767sheryoCommon in soil planted with Chrysanthemum, fertilized with bio-organic fertilizer in Nanjing China (common soil, compost biofilter, compost, pig manure, paenibacillus, china, nanjing county, chrysanthemum, bio-organic fertilizer, chrysanthemum morifolium ramat., ph 6.9, paenibacillus polymyxa)2021-04-14v4No1 / 866
129amnoncommon soil, mexico, myrtillocactus geometrizans, opuntia robusta, cactus, semi-arid, ph 6-6.52017-04-15v4No1 / 884
462amnon high in leaf compared to stem in united states of america state of tennessee populus tree cultivated environment 2019-01-13v4No1 / 890
791sheryoHigher in low sodicity and low salinity soil compared to high sodicity and high salinity soil at 80cm depth in China ( high in low salinity low sodicity ph 9 compared to high salinity high sodicity ph 10 in soil china songnen plain da'an station salic solonetz depth (soil) 80cm )2021-06-08v4No1 / 895
801sheryoCommon in soybean and corn agriculture fields at depth 15-30cm, Iowa USA (common soil, zea mays, glycine max, iowa, agricultural field, united states, ames, des moines, nicollet soil series, depth 15-30cm, ph 7.4)2021-06-15v4No1 / 905
462amnoncommon united states of america, state of tennessee, rhizosphere, populus, tree, silt clay loam, depth 30-75cm, cultivated environment2019-01-13v4No1 / 908
103amnoncommon united states of america, river, aquatic biome, fresh water, mississippi river, particles2017-04-05v4No1 / 909
103amnoncommon united states of america, river, aquatic biome, fresh water, mississippi river, free floating2017-04-05v4No1 / 909
609sheryoCommon in soil without tobacco plants amended with difenoconazole fungicide and biochar (common soil, ph 7-8, depth 0-20cm, limestone, biochar, fungicide, china, tobacco field, difenoconazole, without plants)2020-07-05v4No1 / 910
609sheryoCommon in soil without tobacco plants amended with difenoconazole fungicide (common soil, ph 7-8, depth 0-20cm, limestone, fungicide, china, tobacco field, difenoconazole, without plants)2020-07-05v4No1 / 915
126amnoncommon rhizosphere, hordeum vulgare, germany, winter barley2017-04-14v4No1 / 925
791sheryoHigher in low sodicity and low salinity soil compared to high sodicity and high salinity soil at 0cm depth in China ( high in low salinity low sodicity ph 8.5 compared to high salinity high sodicity ph 10.5 in soil depth 0cm china songnen plain da'an station salic solonetz )2021-06-08v4No1 / 932
462amnoncommon united states of america, state of tennessee, soil, depth 0-30cm, silt loam, cultivated environment2019-01-13v4No1 / 938
134amnoncommon rhizosphere, temperate, tree, taxus, taxus mairei, northeast china, china2017-04-16v4No1 / 973
828sheryoCommon in gleysol soil of poplar plantation at 20-30cm depth, sihong, china (common soil, jiangsu province, depth (soil) 20-30cm, clay loam, ph 6-7, gleysol, china, sihong county, poplar, poplar plantation, chenwei forest)2021-08-25v4No1 / 989
462amnoncommon united states of america, state of tennessee, rhizosphere, populus, tree, depth 0-30cm, silt loam, cultivated environment2019-01-13v4No1 / 997
791sheryoCommon at 0cm depth in low saline low sodicity soil in China (common soil, depth 0cm, low salinity, china, songnen plain, da'an station, salic solonetz, low sodicity, ph 8.5)2021-06-07v4No1 / 1035
837sheryoCommon in soil after 10 years reforestation with Black locust trees at 100-300cm depth, shaanxi, China (common soil, silt loam, reforestation, china, shaanxi province, loess plateau, robinia pseudoacacia, depth 100-300cm, 10 years)2021-09-26v4No1 / 1061
837sheryoCommon in soil after 10 years reforestation with Black locust trees at 40-100cm depth, shaanxi, China (common soil, silt loam, reforestation, china, shaanxi province, loess plateau, robinia pseudoacacia, depth 40-100cm, 10 years)2021-09-26v4No1 / 1065
828sheryoCommon in gleysol soil of poplar plantation at 0-10cm depth, sihong, china (common soil, jiangsu province, depth 0-10cm, clay loam, ph 6-7, gleysol, china, sihong county, poplar, poplar plantation, chenwei forest)2021-08-25v4No1 / 1069
252amnoncommon in river rock biofilm (common river, rock, biofilm, kingdom of spain, epilithic)2017-11-22v4No1 / 1081
