Search result for sequence:
TACGAAGGGGGCTAGCGTTGCTCGGAATCACTGGGCGTAAAGCGCACGTAGGCGGCTTTTTAAGTCAGGGGTGAAATCCTGGAGCTCAACTCCAGAACTGCCTTTGATACTGAGAAGCTTGAGTCCGGGAGAGGTGAGTGGAACTGCGAG
common ontology terms
term enrichment score
TermScore
soil0.723060
china0.307333
rhizosphere0.274243
depth (soil) 0-10cm0.155898
agricultural field0.149686
cultivated environment0.141768
depth (soil) 0-20cm0.130087
united states of america0.126060
topsoil0.119540
zea mays0.115817
silt loam0.106852
forest ecosystem0.096819
loess plateau0.089517
triticum aestivum0.089232
canada0.087986
grand river watershed0.087558
rare charitable research reserve0.087558
kellogg biological station0.083333
mesic type hapludalf0.083333
kalamazoo loam0.083333
shaanxi province0.083333
cambridge0.077393
province of ontario0.074510
woodland area0.074182
luvisol0.070423
river0.066667
glycine max0.066587
robinia pseudoacacia0.066038
reforestation0.066038
citrus0.064965
state of michigan0.062500
yunwushan national natural grassland protection zone0.061611
ningxia province0.061611
calci-orthic aridisol0.061611
haplic calcisol0.061611
grazing exclusion0.061611
forested area0.060677
brazil0.058374
farm0.057002
fresh water0.056399
root0.056338
ph 7-80.056000
orchard0.052632
state of california0.050682
paddy field soil0.048662
ph 7.60.048662
united states0.048077
nicollet soil series0.048077
des moines0.048077
skin0.048000
oryza sativa0.047695
wheat0.047506
iowa0.046948
tree0.044843
maize field0.044118
ph 60.043478
restored prairie0.043478
ph 4-50.042328
agricultural feature0.041096
ph 6-70.041026
state of tennessee0.040816
state of new york0.039604
fertilized soil0.039409
depth (soil) 0-30 cm0.039344
peatland0.039216
bulk soil0.039024
biochar0.038835
flood plain0.038835
sacramento0.038835
cosumnes river preserve0.038835
depth 0-15cm0.038835
quercus velutina0.038835
quercus alba0.038835
quercus rubra0.038835
acer saccharum0.038835
acer saccharum subsp. nigrum0.038835
fagus grandifolia0.038835
forest0.038835
summer0.036832
sediment0.035524
depth (soil) 10-25cm0.034739
peat soil0.034539
depth (soil) 15cm0.034539
depth (soil) 0-15cm0.034440
ph 50.034342
minas gerais state0.034146
campos rupestres0.034146
dipsacus fullonum0.034146
solidago0.034146
apocynum0.034146
decomissioned agricultural field0.034146
meadow ecosystem0.034146
daucus carota0.033573
germany0.033241
water0.033058
zhejiang province0.031963
surface water0.031963
ph 4.50.029630
heilongjiang province0.029630
clay loam0.029630
Fraction of dbbact annotations with this term covered by the query
TermScore
ph 6-6.51.000000
ph 5.51.000000
depth (soil) 10-25cm1.000000
cane toad1.000000
bufo marinus1.000000
jinxiang county1.000000
qiao nature reserve1.000000
sonneratia apetala1.000000
quaternary laterite soil1.000000
cucurbita moschata1.000000
pumpkin1.000000
banana1.000000
musa acuminata1.000000
volcan sumaco1.000000
cinnamomum camphora1.000000
anxi county1.000000
river water1.000000
fuzhou city prefecture1.000000
xiyuan river1.000000
fall1.000000
depth (soil) 0-10cm0.846154
fertilized soil0.800000
peat soil0.750000
mississippi river0.750000
depth (soil) 15cm0.750000
cultivated environment0.750000
depth (soil) 0-30 cm0.750000
maize field0.750000
soil0.742574
rhizosphere0.723404
zea mays0.700000
peatland0.666667
sphagnum bog0.666667
depth 20cm0.666667
fen0.666667
park0.666667
particles0.666667
hordeum vulgare0.666667
subtropical0.666667
northeast china0.666667
ph 4.50.666667
non-fertilized soil0.666667
soybean0.666667
topsoil0.666667
guangxi zhuang autonomous region0.666667
cambisol0.666667
heilongjiang province0.666667
black soil0.666667
mollisol0.666667
clay loam0.666667
paddy field soil0.666667
silt loam0.666667
ph 4-60.666667
unamended soil0.666667
potting mix0.666667
saccharum0.666667
sugarcane0.666667
ph 7.60.666667
ph 5.5-60.666667
ph 5.90.666667
ph 7.850.666667
LOWER IN plant litter0.666667
depth (soil) 0-15cm0.666667
depth (soil) 30-60cm0.666667
ph 6.70.666667
depth 10-20cm0.666667
LOWER IN depth 20-40cm0.666667
loess plateau0.666667
ph 80.666667
loam soil0.666667
luancheng county0.666667
triticum aestivum0.636364
depth 5cm0.600000
ph 50.600000
river0.583333
agricultural field0.583333
bulk soil0.571429
glycine max0.571429
forest ecosystem0.555556
field soil0.500000
seleniferous0.500000
non-seleniferous0.500000
temperate grassland biome0.500000
flooded grassland biome0.500000
vero beach, fl0.500000
quincy, fl0.500000
immokalee, fl0.500000
ft. pierce, fl0.500000
gainesville, fl0.500000
central park0.500000
merlot0.500000
grapevine0.500000
nile tilapia0.500000
winter barley0.500000
myrtillocactus geometrizans0.500000
opuntia robusta0.500000
root zone soil0.500000
alpine bog0.500000
plant surface0.500000
taxus0.500000
Fraction of annotations for the query sequences containing the term
TermScore
soil0.704545
china0.388889
united states of america0.217172
rhizosphere0.169192
depth (soil) 0-20cm0.085859
depth (soil) 0-10cm0.085859
agricultural field0.085859
cultivated environment0.078283
canada0.065657
topsoil0.065657
zea mays0.063131
silt loam0.058081
forest ecosystem0.053030
triticum aestivum0.047980
loess plateau0.047980
grand river watershed0.047980
province of ontario0.047980
cambridge0.047980
rare charitable research reserve0.047980
state of michigan0.045455
kellogg biological station0.045455
mesic type hapludalf0.045455
kalamazoo loam0.045455
shaanxi province0.045455
woodland area0.042929
luvisol0.037879
citrus0.035354
river0.035354
glycine max0.035354
robinia pseudoacacia0.035354
reforestation0.035354
fresh water0.032828
state of california0.032828
brazil0.032828
farm0.032828
forested area0.032828
yunwushan national natural grassland protection zone0.032828
ningxia province0.032828
calci-orthic aridisol0.032828
haplic calcisol0.032828
grazing exclusion0.032828
root0.030303
ph 7-80.030303
skin0.027778
orchard0.027778
tree0.025253
oryza sativa0.025253
wheat0.025253
