Search result for sequence:
TACGAACTGTGCGAACGTTACTCGGAATCACTGGGCTTACAGGGTGCGTAGGTGGCTTGTTAAGCAGGGTGTGAAATCCCTCGGCTCAACCGAGGAACTGCGCTCTGAACTGGCGAGCTAGAGTATGCTAGAGGTGAATGGAACATCCAG
common ontology terms
term enrichment score
TermScore
jiulong river0.500000
fujian province0.500000
depth 0.5m0.400000
nile tilapia0.333333
populated place0.333333
carnivorous beetle0.333333
poland0.333333
carabidae0.333333
LOWER IN staphylinidae0.333333
oreochromis niloticus0.285714
beetle0.285714
river0.272727
texas0.250000
upstream0.250000
LOWER IN downstream0.250000
whole body0.200000
LOWER IN caecum0.133333
fresh water0.095238
city0.090909
colon0.086957
water0.038462
china0.018692
research facility0.018018
united states of america0.009852
Fraction of dbbact annotations with this term covered by the query
TermScore
nile tilapia0.500000
jiulong river0.500000
fujian province0.500000
populated place0.500000
carnivorous beetle0.500000
poland0.500000
carabidae0.500000
LOWER IN staphylinidae0.500000
oreochromis niloticus0.333333
depth 0.5m0.333333
beetle0.333333
texas0.250000
upstream0.250000
LOWER IN downstream0.250000
river0.166667
whole body0.166667
LOWER IN caecum0.090909
city0.055556
colon0.052632
fresh water0.052632
water0.020000
china0.009524
research facility0.009346
united states of america0.005025
Fraction of annotations for the query sequences containing the term
TermScore
river0.750000
water0.500000
fresh water0.500000
depth 0.5m0.500000
jiulong river0.500000
fujian province0.500000
china0.500000
research facility0.250000
texas0.250000
united states of america0.250000
oreochromis niloticus0.250000
nile tilapia0.250000
colon0.250000
LOWER IN caecum0.250000
city0.250000
populated place0.250000
upstream0.250000
LOWER IN downstream0.250000
whole body0.250000
beetle0.250000
carnivorous beetle0.250000
poland0.250000
carabidae0.250000
LOWER IN staphylinidae0.250000

Problems / suggestions? Please email info AT dbbact DOT org