478amnoncommon farm, sediment, shrimp farm, china2019-02-19v4No1 / 1085
791sheryoCommon at 40cm depth in low saline low sodicity soil in China (common soil, low salinity, china, songnen plain, da'an station, salic solonetz, low sodicity, ph 9, depth (soil) 40cm)2021-06-08v4No1 / 1085
415amnoncommon orchard, soil, rhizosphere, brazil, citrus, cultivated environment2018-11-27v4No1 / 1091
415amnoncommon orchard, soil, rhizosphere, kingdom of spain, citrus, cultivated environment2018-11-27v4No1 / 1099
101amnoncommon united states of america, vitis vinifera, state of new york, merlot, grapevine, root2017-04-03v4No1 / 1106
824sheryocommon in soil after 0-9 years of grazing exclusion at 40-60cm depth, Ningxia china (common soil, china, depth 40-60cm, grazing exclusion, haplic calcisol, calci-orthic aridisol, ningxia province, yunwushan national natural grassland protection zone, 0-9 years of grazing exclusion)2021-08-08v4No1 / 1113
828sheryoCommon in gleysol soil of poplar plantation at 10-20cm depth, sihong, china (common soil, jiangsu province, clay loam, ph 6-7, gleysol, china, sihong county, poplar, depth 10-20cm, poplar plantation, chenwei forest)2021-08-25v4No1 / 1123
791sheryoCommon at 80cm depth in low saline low sodicity soil in China (common soil, low salinity, china, songnen plain, da'an station, salic solonetz, low sodicity, ph 9, depth (soil) 80cm)2021-06-08v4No1 / 1128
134amnoncommon rhizosphere, temperate, tree, taxus, taxus cuspidata, northeast china, china2017-04-16v4No1 / 1141
791sheryoCommon at 20cm depth in low saline low sodicity soil in China (common soil, depth 20cm, low salinity, china, songnen plain, da'an station, salic solonetz, low sodicity, ph 8.5, ph 9)2021-06-08v4No1 / 1155
746sheryoCommon in saline soil in dafeng, china (common jiangsu province, solonchak, china, dafeng city, ph 7.6, saline soil)2021-03-03v4No1 / 1170
252amnoncommon in river sand biofilm (common river, biofilm, sand, kingdom of spain)2017-11-22v4No1 / 1181
309amnoncommon rhizosphere, germany, prunella vulgaris, woundwort2018-04-05v4No1 / 1217
801sheryoCommon in soybean and corn agriculture fields at depth 0-15cm, Iowa USA (common soil, zea mays, glycine max, iowa, agricultural field, united states, ames, des moines, ph 7.5, depth 0-15cm, nicollet soil series)2021-06-15v4No1 / 1226
824sheryoCommon in soil after 27-35 years of grazing exclusion at 40-60cm depth, Ningxia china (common soil, china, depth 40-60cm, grazing exclusion, 27-35 years of grazing exclusion, haplic calcisol, calci-orthic aridisol, ningxia province, yunwushan national natural grassland protection zone)2021-08-08v4No1 / 1232
420amnoncommon in soil of vegetables in organic field (common agricultural feature, farm, soil, shanghai proper, ph>7, ph 7-8, clay loam, organic farming, cultivated environment, china)2018-12-02v4No1 / 1240
134amnoncommon rhizosphere, temperate, tree, taxus, taxus media, northeast china, china2017-04-16v4No1 / 1251
837sheryoCommon in agricultural field at depths 40-100cm, shaanxi, China (common soil, zea mays, triticum aestivum, silt loam, agricultural field, china, shaanxi province, loess plateau, depth 40-100cm)2021-09-26v4No1 / 1263
309amnon high in veronica chamaedrys germander speedwell compared to other plants in rhizosphere germany 2018-04-05v4No1 / 1272
824sheryoCommoon in soil after 0-9 years of grazing exclusion at 20-40cm depth, Ningxia china (common soil, china, grazing exclusion, haplic calcisol, calci-orthic aridisol, ningxia province, yunwushan national natural grassland protection zone, 0-9 years of grazing exclusion, depth 20-40cm)2021-08-08v4No1 / 1274
415amnoncommon orchard, soil, rhizosphere, italy, citrus, cultivated environment2018-11-27v4No1 / 1279
420amnoncommon in soil of vegetables in organic plastic tunnel (common agricultural feature, farm, soil, greenhouse soil, shanghai proper, ph>7, ph 7-8, clay loam, organic farming, cultivated environment, china)2018-12-02v4No1 / 1294
837sheryoCommon in soil at 0-40-100cm depth after 20 years reforestation with Black locust trees, shaanxi, China (common soil, silt loam, reforestation, china, shaanxi province, loess plateau, robinia pseudoacacia, depth 40-100cm, 20 years)2021-09-26v4No1 / 1294
