Search result for sequence:
TACGAAGGGGGCAAGCGTTGTTCGGAATTACTGGGCGTAAAGGGTGTGTAGGCGGATTTGTAAGATAGTGGTGAAATACCTGAGCTCAACTTAGGAATTGCCATTATAACTATAGATCTGGAGTGACAGAGAGGATATTGGAATACCCAG
common ontology terms
term enrichment score
TermScore
rat0.225352
wistar rat0.195122
chicken0.179104
gallus gallus0.173913
kingdom of spain0.163265
czech republic0.156863
feces0.128843
rattus norvegicus0.126984
homo sapiens0.117647
rattus0.115942
israel0.115942
broiler chicken0.107143
free range chicken0.102564
dahl salt-sensitive0.102564
male0.101266
caecum0.096386
kingdom of denmark0.093023
rectum0.086957
adult0.086538
crohn's disease0.085106
thailand0.085106
control diet0.081633
city0.072727
sprague dawley0.072727
united kingdom0.068966
infant0.065574
united states of america0.056738
mexico0.055556
LOWER IN cuba0.055556
lima0.055556
children0.054054
indonesia0.054054
municipality of yogyakarta0.054054
dnbs induced colitis0.054054
shantytown0.054054
LOWER IN el salado0.054054
salt0.054054
salt rich diet0.054054
LOWER IN himalayas0.054054
cron diet0.054054
perianal skin0.054054
santa catalina island0.054054
urocyon littoralis0.054054
urocyon littoralis catalinae0.054054
santa catalina island fox0.054054
LOWER IN typhlitis0.054054
age >940.054054
tenth decade human stage0.054054
china0.054054
salinity <5 ppt0.054054
LOWER IN salinity &gt;20 ppt0.054054
estuary water0.054054
bilbao0.054054
colon0.052632
madrid0.052632
hymenolepis diminuta0.052632
LOWER IN estonia0.052632
age < 3 years0.052632
LOWER IN viet nam0.052632
toronto0.052632
viet nam0.052632
LOWER IN nepal0.052632
metabolic syndrome0.052632
LOWER IN american diet0.052632
LOWER IN venezuela0.052632
LOWER IN amerindian0.052632
ninth decade human stage0.052632
LOWER IN 65-79 year-old human stage0.052632
age 30 days0.052632
LOWER IN asian0.052632
sigmoid colon0.051282
terminal ileum0.051282
gay0.051282
hispanic or latin american0.051282
age 8 weeks0.051282
LOWER IN small village0.051282
fructose diet0.051282
fructose0.051282
LOWER IN left colon0.051282
LOWER IN external acoustic meatus0.051282
LOWER IN ear canal0.051282
LOWER IN hunter gatherer0.051282
LOWER IN fifth decade human stage0.051282
LOWER IN age 1 week0.051282
caucasian0.051282
european0.051282
estuary0.051282
caloric restriction diet0.050000
jejunum0.050000
LOWER IN right colon0.050000
homosexual0.048780
msm0.048780
LOWER IN 1-month-old human stage0.048780
research facility0.048632
LOWER IN fourth decade human stage0.047619
biopsy0.046512
belgium0.046512
switzerland0.045455
hiv infection0.044444
russia0.044444
Fraction of dbbact annotations with this term covered by the query
TermScore
mexico1.000000
LOWER IN cuba1.000000
lima1.000000
wistar rat0.666667
children0.500000
indonesia0.500000
municipality of yogyakarta0.500000
dnbs induced colitis0.500000
free range chicken0.500000
shantytown0.500000
LOWER IN el salado0.500000
dahl salt-sensitive0.500000
salt0.500000
salt rich diet0.500000
LOWER IN himalayas0.500000
cron diet0.500000
perianal skin0.500000
santa catalina island0.500000
urocyon littoralis0.500000
urocyon littoralis catalinae0.500000
santa catalina island fox0.500000
LOWER IN typhlitis0.500000
age >940.500000
tenth decade human stage0.500000
china0.500000
salinity <5 ppt0.500000
LOWER IN salinity &gt;20 ppt0.500000
estuary water0.500000
bilbao0.500000
colon0.333333
madrid0.333333
hymenolepis diminuta0.333333
LOWER IN estonia0.333333
age < 3 years0.333333
LOWER IN viet nam0.333333
toronto0.333333
viet nam0.333333
LOWER IN nepal0.333333
metabolic syndrome0.333333
LOWER IN american diet0.333333
LOWER IN venezuela0.333333
LOWER IN amerindian0.333333
ninth decade human stage0.333333
LOWER IN 65-79 year-old human stage0.333333
age 30 days0.333333
LOWER IN asian0.333333
sigmoid colon0.250000
terminal ileum0.250000
czech republic0.250000
gay0.250000
hispanic or latin american0.250000
age 8 weeks0.250000
LOWER IN small village0.250000
fructose diet0.250000
fructose0.250000
kingdom of denmark0.250000
LOWER IN left colon0.250000
LOWER IN external acoustic meatus0.250000
LOWER IN ear canal0.250000
LOWER IN hunter gatherer0.250000
LOWER IN fifth decade human stage0.250000
LOWER IN age 1 week0.250000
caucasian0.250000
european0.250000