paddy field soil0.025253
ph 7.60.025253
united states0.025253
nicollet soil series0.025253
des moines0.025253
iowa0.025253
state of new york0.022727
ph 60.022727
ph 4-50.022727
agricultural feature0.022727
ph 6-70.022727
state of tennessee0.022727
restored prairie0.022727
maize field0.022727
peatland0.020202
germany0.020202
sediment0.020202
bulk soil0.020202
summer0.020202
water0.020202
fertilized soil0.020202
depth (soil) 0-30 cm0.020202
biochar0.020202
flood plain0.020202
sacramento0.020202
cosumnes river preserve0.020202
depth 0-15cm0.020202
quercus velutina0.020202
quercus alba0.020202
quercus rubra0.020202
acer saccharum0.020202
acer saccharum subsp. nigrum0.020202
fagus grandifolia0.020202
forest0.020202
peat soil0.017677
research facility0.017677
depth (soil) 15cm0.017677
ph 50.017677
zhejiang province0.017677
minas gerais state0.017677
campos rupestres0.017677
depth (soil) 0-15cm0.017677
depth (soil) 10-25cm0.017677
surface water0.017677
dipsacus fullonum0.017677
solidago0.017677
apocynum0.017677
daucus carota0.017677
decomissioned agricultural field0.017677
meadow ecosystem0.017677
state of florida0.015152
plant0.015152
Exp. ID User ID Description Date Region Flag Sequences
357amnonhigh freq. in moist tropical forest topsoil around the world (dominant soil, topsoil, depth (soil) 0-10cm, moist tropical forest, woodland area, forest ecosystem)2018-08-18v4No1 / 4
357amnondominant soil, topsoil, depth (soil) 0-10cm, montane forest, forest ecosystem, woodland area2018-08-19v4No1 / 5
474amnondominant farm, soil, soybean, glycine max, ph 4-6, brazil, cultivated environment2019-01-16v4No1 / 8
359amnondominant soil, topsoil, depth (soil) 0-10cm, guangdong province, subtropical broadleaf forest biome, china, forest ecosystem, woodland area2018-08-19v4No1 / 10
147amnondominant peatland, soil, siberia, ph 4.5, lichen, moss2017-04-20v4No1 / 18
147amnondominant pinus sibirica, tundra, soil, pine forest, ph 4, siberia, forest ecosystem2017-04-20v4No1 / 20
696amnoncommon georissa, georissa similis, state of sabah, malaysia, gastrointestinal system, stomach, land snail2028-03-27v3No1 / 24
696amnoncommon state of sabah, malaysia, gastrointestinal system, stomach, land snail, opisthostoma concinnum, plectostoma concinnum2028-03-27v3No1 / 36
462amnoncommon united states of america, state of tennessee, populus, tree, root, cultivated environment2019-01-13v4No1 / 51
130amnoncommon peatland, leaf, austria, plant, alpine bog, plant surface, sphagnum bog2017-04-15v4No1 / 65
696amnoncommon alycaeus jagori, state of sabah, malaysia, gastrointestinal system, stomach, land snail2028-03-27v3No1 / 74
108amnonincreases during fasting in nile tilapia colon ( high in fasting late timepoints compared to early timepoints in state of texas research facility united states of america colon oreochromis niloticus nile tilapia )2017-04-07v4No1 / 81
499amnoncommon digestive system, pond, intestine, brazil, remartinia, aeshnidae, dragonfly, larval stage2019-03-05v4No1 / 104
387amnon high in summer compared to winter in ursus arctos brown bear feces sweden wild 2018-11-03v4No1 / 110
536amnoncommon snake, skin, united states of america, southern united states, thamnophis sirtalis, common garter snake2019-07-28v4No1 / 110
536amnoncommon snake, skin, united states of america, southern united states, agkistrodon piscivorus, aquatic snake2019-07-28v4No1 / 115
205amnonhigher in depth 15cm compared to 2.5cm in rock piles in duluth complex ( high in depth (soil) 15cm depth compared to depth 2.5cm in rock united states of america quarry duluth complex ph 4-5 state of minnesota sulfide )2017-10-03v4No1 / 120
374amnoncommon skin, costa rica, amphibia, rhaebo haematiticus, truando toad, toad2018-09-09v4No1 / 121
548amnoncommon minas gerais state, campos rupestres, brazil, barbacenia macrantha, stem, stem endosphere2019-08-17v4No1 / 123
996amnon high in fall summer compared to winter in river water china upstream fuzhou city prefecture xiyuan river fresh water surface water river 2022-12-28v3No1 / 130
374amnoncommon skin, costa rica, amphibia, craugastor fitzingeri, common rain frog, frog2018-09-09v4No1 / 136
402amnoncommon sediment, soil, mine tailing, alkaline mine tailing, guangxi zhuang autonomous region, zone 2,3, china2018-11-18v4No1 / 159
357amnoncommon in moist tropical forest topsoil around the world (common soil, topsoil, depth (soil) 0-10cm, moist tropical forest, woodland area, forest ecosystem)2018-08-18v4No1 / 171
374amnoncommon skin, costa rica, amphibia, craugastor bransfordii, bransford’s litter frog, frog2018-09-09v4No1 / 171
147amnoncommon soil, siberia, peatland, ph 4.5, lichen, moss2017-04-20v4No2 / 396
147amnoncommon pinus sibirica, tundra, soil, pine forest, ph 4, siberia, forest ecosystem2017-04-20v4No2 / 416
432amnoncommon united states of america, plant, state of north carolina, stem, tsuga sieboldii, southern japanese hemlock2018-12-19v4No1 / 183
536amnoncommon snake, skin, united states of america, southern united states, pantherophis obsoletus, black rat snake, arboreal snake2019-07-28v4No1 / 184
631sheryoHigher in maize field biochar amended bulk soil, after 6 years of biochar amended, compared to unamended soil ( high in biochar compared to unamended soil in china guizhou province kaiyang county soil maize field bulk soil after 6 years )2020-06-02v3No1 / 188
75amnoncommon homo sapiens, skin, arm, venezuela, amerindian, hunter gatherer2017-02-27v4No1 / 190
827sheryoHigher in soil depth of 275cm compared to soil depth of 465cm in clayey till loam soil, Lund Denmark ( high in depth 200-350cm compared to depth 450-600cm in lund kingdom of denmark agricultural field clayey till late weichselian glaciation loam soil )2021-09-13v3No1 / 197
316amnoncommon united states of america, soil, topsoil, state of ohio, depth (soil) 0-10cm, ph 5, forest ecosystem2018-04-10v4No1 / 199