309amnoncommon rhizosphere, germany, meadow pea-vine, lathyrus pratensis2018-04-05v4No1 / 1296
837sheryoCommon in soil at 40-100cm depth after 30 years reforestation with Black locust trees, shaanxi, China (common soil, silt loam, reforestation, china, shaanxi province, loess plateau, robinia pseudoacacia, depth 40-100cm, 30 years)2021-09-26v4No1 / 1311
837sheryoCommon in soil after 10 years reforestation with Black locust trees at 0-40cm depth, shaanxi, China (common soil, silt loam, reforestation, china, shaanxi province, loess plateau, robinia pseudoacacia, depth 0-40cm, 10 years)2021-09-26v4No1 / 1317
837sheryoCommon in soil at 100-300cm depth after 20 years reforestation with Black locust trees, shaanxi, China (common soil, silt loam, reforestation, china, shaanxi province, loess plateau, robinia pseudoacacia, depth 100-300cm, 20 years)2021-09-26v4No1 / 1317
309amnoncommon rhizosphere, germany, onobrychis viciifolia, common sainfoin2018-04-05v4No1 / 1323
837sheryoבCommon in soil at 0-40cm depth after 20 years reforestation with Black locust trees, shaanxi, China (common soil, silt loam, reforestation, china, shaanxi province, loess plateau, robinia pseudoacacia, depth 0-40cm, 20 years)2021-09-26v4No1 / 1323
98amnoncommon rhizosphere, state of florida, citrus, ft. pierce, fl, root2017-04-01v4No1 / 1340
837sheryoCommon in soil at 0-40 cm depth after 30 years reforestation with Black locust trees, shaanxi, China (common soil, silt loam, reforestation, china, shaanxi province, loess plateau, robinia pseudoacacia, depth 0-40cm, 30 years)2021-09-26v4No1 / 1346
837sheryoCommon in soil at 100-300cm depth after 30 years reforestation with Black locust trees, shaanxi, China (common soil, silt loam, reforestation, china, shaanxi province, loess plateau, robinia pseudoacacia, depth 100-300cm, 30 years)2021-09-26v4No1 / 1354
824sheryoCommon in soil after 27-35 years of grazing exclusion at 20-40cm depth, Ningxia china (common soil, china, grazing exclusion, 27-35 years of grazing exclusion, haplic calcisol, calci-orthic aridisol, ningxia province, yunwushan national natural grassland protection zone, depth 20-40cm)2021-08-08v4No1 / 1369
98amnoncommon rhizosphere, state of florida, citrus, gainesville, fl, root2017-04-01v4No1 / 1371
420amnoncommon in soil of vegetable open field (common agricultural feature, farm, soil, shanghai proper, ph>7, ph 7-8, npk fertilizer, clay loam, cultivated environment, china)2018-12-02v4No1 / 1376
309amnoncommon rhizosphere, germany, plantago lanceolata, ribwort plantain2018-04-05v4No1 / 1386
420amnonhigh freq. in soil of vegetable in plastic tunnel (common agricultural feature, farm, soil, greenhouse soil, shanghai proper, ph>7, ph 7-8, npk fertilizer, clay loam, cultivated environment, china)2018-12-02v4No1 / 1396
824sheryoCommon in soil after 0-9 years of grazing exclusion at 10-20cm depth, Ningxia china (common soil, china, grazing exclusion, haplic calcisol, calci-orthic aridisol, ningxia province, yunwushan national natural grassland protection zone, 0-9 years of grazing exclusion, depth 10-20cm)2021-08-08v4No1 / 1397
443amnonhigher in lower mississippi river (downstream) compared to upper mississippi river ( high in downstream lower mississippi river compared to upstream upper mississippi river in united states of america river water fresh water mississippi river particles depth 1m filtered 2.7um )2019-01-07v4No1 / 1418
40amnoncommon soil, field soil, rhizosphere, nicotiana tabacum, china2016-12-09v4No1 / 1420
309amnoncommon rhizosphere, germany, geranium pratense, meadow geranium2018-04-05v4No1 / 1434
76amnoncommon in seleniferous soil (common united states of america, soil, rhizosphere, selenium, seleniferous, woodland area)2017-02-28v4No1 / 1438
783sheryocommon in desert soil in mongolia under water addition treatment (common soil, mongolia, sandy desert, bajada, china, dengkou county, ph 7.85, ulan buh desert, cambic arenosols, luvic gypsisols, water addition, 100% above ambient precipitation)2021-05-11v4No1 / 1442