estuary0.250000
rat0.222222
caloric restriction diet0.200000
jejunum0.200000
LOWER IN right colon0.200000
kingdom of spain0.190476
chicken0.187500
rectum0.181818
gallus gallus0.176471
crohn's disease0.166667
homosexual0.166667
msm0.166667
thailand0.166667
LOWER IN 1-month-old human stage0.166667
broiler chicken0.142857
rattus norvegicus0.142857
control diet0.142857
LOWER IN fourth decade human stage0.142857
biopsy0.125000
belgium0.125000
rattus0.117647
israel0.117647
switzerland0.111111
hiv infection0.100000
russia0.100000
city0.100000
sprague dawley0.100000
male0.090909
2-5 year-old child stage0.090909
LOWER IN rural community0.090909
duodenum0.090909
united kingdom0.086957
caecum0.083333
state of new york0.083333
LOWER IN poland0.076923
infant0.076923
Fraction of annotations for the query sequences containing the term
TermScore
feces0.800000
homo sapiens0.514286
adult0.257143
united states of america0.228571
research facility0.228571
rat0.228571
gallus gallus0.171429
chicken0.171429
kingdom of spain0.142857
LOWER IN control0.114286
caecum0.114286
male0.114286
rattus0.114286
czech republic0.114286
wistar rat0.114286
rattus norvegicus0.114286
israel0.114286
broiler chicken0.085714
crohn's disease0.057143
rectum0.057143
infant0.057143
farm0.057143
free range chicken0.057143
thailand0.057143
city0.057143
sprague dawley0.057143
control diet0.057143
dahl salt-sensitive0.057143
kingdom of denmark0.057143
united kingdom0.057143
colon0.028571
sigmoid colon0.028571
terminal ileum0.028571
biopsy0.028571
children0.028571
LOWER IN female0.028571
madrid0.028571
belgium0.028571
switzerland0.028571
LOWER IN poland0.028571
hymenolepis diminuta0.028571
child0.028571
2-5 year-old child stage0.028571
LOWER IN adult0.028571
indonesia0.028571
municipality of yogyakarta0.028571
LOWER IN sweden0.028571
hiv infection0.028571
gay0.028571
homosexual0.028571
msm0.028571
mexico0.028571
LOWER IN cuba0.028571
hispanic or latin american0.028571
russia0.028571
LOWER IN estonia0.028571
age < 3 years0.028571
dnbs induced colitis0.028571
colitis0.028571
age 8 weeks0.028571
LOWER IN viet nam0.028571
LOWER IN child0.028571
toronto0.028571
lima0.028571
shantytown0.028571
LOWER IN el salado0.028571
LOWER IN small village0.028571
salt0.028571
salt rich diet0.028571
viet nam0.028571
fructose diet0.028571
fructose0.028571
LOWER IN nepal0.028571
LOWER IN himalayas0.028571
LOWER IN rural community0.028571
metabolic syndrome0.028571
diet0.028571
cron diet0.028571
caloric restriction diet0.028571
LOWER IN american diet0.028571
female0.028571
LOWER IN male0.028571
duodenum0.028571
jejunum0.028571
ileum0.028571
LOWER IN caecum0.028571
LOWER IN left colon0.028571
LOWER IN right colon0.028571
sus scrofa0.028571
pig0.028571
perianal skin0.028571
LOWER IN external acoustic meatus0.028571
LOWER IN ear canal0.028571
wild0.028571
santa catalina island0.028571
urocyon littoralis0.028571
urocyon littoralis catalinae0.028571
santa catalina island fox0.028571
control0.028571
LOWER IN typhlitis0.028571
Exp. ID User ID Description Date Region Flag Sequences
19amnonhigher in CD compared to control in biopsies ( high in crohn's disease compared to control in homo sapiens united states of america rectum caecum colon sigmoid colon terminal ileum biopsy children )2016-11-14v4No1 / 34
630amnon high in male compared to female in feces homo sapiens adult kingdom of spain madrid 2020-05-31v3No1 / 63
398amnon high in crohn's disease compared to control in feces homo sapiens belgium 2018-11-15v4No1 / 68
663amnon high in switzerland compared to poland in feces homo sapiens adult 2020-09-22v4No1 / 76
358amnonhigher in helminth infected rats compared to controls ( high in hymenolepis diminuta compared to control in feces research facility rattus czech republic rat wistar rat )2018-08-19v4No1 / 82
723amnonhigher in children age 2-4 years compared to mothers ( high in child 2-5 year-old child stage compared to adult in feces homo sapiens indonesia municipality of yogyakarta )2021-01-02v3No1 / 95
578amnon high in kingdom of spain compared to sweden in feces homo sapiens hiv infection adult gay homosexual msm male 2020-01-14v3No1 / 133