205amnoncommon in rock piles from duluth complex (common rock, united states of america, quarry, duluth complex, ph 4-5, state of minnesota, sulfide)2017-10-03v4No1 / 205
755sheryocommon in wild soybean (Glycine soja) rhizosphere (common ph 7, jilin province, rhizosphere, soil, black soil, china, glycine soja)2021-03-18v3No1 / 210
583amnoncommon soil, mountain, switzerland, ph 4-6, depth (soil) 0-10cm, elevation 2000-3000m, siliceous parent material, rhone river valley2020-01-27v3No1 / 234
536amnoncommon snake, skin, united states of america, southern united states, agkistrodon contortrix, copperhead snake2019-07-28v4No1 / 236
602sheryohigher in rhizoshere of tomato plant roots planted in unamended potting mix ( high in unamended compared to amended with biochar in potting mix rhizosphere israel solanum lycopersicum )2020-04-05v4No1 / 252
996amnoncommon in river water without anthropogenic effect (common river water, china, upstream, fuzhou city prefecture, xiyuan river, fresh water, surface water, river)2022-12-28v3No1 / 254
788amnoncommon plant litter, mesocosm, state of georgia, united states of america2021-05-31v4No1 / 259
432amnoncommon united states of america, plant, state of north carolina, stem, tsuga chinensis, chinese hemlock2018-12-19v4No1 / 260
842sheryoCommon in soil depth of 0-15cm in a mature forest in Ontario, Canada (common mature forest, brunisol, grand river watershed, rare charitable research reserve, quercus velutina, quercus alba, quercus rubra, acer saccharum, acer saccharum subsp. nigrum, fagus grandifolia, cambridge, forest, forested area, province of ontario, canada, soil)2021-11-14v3No1 / 261
357amnon high in ph<4 compared to ph>4 in soil topsoil depth (soil) 0-10cm southern temperate forest temperate broadleaf and mixed forest biome woodland area forest ecosystem 2018-08-19v4No1 / 282
156amnoncommon brassica, brassica oleracea, leaf, phyllosphere, china2017-07-27v4No1 / 292
824sheryoHigher in soil at 0-10cm depth after 27-35 years compared to after 0-9 years of grazing exclusion, Ningxia china ( high in 27-35 years of grazing exclusion compared to 0-9 years of grazing exclusion in depth (soil) 0-10cm yunwushan national natural grassland protection zone ningxia province calci-orthic aridisol haplic calcisol grazing exclusion china soil )2021-08-08v4No1 / 294
761sheryoHigher in bulk soil compared to maize rhizosphere in sandy soil maize field in Germany ( high in bulk soil compared to rhizosphere in ph 5 lower saxony sandy soil germany maize field )2021-04-06v3No1 / 294
357amnon high in ph<3 compared to ph>3 in soil topsoil depth (soil) 0-10cm subpolar coniferous forest biome boreal forest woodland area forest ecosystem 2018-08-19v4No1 / 297
824sheryoHigher soil at 40-60cm depth after 27-35 years compared to after 0-9 years of grazing exclusion, Ningxia china ( high in 27-35 years of grazing exclusion compared to 0-9 years of grazing exclusion in yunwushan national natural grassland protection zone ningxia province calci-orthic aridisol haplic calcisol grazing exclusion china soil )2021-08-08v4No1 / 299
432amnoncommon united states of america, plant, state of north carolina, stem, tsuga dumosa, himalayan hemlock2018-12-19v4No1 / 309
828sheryoHigher at 0-20cm depth compared to 20-40cm depth in gleysol soil of poplar plantation, sihong, china ( high in depth (soil) 0-20cm compared to depth 20-40cm in ph 6-7 clay loam gleysol china jiangsu province sihong county chenwei forest soil poplar plantation poplar )2021-08-25v4No1 / 312
534amnoncommon river, water, fresh water, depth (water) 10cm, koshi river, nepal, particle bound, filtered 2.7um2019-07-22v4No1 / 315
807amnonhigher during typhoon with red soil pollution compared to normal weather ( high in storm typhoon compared to normal weather in autumn near shore japan filtered 0.2um surface water okinawa islands sea water )2021-06-20v3No1 / 318
402amnon high in zone 2,3 compared to zone 1 in sediment soil mine tailing alkaline mine tailing guangxi zhuang autonomous region china 2018-11-18v4No1 / 322
882amnoncommon king george island, antarctic pearlwort, colobanthus quitensis, antarctica, rhizosphere2022-03-20v3No1 / 325
512amnoncommon fen, peatland, peat soil, soil, hani peatland, baekdudaegan, ph 5-6, china2019-03-22v4No1 / 329
750sheryoCommon in soil of wheat field in China (common fluvo-aquic soil, ph 7.6, hebei province, luancheng county, china, triticum aestivum, soil)2021-03-11v3No1 / 337
254amnoncommon river, water, fresh water, depth (soil) 50cm, jiulong river, fujian province, china2017-11-23v4No1 / 347
718amnon high in hypolimnion compared to epilimnion in freshwater lake bog lake united states of america state of wisconsin ph 4.5-5 dimictic lake "north sparkling bog" lake 2028-05-23v4No1 / 351
583amnoncommon soil, mountain, switzerland, depth (soil) 0-10cm, elevation 2000-3000m, siliceous parent material, ph 4.5-7, canton of graubunden2020-01-27v3No1 / 359
512amnon high in hani peatland baekdudaegan ph 5-6 compared to riganqiao peatland tibetan plateau ph 5.5-6.5 in fen peatland peat soil soil china 2019-03-22v4No1 / 363
813amnonhigher in epiphytic materiall attached to intact branch compared to severed suspended branch ( high in intact branch compared to severed branch in epiphytic material united states of america state of washington olympic national park canopy soil soil )2021-06-22v4No1 / 390
842sheryoCommon in soil depth of 30-45cm in an old growth forest in Ontario, Canada (common depth 30-45cm, old growth forest, luvisol, grand river watershed, rare charitable research reserve, quercus velutina, quercus alba, quercus rubra, acer saccharum, acer saccharum subsp. nigrum, fagus grandifolia, cambridge, forest, forested area, province of ontario, canada, soil)2021-11-14v3No1 / 390
