Search result for sequence:
TACGAAGGGGGCAAGCGTTGTTCGGAATTATTGGGCGTAAAGCGTATGTAGGCGGCTGGACAAGTCAGACGTGTAAGCCCACGGCTCAACCGTGGAATTGCGTTTGAAACTGTTCAGCTTGAGTACAGGAGAGGAAAGCGGAATTCCCAG
common ontology terms
Fraction of dbbact annotations with this term covered by the query
TermScore
mangrove swamp0.500000
mudflat0.500000
shenzhen futian national nature reserve0.500000
kandelia candel0.500000
dongzhaigang national nature reserve0.500000
futian national nature reserve0.500000
leizhou nature reserve0.500000
guangdong province0.333333
mangrove0.333333
hainan autonomous prefecture0.333333
spartina alterniflora0.333333
zhejiang province0.166667
depth 0-20cm0.142857
marine sediment0.071429
rhizosphere0.031250
china0.019048
soil0.016129
Fraction of annotations for the query sequences containing the term
TermScore
china1.000000
mangrove swamp1.000000
soil0.900000
marine sediment0.900000
depth 0-20cm0.900000
guangdong province0.500000
mudflat0.400000
shenzhen futian national nature reserve0.400000
mangrove0.400000
kandelia candel0.400000
zhejiang province0.300000
futian national nature reserve0.300000
hainan autonomous prefecture0.100000
dongzhaigang national nature reserve0.100000
rhizosphere0.100000
leizhou nature reserve0.100000
spartina alterniflora0.100000
Exp. ID User ID Description Date Region Flag Sequences
571amnondominant china, soil, mangrove swamp, marine sediment, depth 0-20cm, mudflat, guangdong province, shenzhen futian national nature reserve2019-12-16v4No1 / 1
571amnondominant china, soil, mangrove swamp, marine sediment, depth 0-20cm, guangdong province, shenzhen futian national nature reserve, mangrove, kandelia candel2019-12-16v4No1 / 2
571amnoncommon china, soil, mangrove swamp, marine sediment, depth 0-20cm, hainan autonomous prefecture, dongzhaigang national nature reserve, mudflat2019-12-16v4No1 / 1422
571amnoncommon china, soil, mangrove swamp, marine sediment, depth 0-20cm, zhejiang province, futian national nature reserve, mangrove, kandelia candel2019-12-16v4No1 / 1435
34amnoncommon in mangrove rhizosphere (common mangrove swamp, rhizosphere, china)2016-12-06v4No1 / 1473
571amnoncommon china, soil, mangrove swamp, marine sediment, depth 0-20cm, guangdong province, leizhou nature reserve, mangrove, kandelia candel2019-12-16v4No1 / 1523
571amnoncommon china, soil, mangrove swamp, marine sediment, depth 0-20cm, zhejiang province, futian national nature reserve, mudflat2019-12-16v4No1 / 1587
571amnoncommon china, soil, mangrove swamp, marine sediment, depth 0-20cm, guangdong province, shenzhen futian national nature reserve, mangrove, kandelia candel2019-12-16v4No1 / 1593
571amnoncommon china, soil, mangrove swamp, marine sediment, depth 0-20cm, mudflat, guangdong province, shenzhen futian national nature reserve2019-12-16v4No1 / 1649
571amnoncommon china, soil, mangrove swamp, marine sediment, depth 0-20cm, zhejiang province, spartina alterniflora, futian national nature reserve2019-12-16v4No1 / 1747

Problems / suggestions? Please email info AT dbbact DOT org