686sheryoCommon in vanilla field soil infected with Fusarium oxysporum, fertilized with chemical fertilizer and had high Fusarium cumulative disease incidence (common wanning city, vanilla planifolia, ph 7.6, pot expreiment, soil from vanilla field, fusarium oxysporum f. sp. vanillae, chemical fertilization n,p,k, high fusarium cumulative disease incidence )2028-03-08v4No1 / 1456
271amnoncommon rhizosphere, glycine max, soybean, depth 0-20cm, china2018-01-09v4No1 / 1459
837sheryoCommon in agricultural field at depths 0-40cm, shaanxi, China (common soil, zea mays, triticum aestivum, silt loam, agricultural field, china, shaanxi province, loess plateau, depth 0-40cm)2021-09-26v4No1 / 1470
824sheryoCommon in soil after 27-35 years of grazing exclusion at 10-20cm depth, Ningxia china (common soil, china, grazing exclusion, 27-35 years of grazing exclusion, haplic calcisol, calci-orthic aridisol, ningxia province, yunwushan national natural grassland protection zone, depth 10-20cm)2021-08-08v4No1 / 1477
309amnoncommon rhizosphere, germany, red fescue grass, festuca rubra2018-04-05v4No1 / 1510
101amnon high in rhizosphere compared to root in united states of america vitis vinifera state of new york merlot grapevine 2017-04-03v4No1 / 1588
309amnoncommon rhizosphere, germany, galium mollugo, hedge bedstraw2018-04-05v4No1 / 1599
608sheryoCommon in wheat field in China, amended and unamended biochar, unamended with nitrogen fertilizer (common soil, china, silty clay, triticum aestivum l. cv., xiaoyan no. 22)2020-04-20v4No1 / 1643
824sheryoCommon in soil after 27-35 years of grazing exclusion at 0-10cm depth, Ningxia china (common soil, depth 0-10cm, china, grazing exclusion, 27-35 years of grazing exclusion, haplic calcisol, calci-orthic aridisol, ningxia province, yunwushan national natural grassland protection zone)2021-08-08v4No1 / 1659
686sheryoCommon in vanilla field soil infected with Fusarium oxysporum, fertilized with fungal bio-fertilizer and had low Fusarium cumulative disease incidence (common wanning city, vanilla planifolia, ph 7.6, pot expreiment, soil from vanilla field, fusarium oxysporum f. sp. vanillae, low fusarium cumulative disease incidence , fungal enriched bio-fertilizer, trichoderma guizhouense njau 4742)2028-03-08v4No1 / 1661
608sheryoCommon in wheat field in China, amended and unamended biochar, amended with nitrogen fertilizer (common soil, urea enriched soil, china, silty clay, triticum aestivum l. cv., xiaoyan no. 22)2020-04-20v4No1 / 1682
686sheryoCommon in vanilla field soil infected with Fusarium oxysporum, fertilized with bacterial bio-fertilizer and had low Fusarium cumulative disease incidence (common wanning city, vanilla planifolia, ph 7.6, pot expreiment, soil from vanilla field, fusarium oxysporum f. sp. vanillae, bacterial enriched bio-fertilizer, bacillus amyloliquefaciens w19, low fusarium cumulative disease incidence )2028-03-08v4No1 / 1726
686sheryoCommon in vanilla field soil infected with Fusarium oxysporum, fertilized with organic fertilizer and had high Fusarium cumulative disease incidence (common wanning city, vanilla planifolia, ph 7.6, pot expreiment, soil from vanilla field, fusarium oxysporum f. sp. vanillae, high fusarium cumulative disease incidence , organic fertilizer- chicken manure compost)2028-03-08v4No1 / 1765
309amnoncommon rhizosphere, germany, veronica chamaedrys, germander speedwell2018-04-05v4No1 / 1788
263amnonlower in heat stressed soil (65C) compared to control ( high in control compared to heat stressed soil in research facility soil israel negev desert sandy loam soil ph 7-8 irrigated )2017-12-11v4No1 / 1893
824sheryoCommon in soil after 0-9 years of grazing exclusion at 0-10cm depth, Ningxia china (common soil, depth 0-10cm, china, grazing exclusion, haplic calcisol, calci-orthic aridisol, ningxia province, yunwushan national natural grassland protection zone, 0-9 years of grazing exclusion)2021-08-08v4No1 / 1903
101amnoncommon united states of america, rhizosphere, vitis vinifera, state of new york, merlot, grapevine2017-04-03v4No1 / 1980
175amnoncommon in heavy metal contaminated soils in china (common soil, heavy metal, ph 7-9, china)2017-07-29v4No1 / 2133
296amnoncommon agricultural feature, soil, winter, wheat, depth 0-20cm, north china plain, ph>7, ph<8, china2018-02-11v4No1 / 2160