842sheryoCommon in soil depth of 30-45cm in a mature forest in Ontario, Canada (common depth 30-45cm, luvisol, mature forest, grand river watershed, rare charitable research reserve, quercus velutina, quercus alba, quercus rubra, acer saccharum, acer saccharum subsp. nigrum, fagus grandifolia, cambridge, forest, forested area, province of ontario, canada, soil)2021-11-14v3No1 / 393
879amnoncommon dog, canis lupus familiaris, adult organism, chest, captive, austria, skin, research facility2022-03-12v4No1 / 399
662amnoncommon clay soil, irrigated, neve yaar, depth (soil) 0-10cm, soil, agricultural field, israel2020-09-21v3No1 / 402
855sheryoHigher in soil depth of 350cm compared to soil depth of 800cm in fertilized soil in china ( high in depth 350cm compared to depth 800cm in luancheng county china agricultural field fertilized soil soil )2021-12-27v3No1 / 418
829sheryohigher soil depth of 12-44cm compared to 44-108cm in Alfisol soil, Dekalb, Illinois, united states of america ( high in depth 12-44cm compared to depth 44-108cm in sandy loam sandy loam soil hapludalf alfisol united states of america soil state of illinois illinois dekalb county )2021-08-26v3No1 / 428
360amnoncommon desert, soil, rhizosphere, agave, agave deserti, state of california2018-08-21v4No1 / 432
842sheryoCommon in soil depth of 15-30cm in a mature forest in Ontario, Canada (common depth 15-30cm, luvisol, mature forest, grand river watershed, rare charitable research reserve, quercus velutina, quercus alba, quercus rubra, acer saccharum, acer saccharum subsp. nigrum, fagus grandifolia, cambridge, forest, forested area, province of ontario, canada, soil)2021-11-14v3No1 / 433
412amnonlower in pig manured soil with wheat-maize rotation compared to non-manured soil ( high in non-manured soil compared to manured soil in soil hunan province red soil cambisol zea mays triticum aestivum china )2018-11-26v4No1 / 437
135amnoncommon soil, tundra, alaska, permafrost, depth (soil) 15cm2017-04-17v4No1 / 438
823sheryoHigher in 10-25cm depth compared to 25-50cm depth in ultisol soil in auburn, alabama ( high in depth (soil) 10-25cm compared to depth (soil) 25-50cm in alabama auburn upland soil ultisol agricultural field soil )2021-08-07v3No1 / 455
415amnonhigher in citrus from humid subtropical compared to mediterranean and semi-arid climate ( high in subtropical compared to mediterranean semi-arid in rhizosphere soil citrus orchard cultivated environment )2018-11-27v4No1 / 458
842sheryoCommon in soil depth of 0-15cm in a mature forest in Ontario, Canada (common depth 0-15cm, luvisol, mature forest, grand river watershed, rare charitable research reserve, quercus velutina, quercus alba, quercus rubra, acer saccharum, acer saccharum subsp. nigrum, fagus grandifolia, cambridge, forest, forested area, province of ontario, canada, soil)2021-11-14v3No1 / 460
254amnonlower in river when close to populated region compared to downstream ( high in downstream compared to upstream city populated place in river water fresh water depth (soil) 50cm jiulong river fujian province china )2017-11-23v4No1 / 468
964amnoncommon stratovolcano, ph 4-5, soil, depth (soil) 10-25cm, ecuador, volcan sumaco2022-12-21v3No1 / 472
357amnoncommon soil, topsoil, depth (soil) 0-10cm, woodland area, forest ecosystem2018-08-19v4No1 / 474
813amnoncommon intact branch, epiphytic material, united states of america, state of washington, olympic national park, canopy soil, soil2021-06-22v4No1 / 475
989amnoncommon rhizosphere, depth (soil) 0-20cm, cinnamomum camphora, anxi county, ph 4-5, farm, china2022-12-26v3No1 / 476
786sheryoCommon in flood plain soil near cosumnes river, california, at 400-700cm depth (common depth (soil) 400-700cm, flood plain, soil, united states of america, state of california, sacramento, cosumnes river preserve)2021-05-18v3No1 / 481
259amnonlower in fertilized soil (npk) compared to non-fertilized ( high in non-fertilized soil compared to fertilized soil in soil rhizosphere ph 5 arachis hypogaea peanut china )2017-12-02v4No1 / 483
360amnoncommon desert, soil, rhizosphere, agave, agave salmiana, mexico, guanajuato2018-08-21v4No1 / 484
662amnoncommon loam soil, loam, irrigated, neve yaar, depth (soil) 0-10cm, soil, agricultural field, israel2020-09-21v3No1 / 489
415amnoncommon rhizosphere, soil, citrus, orchard, united states of america, cultivated environment2018-11-27v4No1 / 494
259amnonhigher in manured soil compared to non-manured ( high in manured soil compared to non-manured in soil rhizosphere ph 5 arachis hypogaea peanut fertilized soil china )2017-12-02v4No1 / 497
357amnoncommon soil, topsoil, depth (soil) 0-10cm, southern temperate forest, temperate broadleaf and mixed forest biome, woodland area, forest ecosystem2018-08-19v4No1 / 499
801sheryoHigher at depth 0-15cm compared to depth 60-90cm in corn agriculture fields, Iowa USA ( high in depth (soil) 0-15cm compared to depth (soil) 60-90cm in kanawha nicollet soil series des moines united states agricultural field iowa zea mays soil )2021-06-15v4No1 / 501
616amnon high in ph 6.7 non-fertilized soil compared to ph 5.5-6 fertilized soil in depth (soil) 0-20cm sugarcane saccharum soil topsoil china guangzhou city prefecture 2020-04-27v3No1 / 504
942amnoncommon banana, rhizosphere, nanning city prefecture, china, musa acuminata2022-11-25v3No1 / 505
842sheryoCommon in soil depth of 15-30cm in an old growth forest in Ontario, Canada (common depth 15-30cm, old growth forest, luvisol, grand river watershed, rare charitable research reserve, quercus velutina, quercus alba, quercus rubra, acer saccharum, acer saccharum subsp. nigrum, fagus grandifolia, cambridge, forest, forested area, province of ontario, canada, soil)2021-11-14v3No1 / 507
357amnoncommon soil, topsoil, depth (soil) 0-10cm, subpolar coniferous forest biome, boreal forest, woodland area, forest ecosystem2018-08-19v4No1 / 538
98amnoncommon citrus, rhizosphere, immokalee, fl, root, state of florida2017-04-01v4No1 / 543
