Search result for sequence:
TACCGGCAGCACGAGTGATAGCCACTATTATTGGGCCTAAAGCGTCCGTAGCCGGCCGAACAGGTCCATCGGGAAATCCACCCGCTCAACGGGTGGACGTCCGGTGGAAACCAGTCGGCTTGGGGCCGGAAGACCAGAGGGGTACGTCCG
common ontology terms
term enrichment score
TermScore
amerindian0.500000
venezuela0.500000
hunter gatherer0.400000
LOWER IN city0.222222
LOWER IN united states of america0.181818
skin0.076923
homo sapiens0.011905
Fraction of dbbact annotations with this term covered by the query
TermScore
amerindian0.333333
venezuela0.333333
hunter gatherer0.250000
LOWER IN city0.166667
LOWER IN united states of america0.125000
skin0.040000
homo sapiens0.005988
Fraction of annotations for the query sequences containing the term
TermScore
homo sapiens1.000000
skin1.000000
amerindian1.000000
hunter gatherer1.000000
venezuela1.000000
LOWER IN city0.333333
LOWER IN united states of america0.333333

Problems / suggestions? Please email info AT dbbact DOT org