296amnoncommon agricultural feature, soil, winter, wheat, depth 0-20cm, north china plain, ph>6, ph<7, china2018-02-11v4No1 / 2223
166amnoncommon in river sediment (5cm) with mussels (common united states of america, river, sediment, freshwater biome, mississippi river, depth 5cm, upper mississippi river, mussel, unionidae)2017-07-18v4No1 / 2254
76amnonhigher in seleniferous soil compared to non-seleniferous soil ( high in selenium seleniferous compared to non-seleniferous in united states of america soil rhizosphere woodland area )2017-02-28v4No1 / 2259
443amnon high in particles filtered 2.7um compared to free floating filtered 0.2um in united states of america river water fresh water mississippi river depth 1m 2019-01-07v4No1 / 2266
296amnoncommon in wheat field soil (common agricultural feature, soil, winter, depth 5cm, wheat, north china plain, china)2018-02-11v4No1 / 2341
155amnoncommon in soil loosely bound to wheat root (common soil, rhizosphere, triticum aestivum, wheat, china)2017-07-02v4No1 / 2425
101amnoncommon united states of america, soil, vitis vinifera, state of new york, merlot, grapevine2017-04-03v4No1 / 2537
155amnoncommon in bulk soil in wheat field (common soil, bulk soil, triticum aestivum, wheat, china)2017-07-02v4No1 / 2594
296amnoncommon agricultural feature, soil, winter, wheat, depth 0-20cm, north china plain, ph>8, china2018-02-11v4No1 / 2646
357amnon high in ph>4.5 compared to ph<4.5 in soil topsoil depth 0-10cm moist tropical forest woodland area forest ecosystem 2018-08-18v4No1 / 2773
271amnoncommon soil, depth 0-20cm, china2018-01-09v4No1 / 2856
166amnoncommon in river sediment (5cm) without mussels (common united states of america, river, sediment, freshwater biome, mississippi river, depth 5cm, upper mississippi river)2017-07-18v4No1 / 2877
422amnon high in ph 7-8 compared to ph 5-6 in soil paddy field soil oryza sativa heilongjiang province cultivated environment china 2018-12-04v4No1 / 3267
837sheryoHigher in soil after 10 years compared to 30 years of reforestation with Black locust trees, shaanxi, China ( high in 10 years compared to 30 years in soil silt loam reforestation china shaanxi province loess plateau robinia pseudoacacia )2021-09-27v4No1 / 3368
296amnoncommon agricultural feature, soil, winter, wheat, depth 0-20cm, north china plain, ph>5, ph<6, china2018-02-11v4No1 / 3508
103amnonhigher in particle bound fraction compared to free floating bacteria in mississippi river ( high in particles compared to free floating in united states of america river aquatic biome fresh water mississippi river )2017-04-05v4No1 / 3559
837sheryoHigher in soil after 10 years compared to 20 years of reforestation with Black locust trees, shaanxi, China ( high in 10 years compared to 20 years in soil silt loam reforestation china shaanxi province loess plateau robinia pseudoacacia )2021-09-27v4No1 / 3585
837sheryoHigher in soil after 10 years reforestation with Black locust trees compared to agricultural feild, shaanxi, China ( high in reforestation robinia pseudoacacia 10 years compared to zea mays wheat agricultural field in soil silt loam china shaanxi province loess plateau )2021-09-26v4No1 / 3932
837sheryoHigher in soil after 30 years compared to 20 years of reforestation with Black locust trees, shaanxi, China ( high in 30 years compared to 20 years in soil silt loam reforestation china shaanxi province loess plateau robinia pseudoacacia )2021-09-27v4No1 / 3936
462amnon high in rhizosphere compared to root in united states of america state of tennessee populus tree cultivated environment 2019-01-13v4No1 / 4630
271amnon high in soil compared to rhizosphere glycine max soybean in depth 0-20cm china 2018-01-09v4No1 / 4853
837sheryoHigher in soil after 30 years reforestation with Black locust trees compared to agricultural feild, shaanxi, China ( high in reforestation robinia pseudoacacia 30 years compared to zea mays triticum aestivum agricultural field in soil silt loam china shaanxi province loess plateau )2021-09-27v4No1 / 5596
271amnon high in soil rhizosphere compared to root structure root in glycine max soybean depth 0-20cm china 2018-01-09v4No1 / 7954

Problems / suggestions? Please email info AT dbbact DOT org