98amnoncommon citrus, rhizosphere, vero beach, fl, root, state of florida2017-04-01v4No1 / 544
462amnon high in populus deltoides compared to populus trichocarpa x deltoides in united states of america state of tennessee populus tree leaf cultivated environment 2019-01-13v4No1 / 559
205amnonhigher in depth 15cm compared to 2.5cm in Ely Greenstone rock piles ( high in depth depth (soil) 15cm compared to depth 2.5cm in rock united states of america quarry state of minnesota ph 7 greenschist )2017-10-03v4No1 / 562
357amnoncommon soil, topsoil, depth (soil) 0-10cm, mediterranean forest biome, forest ecosystem, woodland area2018-08-19v4No1 / 564
254amnon high in summer wet season autumn compared to winter dry season in river water fresh water depth (soil) 50cm jiulong river fujian province china 2017-11-23v4No1 / 571
548amnoncommon minas gerais state, campos rupestres, brazil, barbacenia macrantha, root endosphere, root2019-08-17v4No1 / 575
667amnoncommon depth (soil) 0-20cm, ph 4.5, elevation 500-600m, jiangxi province, lushan mountain, china, forested area, topsoil, soil2020-09-25v4No1 / 575
254amnon high in summer wet season compared to winter dry season autumn in river water fresh water depth (soil) 50cm jiulong river fujian province china 2017-11-23v4No1 / 581
84amnoncommon soil, peatland, peat soil, sphagnum bog, temperate grassland biome, depth 20cm, wetland area2017-03-06v4No1 / 590
357amnoncommon soil, topsoil, depth (soil) 0-10cm, montane forest, woodland area, forest ecosystem2018-08-19v4No1 / 592
415amnoncommon rhizosphere, soil, citrus, orchard, south africa, cultivated environment2018-11-27v4No1 / 600
788amnoncommon cherokia georgiana georgiana, millipede, feces, mesocosm, state of georgia, united states of america2021-05-31v4No1 / 607
662amnoncommon loamy sand soil, irrigated, neve yaar, depth (soil) 0-10cm, soil, agricultural field, israel2020-09-22v3No1 / 609
667amnoncommon depth (soil) 0-20cm, jiangxi province, lushan mountain, china, forested area, ph 4.5, elevation 200-300m, topsoil, soil2020-09-25v4No1 / 613
357amnoncommon soil, topsoil, depth (soil) 0-10cm, savanna, forest ecosystem, woodland area2018-08-19v4No1 / 614
698amnoncommon depth (soil) 0-30 cm, depth (soil) 0-20cm, ph 4-4.5, park, london, united kingdom, oak, quercus, rhizosphere2028-04-01v3No1 / 623
786sheryoHigher at 0-30cm depth compared to 30-60cm depth in flood plain soil near cosumnes river, california ( high in depth (soil) 0-30 cm depth (soil) 0-20cm compared to depth 30-60cm in flood plain soil united states of america state of california sacramento cosumnes river preserve )2021-09-13v3No1 / 627
667amnoncommon depth (soil) 0-20cm, coniferous forest biome, ph 4-4.5, elevation 1000-1100m, jiangxi province, lushan mountain, china, forested area, topsoil, soil2020-09-25v4No1 / 630
609sheryoCommon in soil with tobacco plants amended with difenoconazole fungicide and biochar (common biochar, tobacco plant present, difenoconazole, fungicide, ph 7-8, china, tobacco field, limestone, depth 0-20cm, soil)2020-04-21v4No1 / 634
360amnoncommon desert, soil, state of california2018-08-21v4No1 / 637
237amnoncommon in burrow soil of seabird (common bird, oceanodroma leucorhoa, seabird, canada, bon portage island, burrow, soil)2017-11-07v4No1 / 638
827sheryoCommon in soil at 230cm depth in clayey till loam soil, Lund Denmark (common depth 200-260cm, loam soil, late weichselian glaciation, clayey till, agricultural field, kingdom of denmark, lund)2021-08-24v3No1 / 644
360amnoncommon agave, desert, state of california, agave deserti, leaf, leaf surface2018-08-21v4No1 / 649
548amnoncommon minas gerais state, campos rupestres, brazil, barbacenia macrantha, rhizosphere2019-08-17v4No1 / 651
842sheryoHigher in soil depth of 0-15cm compared to soil depth of 15-30cm in an old growth forest in Ontario, Canada ( high in depth 0-15cm compared to depth 15-30cm in old growth forest luvisol grand river watershed rare charitable research reserve quercus velutina quercus alba quercus rubra acer saccharum acer saccharum subsp. nigrum fagus grandifolia cambridge forest forested area province of ontario canada soil )2021-11-14v3No1 / 653
175amnonhigher in summer compared to winter in heavy metal contaminated soils in china ( high in summer compared to winter in soil heavy metal china )2017-07-29v4No1 / 658
609sheryocommon in soil with tobacco plants amended with difenoconazole fungicide (common tobacco plant present, difenoconazole, fungicide, ph 7-8, china, tobacco field, limestone, depth 0-20cm, soil)2020-04-21v4No1 / 671
791sheryoHigher at 80cm depth compared to 0cm depth in low saline low sodicity soil in China ( high in depth (soil) 80cm compared to depth (soil) 0-20cm depth 0cm in ph 9 low salinity low sodicity soil salic solonetz da'an station china songnen plain )2021-06-08v4No1 / 675
842sheryoCommon in soil depth of 30-45cm in a zea mays agricultural field in Ontario, Canada (common depth 30-45cm, zea mays, preston flats, agricultural field, soil, luvisol, grand river watershed, canada, province of ontario, cambridge, rare charitable research reserve)2021-11-14v3No1 / 676
357amnoncommon in temperate deciduous forests around the world (common soil, topsoil, depth (soil) 0-10cm, temperate woodland biome, temperate deciduos forest, woodland area, forest ecosystem)2018-08-18v4No1 / 681
422amnoncommon soil, paddy field soil, oryza sativa, heilongjiang province, ph 6-7, cultivated environment, china2018-12-04v4No1 / 682
100amnoncommon soil, urban biome, park, new york city, central park2017-04-03v4No1 / 685
829sheryohigher soil depth of 0-12cm compared to 12-44cm in Alfisol soil, Dekalb, Illinois, united states of america ( high in depth 0-12cm compared to depth 12-44cm in sandy loam sandy loam soil hapludalf alfisol united states of america soil state of illinois illinois dekalb county )2021-08-26v3No1 / 685
