Search result for sequence:
TACGAACTGTGCGAACGTTACTCGGAATCACTGGGCTTACAGGGTGCGTAGGTGGCTTGTTAAGCAGGGTGTGAAATCCCTCGGCTCAACCGAGGAACTGCGCTCTGAACTGGCGAGCTAGAGTATGCTAGAGGTGAATGGAACATCCAG
common ontology terms
term enrichment score
TermScore
jiulong river0.500000
fujian province0.500000
depth 0.5m0.400000
nile tilapia0.333333
populated place0.333333
carnivorous beetle0.333333
carabidae0.333333
LOWER IN staphylinidae0.333333
oreochromis niloticus0.285714
beetle0.285714
poland0.285714
river0.272727
texas0.250000
upstream0.250000
LOWER IN downstream0.250000
whole body0.250000
LOWER IN caecum0.142857
fresh water0.100000
city0.095238
colon0.086957
water0.041667
china0.022989
research facility0.019802
united states of america0.010695
Fraction of dbbact annotations with this term covered by the query
TermScore
nile tilapia0.500000
jiulong river0.500000
fujian province0.500000
populated place0.500000
carnivorous beetle0.500000
carabidae0.500000
LOWER IN staphylinidae0.500000
oreochromis niloticus0.333333
depth 0.5m0.333333
beetle0.333333
poland0.333333
texas0.250000
upstream0.250000
LOWER IN downstream0.250000
whole body0.250000
river0.166667
LOWER IN caecum0.100000
city0.058824
fresh water0.055556
colon0.052632
water0.021739
china0.011765
research facility0.010309
united states of america0.005464
Fraction of annotations for the query sequences containing the term
TermScore
river0.750000
water0.500000
fresh water0.500000
depth 0.5m0.500000
jiulong river0.500000
fujian province0.500000
china0.500000
research facility0.250000
texas0.250000
united states of america0.250000
oreochromis niloticus0.250000
nile tilapia0.250000
colon0.250000
LOWER IN caecum0.250000
city0.250000
populated place0.250000
upstream0.250000
LOWER IN downstream0.250000
whole body0.250000
beetle0.250000
carnivorous beetle0.250000
poland0.250000
carabidae0.250000
LOWER IN staphylinidae0.250000

Problems / suggestions? Please email info AT dbbact DOT org