644amnonhigher in individuals born in mexico compared to cuba ( high in mexico compared to cuba in feces homo sapiens united states of america adult hispanic or latin american )2020-08-31v4No1 / 136
241amnonhigher in babies from russia compared to estonia ( high in russia compared to estonia in feces homo sapiens infant age < 3 years )2017-11-13v4No1 / 146
358amnonhigher in dnbs induced colitis compared to controls in rat feces ( high in dnbs induced colitis colitis compared to control in feces research facility rattus czech republic rat wistar rat )2018-08-19v4No1 / 154
495amnoncommon farm, caecum, gallus gallus, kingdom of spain, chicken, free range chicken, age 8 weeks2019-03-03v4No1 / 189
568amnon high in thailand compared to viet nam in feces gallus gallus chicken broiler chicken 2019-12-08v3No1 / 206
10amnonpositively correlated with age (6-35) ( high in adult compared to child in feces homo sapiens toronto )2016-10-27v4No1 / 228
53amnon high in lima shantytown compared to el salado small village in feces homo sapiens city 2017-01-21v4No1 / 236
586amnoncommon feces, research facility, rattus norvegicus, sprague dawley, israel, rat, control diet, male2020-02-09v4No1 / 241
429amnoncommon feces, research facility, rattus norvegicus, dahl salt-sensitive, israel, rat, salt, salt rich diet2018-12-13v4No1 / 249
568amnoncommon feces, gallus gallus, chicken, broiler chicken, viet nam2019-12-08v3No1 / 272
586amnoncommon feces, research facility, rattus norvegicus, sprague dawley, israel, rat, fructose diet, fructose, male2020-02-09v4No1 / 287
477amnon high in united states of america compared to nepal himalayas rural community in feces homo sapiens adult 2019-01-28v4No1 / 295
358amnoncommon feces, research facility, rattus, czech republic, rat, wistar rat2018-08-19v4No1 / 309
568amnoncommon feces, gallus gallus, thailand, chicken, broiler chicken2019-12-08v3No1 / 320
429amnoncommon feces, research facility, rattus norvegicus, dahl salt-sensitive, israel, rat, control diet2018-12-13v4No1 / 327
467amnoncommon feces, homo sapiens, metabolic syndrome, adult, kingdom of denmark2019-01-14v4No1 / 328
187amnoncommon feces, research facility, rattus, czech republic, rat, wistar rat2017-08-23v4No1 / 351
293amnonhigher in caloric restriction (CRON) diet compared to american diet ( high in diet cron diet caloric restriction diet compared to american diet in feces homo sapiens united states of america adult )2018-02-07v4No1 / 381
63amnon high in female compared to male in feces homo sapiens united states of america 2017-12-04v4No1 / 384
256amnonhigher in small intestine compared to colon in pigs ( high in duodenum jejunum ileum compared to caecum left colon right colon in sus scrofa pig united kingdom )2017-11-26v4No1 / 387
582amnon high in rectum perianal skin compared to external acoustic meatus ear canal in united states of america wild santa catalina island urocyon littoralis urocyon littoralis catalinae santa catalina island fox 2020-01-22v4No1 / 400
495amnon high in control compared to typhlitis disease intestinal disease in farm caecum gallus gallus kingdom of spain chicken free range chicken 2019-03-03v4No1 / 412
371amnonlower in amerindians compared to western visitors ( high in united states of america city compared to venezuela amerindian hunter gatherer in feces homo sapiens )2018-09-06v4No1 / 417
438amnonhigher in centenarians compared to adults ( high in age >94 ninth decade human stage tenth decade human stage compared to 65-79 year-old human stage fourth decade human stage fifth decade human stage in feces homo sapiens china )2018-12-30v4No1 / 474
738amnon high in age 30 days compared to age 1 week in caecum gallus gallus chicken united kingdom 2021-01-30v3No1 / 474
650amnon high in caucasian european compared to asian in feces homo sapiens united states of america adult state of new york 2020-09-12v4No1 / 475
273amnon high in age 1-year-old human stage compared to 1-month-old human stage in feces homo sapiens infant kingdom of denmark 2018-01-14v4No1 / 557
510amnon high in fresh water salinity <5 ppt compared to saline water salinity >20 ppt in estuary water kingdom of spain estuary water bilbao 2019-03-20v4No1 / 592

Problems / suggestions? Please email info AT dbbact DOT org