506amnoncommon soil, boreal wetland, seasonal frozen marsh, depth (soil) 0-10cm, peat soil, northeast china, china, wetland area2019-03-16v4No1 / 690
134amnon high in taxus mairei southeast china subtropical compared to taxus media taxus cuspidata northeast china temperate in rhizosphere tree taxus china 2017-04-16v4No1 / 694
667amnoncommon depth (soil) 0-20cm, elevation 800-900m, ph 4.5, jiangxi province, lushan mountain, china, forested area, topsoil, soil2020-09-25v4No1 / 694
921amnon high in puerto rico compared to costa rica in cane toad bufo marinus skin epidermis skin 2022-07-24v4No1 / 704
415amnoncommon rhizosphere, soil, citrus, orchard, reunion island, cultivated environment2018-11-27v4No1 / 721
829sheryoCommon in soil depth of 12-44m in Alfisol soil, Dekalb, Illinois, united states of america (common depth 12-44cm, sandy loam, sandy loam soil, hapludalf, alfisol, united states of america, soil, state of illinois, illinois, dekalb county)2021-08-26v3No1 / 721
422amnoncommon soil, paddy field soil, oryza sativa, heilongjiang province, ph 5-6, cultivated environment, china2018-12-04v4No1 / 726
821sheryoComoon in soil of miscanthus field at 50-100cm depth, Michigan USA (common depth 50-100m, miscanthus, restored prairie, united states of america, state of michigan, kellogg biological station, mesic type hapludalf, kalamazoo loam, soil)2021-08-02v4No1 / 726
462amnoncommon depth (soil) 20-60cm, united states of america, state of tennessee, soil, depth 30-75cm, silt clay loam, cultivated environment2019-01-13v4No1 / 728
823sheryoCommon at 0-10cm depth in ultisol soil in auburn, alabama (common depth (soil) 0-10cm, auburn, alabama, upland soil, agricultural field, ultisol, soil)2021-08-07v3No1 / 730
823sheryoCommon at 10-25cm depth in ultisol soil in auburn, alabama (common depth (soil) 10-25cm, alabama, auburn, upland soil, ultisol, agricultural field, soil)2021-08-07v3No1 / 732
824sheryoHigher at 10-20cm depth compared to 0-10cm depth in soil after grazing exclusion, Ningxia china ( high in depth 10-20cm compared to depth (soil) 0-10cm in yunwushan national natural grassland protection zone ningxia province calci-orthic aridisol haplic calcisol grazing exclusion china soil )2021-08-08v4No1 / 734
829sheryoCommon in soil depth of 0-12m in Alfisol soil, Dekalb, Illinois, united states of america (common depth 0-12cm, sandy loam, sandy loam soil, hapludalf, alfisol, united states of america, soil, state of illinois, illinois, dekalb county)2021-08-26v3No1 / 737
989amnoncommon depth (soil) 0-20cm, cinnamomum camphora, anxi county, ph 4-5, farm, china, soil2022-12-26v3No1 / 738
421amnoncommon in paddy field soil incubated with copper (common soil, research facility, zhejiang province, paddy field soil, copper, china)2018-12-02v4No1 / 740
761sheryoCommon in maize rhizosphere sandy soil maize field in Germany (common zea mays, rhizosphere, ph 5, lower saxony, sandy soil, germany, maize field)2021-04-06v3No1 / 742
415amnoncommon rhizosphere, soil, citrus, australia, orchard, cultivated environment2018-11-27v4No1 / 743
821sheryoCommon in soil of restored prairie at 50-100cm depth, Michigan USA (common depth 50-100m, restored prairie, united states of america, state of michigan, kellogg biological station, mesic type hapludalf, kalamazoo loam, soil)2021-07-28v4No1 / 744
600sheryoDecreases after 12 days of stover ammendment in soil ( high in day 1 compared to day 12 in depth (soil) 0-5cm state of new york soil united states of america coarse-loamy soil ph 6 stover ammendment soil )2020-03-27v4No1 / 747
709sheryoCommon in potting mix soil from the Netherlands, substraat arabidopsis, Lentse Potgrond (common substraat arabidopsis, lentse potgrond, soil, potting mix, kingdom of the netherlands)2028-05-16v4No1 / 752
801sheryoCommon at depth 30-60cm in corn and soybean agriculture fields, Iowa USA (common ph 6.7, depth (soil) 30-60cm, subsurface drainage, glycine max, kelley, nicollet soil series, des moines, united states, agricultural field, iowa, zea mays, soil)2021-06-15v4No1 / 760
842sheryoCommoon in soil depth of 30-45cm in a Decomissioned Agricultural Field in Ontario, Canada (common depth 30-45cm, dipsacus fullonum, solidago, apocynum, daucus carota, brunisol, decomissioned agricultural field, meadow ecosystem, grand river watershed, rare charitable research reserve, cambridge, province of ontario, canada, soil)2021-11-14v3No1 / 768
821sheryoCommon in soil of continuous corn field at 50-100cm depth, Michigan USA (common depth 50-100m, united states of america, state of michigan, kellogg biological station, mesic type hapludalf, kalamazoo loam, continuous corn, corn, soil)2021-07-28v4No1 / 769
667amnoncommon depth (soil) 0-20cm, ph 4, elevation 1300-1400m, coniferous forest biome, jiangxi province, lushan mountain, china, forested area, topsoil, soil2020-09-25v4No1 / 777
615amnoncommon in control soil with no sugarcane (common campinas, brazil, greenhouse, soil)2020-04-27v4No1 / 780
821sheryoHigher at 25-50cm depth compared to 50-100cm depth in soil in Michigan USA ( high in depth (soil) 25-50cm compared to depth 50-100m in restored prairie corn miscanthus panicum virgatum kellogg biological station mesic type hapludalf kalamazoo loam state of michigan soil united states of america )2021-08-05v4No1 / 784
829sheryoCommon in soil depth of 0-27cm in Mollisol soil, Dekalb, Illinois, united states of america (common depth 0-27cm, dekalb county, illinois, state of illinois, mollisol, silt loam, soil, united states of america)2021-08-26v3No1 / 798
478amnoncommon farm, shrimp farm, water, saline water, china2019-02-19v4No1 / 799
548amnoncommon in endopytic roots of Vellozia epidendroides (common minas gerais state, campos rupestres, brazil, vellozia epidendroides, plant, root)2019-08-15v4No1 / 800
718amnon high in hypolimnion compared to epilimnion in "south sparkling bog" lake ph 4.5-5 dimictic lake freshwater lake bog lake united states of america state of wisconsin 2028-05-23v4No1 / 812
