Search result for sequence:
TACCTGCAGCTCAAGTGGTGACCACTATTATTGGGCCTAAAACGTTCGTAGCCGGTTTGGTAAATGCCTGGGTAAATCGTGTAGCTTAACTATACGAATTCCGGGTAGACTGTCAAACTTGAGACCGGGAGAAGCTAGAGGTACTCCTGG
common ontology terms
Fraction of dbbact annotations with this term covered by the query
TermScore
shenzhen futian national nature reserve0.500000
kandelia candel0.500000
danzhou xinyinggang nature reserve0.500000
dongzhaigang national nature reserve0.500000
futian national nature reserve0.500000
mudflat0.500000
bodega bay0.500000
guangdong province0.333333
mangrove0.333333
spartina alterniflora0.333333
hainan autonomous prefecture0.333333
zostera marina0.333333
marine eelgrass0.333333
mangrove swamp0.250000
zhejiang province0.166667
marine sediment0.142857
depth 0-20cm0.142857
LOWER IN root0.090909
ocean0.062500
state of california0.052632
sediment0.043478
soil0.016129
china0.009524
Fraction of annotations for the query sequences containing the term
TermScore
marine sediment1.000000
china0.888889
soil0.888889
mangrove swamp0.888889
depth 0-20cm0.888889
mangrove0.444444
kandelia candel0.444444
guangdong province0.333333
shenzhen futian national nature reserve0.333333
zhejiang province0.333333
futian national nature reserve0.333333
spartina alterniflora0.222222
hainan autonomous prefecture0.222222
mudflat0.222222
danzhou xinyinggang nature reserve0.111111
dongzhaigang national nature reserve0.111111
state of california0.111111
bodega bay0.111111
ocean0.111111
zostera marina0.111111
marine eelgrass0.111111
sediment0.111111
LOWER IN root0.111111
Exp. ID User ID Description Date Region Flag Sequences
571amnondominant china, soil, mangrove swamp, marine sediment, depth 0-20cm, guangdong province, shenzhen futian national nature reserve, mangrove, kandelia candel2019-12-16v4No1 / 2
571amnoncommon china, soil, mangrove swamp, marine sediment, depth 0-20cm, spartina alterniflora, hainan autonomous prefecture, danzhou xinyinggang nature reserve2019-12-16v4No1 / 1169
571amnoncommon china, soil, mangrove swamp, marine sediment, depth 0-20cm, mangrove, kandelia candel, hainan autonomous prefecture, dongzhaigang national nature reserve2019-12-16v4No1 / 1351
571amnoncommon china, soil, mangrove swamp, marine sediment, depth 0-20cm, zhejiang province, futian national nature reserve, mangrove, kandelia candel2019-12-16v4No1 / 1435
571amnoncommon china, soil, mangrove swamp, marine sediment, depth 0-20cm, zhejiang province, futian national nature reserve, mudflat2019-12-16v4No1 / 1587
571amnoncommon china, soil, mangrove swamp, marine sediment, depth 0-20cm, guangdong province, shenzhen futian national nature reserve, mangrove, kandelia candel2019-12-16v4No1 / 1593
571amnoncommon china, soil, mangrove swamp, marine sediment, depth 0-20cm, mudflat, guangdong province, shenzhen futian national nature reserve2019-12-16v4No1 / 1649
571amnoncommon china, soil, mangrove swamp, marine sediment, depth 0-20cm, zhejiang province, spartina alterniflora, futian national nature reserve2019-12-16v4No1 / 1747
236amnon high in sediment marine sediment compared to root in state of california bodega bay ocean zostera marina marine eelgrass 2017-11-07v4No1 / 2745

Problems / suggestions? Please email info AT dbbact DOT org