Search result for sequence:
TACCGGCAGCACGAGTGATAGCCACTATTATTGGGCCTAAAGCGTCCGTAGCCGGCCGAACAGGTCCATCGGGAAATCCACCCGCTCAACGGGTGGACGTCCGGTGGAAACCAGTCGGCTTGGGGCCGGAAGACCAGAGGGGTACGTCCG
common ontology terms
term enrichment score
TermScore
amerindian0.500000
venezuela0.500000
hunter gatherer0.400000
LOWER IN city0.200000
LOWER IN united states of america0.166667
skin0.071429
homo sapiens0.010989
Fraction of dbbact annotations with this term covered by the query
TermScore
amerindian0.333333
venezuela0.333333
hunter gatherer0.250000
LOWER IN city0.142857
LOWER IN united states of america0.111111
skin0.037037
homo sapiens0.005525
Fraction of annotations for the query sequences containing the term
TermScore
homo sapiens1.000000
skin1.000000
amerindian1.000000
hunter gatherer1.000000
venezuela1.000000
LOWER IN city0.333333
LOWER IN united states of america0.333333

Problems / suggestions? Please email info AT dbbact DOT org