480amnoncommon soil, pasture, farm, ireland2019-02-05v4No1 / 816
422amnoncommon soil, paddy field soil, oryza sativa, yunnan province, china, cultivated environment2018-12-02v4No1 / 821
412amnoncommon soil, hunan province, red soil, cambisol, zea mays, triticum aestivum, ph<5, china2018-11-26v4No1 / 823
421amnoncommon in paddy field soil incubated without copper (common research facility, soil, paddy field soil, zhejiang province, china)2018-12-02v4No1 / 824
415amnoncommon rhizosphere, soil, citrus, orchard, china, cultivated environment2018-11-27v4No1 / 830
583amnoncommon soil, mountain, switzerland, depth (soil) 0-10cm, elevation 2000-3000m, canton of graubunden, calcareous parent material, ph 7-82020-01-28v3No1 / 830
444amnoncommon rhizosphere, fragaria x ananassa, strawberry, greenhouse soil, farm, yellow brown soil, nanjing city prefecture, continuous cropping, age 5 years, age 10 years, china, cultivated environment2019-01-07v4No1 / 833
356amnoncommon in deciduous broad leaved forest top soil in japan (common soil, depth (soil) 0-10cm, hokkaido, topsoil, ph 5.4, japan, forest ecosystem)2018-08-15v4No1 / 834
842sheryoCommon in soil depth of 0-15cm in an old growth forest in Ontario, Canada (common depth 0-15cm, old growth forest, luvisol, grand river watershed, rare charitable research reserve, quercus velutina, quercus alba, quercus rubra, acer saccharum, acer saccharum subsp. nigrum, fagus grandifolia, cambridge, forest, forested area, province of ontario, canada, soil)2021-11-14v3No1 / 834
996amnon high in fall summer compared to winter in river water china fuzhou city prefecture xiyuan river fresh water surface water river downstream anthropogenic environmental material city 2022-12-28v3No1 / 834
761sheryoCommon in bulk sandy soil maize field in Germany (common ph 5, lower saxony, sandy soil, germany, maize field, bulk soil)2021-04-06v3No1 / 835
801sheryoCommon in soybean and corn agriculture fields at depth 30-60cm, Iowa USA (common depth (soil) 30-60cm, ph 7.4, united states, nicollet soil series, glycine max, zea mays, ames, des moines, iowa, agricultural field, soil)2021-06-15v4No1 / 839
265amnoncommon canada, province of quebec, soilwater, water2017-12-11v4No1 / 841
801sheryoCommon at depth 15-30cm in corn and soybean agriculture fields, Iowa USA (common ph 6, depth (soil) 15-30cm, subsurface drainage, glycine max, kelley, nicollet soil series, des moines, united states, agricultural field, iowa, zea mays, soil)2021-06-15v4No1 / 841
718amnon high in hypolimnion compared to epilimnion in "trout bog" lake ph 4.5-5 dimictic lake freshwater lake bog lake united states of america state of wisconsin 2028-05-23v4No1 / 843
828sheryoCommon in gleysol soil of poplar plantation at 30-40cm depth, sihong, china (common depth 30-4cm, ph 6-7, clay loam, gleysol, china, jiangsu province, sihong county, chenwei forest, soil, poplar plantation, poplar)2021-08-25v4No1 / 844
698amnoncommon depth (soil) 0-30 cm, depth (soil) 0-20cm, ph 5-6, disease, plant disease, acute oak decline, park, united kingdom, oak, quercus, rhizosphere2028-04-01v3No1 / 848
412amnoncommon soil, hunan province, red soil, cambisol, zea mays, triticum aestivum, ph>5, china2018-11-26v4No1 / 856
801sheryoCommon at depth 0-15cm in corn agriculture fields, Iowa USA (common kanawha, ph 7.1, nicollet soil series, depth (soil) 0-15cm, des moines, united states, agricultural field, iowa, zea mays, soil)2021-06-15v4No1 / 862
827sheryoCommon in soil at 325cm depth in clayey till loam soil, Lund Denmark (common lund, kingdom of denmark, agricultural field, clayey till, late weichselian glaciation, loam soil, depth 300-350cm)2021-08-24v3No1 / 866
821sheryoCommon in soil of switchgrass field at 50-100cm depth, Michigan USA (common depth 50-100m, panicum virgatum, kellogg biological station, mesic type hapludalf, kalamazoo loam, state of michigan, soil, united states of america)2021-08-03v4No1 / 872
855sheryoCommon in soil depth of 75cm in fertilized soil in china (common depth 75cm, luancheng county, china, agricultural field, fertilized soil, soil)2021-12-27v3No1 / 873
786sheryoCommon in flood plain soil near cosumnes river, california, at 60-100cm depth (common depth (soil) 60-100cm, cosumnes river preserve, sacramento, state of california, united states of america, soil, flood plain)2021-05-18v3No1 / 878
854sheryoCommon in soil depth of 75-100cm of colluvial soil, Czech rebuplic (common depth 75-100cm, calcic chernozem, colluvial soil, ph 8, south moravian region, czech republic, soil)2021-12-23v3No1 / 879
129amnoncommon ph 6-6.5, mexico, myrtillocactus geometrizans, opuntia robusta, cactus, semi-arid, soil2017-04-15v4No1 / 884
462amnon high in leaf compared to stem in united states of america state of tennessee populus tree cultivated environment 2019-01-13v4No1 / 890
146amnoncommon united states of america, solanum lycopersicum, tomato, slit loam soil, ph 6, rhizosphere2017-04-20v4No1 / 894
996amnon high in upstream compared to city anthropogenic environmental material downstream in river surface water fresh water xiyuan river fuzhou city prefecture china river water 2022-12-28v3No1 / 894
791sheryoHigher in low sodicity and low salinity soil compared to high sodicity and high salinity soil at 80cm depth in China ( high in ph 9 low sodicity low salinity compared to ph 10 high sodicity high salinity in depth (soil) 80cm soil salic solonetz da'an station china songnen plain )2021-06-08v4No1 / 895
788amnoncommon soil, mesocosm, state of georgia, united states of america2021-05-31v4No1 / 897
786sheryoCommon in flood plain soil near cosumnes river, california, at 133-166cm depth (common depth (soil) 133-166cm, cosumnes river preserve, sacramento, state of california, united states of america, soil, flood plain)2021-05-18v3No1 / 898
479amnoncommon rhizosphere, united states of america, state of california, ph 6-7, ceanothus jepsonii2019-02-05v4No1 / 900
821sheryoCommon in soil of miscanthus field at 25-50cm depth, Michigan USA (common depth (soil) 25-50cm, miscanthus, restored prairie, united states of america, state of michigan, kellogg biological station, mesic type hapludalf, kalamazoo loam, soil)2021-08-02v4No1 / 901
801sheryoCommon in soybean and corn agriculture fields at depth 15-30cm, Iowa USA (common ph 7.4, depth (soil) 15-30cm, united states, nicollet soil series, glycine max, zea mays, ames, des moines, iowa, agricultural field, soil)2021-06-15v4No1 / 905
807amnoncommon tropical storm, summer, okinawa islands, japan, filtered 0.2um, near shore, sea water, surface water2021-06-20v3No1 / 905
842sheryoCommon in soil depth of 15-30cm in a Decomissioned Agricultural Field in Ontario, Canada (common depth 15-30cm, dipsacus fullonum, solidago, apocynum, daucus carota, brunisol, decomissioned agricultural field, meadow ecosystem, grand river watershed, rare charitable research reserve, cambridge, province of ontario, canada, soil)2021-11-14v3No1 / 905
854sheryoCommon in soil depth of 25-50cm of colluvial soil, Czech rebuplic (common ph 8, calcic chernozem, czech republic, south moravian region, colluvial soil, depth 25-50cm, soil)2021-12-23v3No1 / 905
462amnoncommon depth (soil) 20-60cm, united states of america, state of tennessee, depth 30-75cm, silt clay loam, rhizosphere, populus, tree, cultivated environment2019-01-13v4No1 / 908
609sheryoCommon in soil without tobacco plants amended with difenoconazole fungicide and biochar (common biochar, without plants, difenoconazole, fungicide, ph 7-8, china, tobacco field, limestone, depth 0-20cm, soil)2020-07-05v4No1 / 910
357amnon high in ph<4.5 compared to ph>4.5 in soil topsoil depth (soil) 0-10cm moist tropical forest woodland area forest ecosystem 2018-08-18v4No1 / 915
609sheryoCommon in soil without tobacco plants amended with difenoconazole fungicide (common without plants, difenoconazole, fungicide, ph 7-8, china, tobacco field, limestone, depth 0-20cm, soil)2020-07-05v4No1 / 915
548amnoncommon minas gerais state, campos rupestres, brazil, rock2019-08-17v4No1 / 924
842sheryoHigher in soil depth of 0-15cm compared to soil depth 15-30cm in a zea mays agricultural field in Ontario, Canada ( high in depth 0-15cm compared to depth 15-30cm in zea mays preston flats agricultural field soil luvisol grand river watershed canada province of ontario cambridge rare charitable research reserve )2021-11-14v3No1 / 924
126amnoncommon rhizosphere, germany, hordeum vulgare, winter barley2017-04-14v4No1 / 925
359amnoncommon soil, topsoil, depth (soil) 0-10cm, guangdong province, subtropical broadleaf forest biome, china, forest ecosystem, woodland area2018-08-19v4No1 / 935
786sheryoCommon in flood plain soil near cosumnes river, california, at 166-200cm depth (common depth (soil) 166-200cm, flood plain, soil, united states of america, state of california, sacramento, cosumnes river preserve)2021-05-18v3No1 / 936
462amnoncommon depth (soil) 0-30 cm, depth (soil) 0-20cm, united states of america, state of tennessee, soil, silt loam, cultivated environment2019-01-13v4No1 / 938
842sheryoCommon in soil depth of 15-30cm in a zea mays agricultural field in Ontario, Canada (common depth 15-30cm, zea mays, preston flats, agricultural field, soil, luvisol, grand river watershed, canada, province of ontario, cambridge, rare charitable research reserve)2021-11-14v3No1 / 944
444amnoncommon in uncultivated soil plot (common yellow brown soil, nanjing city prefecture, soil, china)2019-01-07v4No1 / 946
98amnoncommon citrus, rhizosphere, quincy, fl, root, state of florida2017-04-01v4No1 / 950
422amnoncommon soil, paddy field soil, jiangsu province, oryza sativa, china, cultivated environment2018-12-02v4No1 / 957
854sheryoCommon in soil depth of 125-175cm of colluvial soil, Czech rebuplic (common depth 125-175cm, calcic chernozem, colluvial soil, ph 8, south moravian region, czech republic, soil)2021-12-23v3No1 / 962
821sheryoCommon in soil of continuous corn field at 25-50cm depth, Michigan USA (common depth (soil) 25-50cm, united states of america, state of michigan, kellogg biological station, mesic type hapludalf, kalamazoo loam, continuous corn, corn, soil)2021-07-28v4No1 / 963
917amnon high in qiao nature reserve compared to futian national nature reserve in mangrove biome mangrove depth (soil) 0-20cm china marsh soil saline marsh 2022-07-08v3No1 / 967
129amnoncommon ph 6-6.5, mexico, myrtillocactus geometrizans, opuntia robusta, cactus, semi-arid, soil, root zone soil2017-04-15v4No1 / 968
821sheryoCommon in soil of restored prairie at 25-50cm depth, Michigan USA (common depth (soil) 25-50cm, restored prairie, united states of america, state of michigan, kellogg biological station, mesic type hapludalf, kalamazoo loam, soil)2021-07-28v4No1 / 968
480amnoncommon soil, pasture, farm, new zealand2019-02-05v4No1 / 970
842sheryoCommon in soil depth of 30-45cm in a Decomissioned Agricultural Field in Ontario, Canada (common depth 30-45cm, luvisol, dipsacus fullonum, solidago, apocynum, daucus carota, decomissioned agricultural field, meadow ecosystem, grand river watershed, rare charitable research reserve, cambridge, province of ontario, canada, soil)2021-11-14v3No1 / 970
134amnoncommon rhizosphere, tree, taxus, northeast china, temperate, taxus mairei, china2017-04-16v4No1 / 973
474amnoncommon soil, farm, glycine max, soybean, ph 4-6, brazil, cultivated environment2019-01-16v4No1 / 974
615amnoncommon saccharum, sugarcane, rhizosphere, campinas, brazil, greenhouse2020-04-27v4No1 / 974
821sheryoCommon in soil of switchgrass field at 25-50cm depth, Michigan USA (common depth (soil) 25-50cm, kellogg biological station, mesic type hapludalf, kalamazoo loam, panicum virgatum, state of michigan, soil, united states of america)2021-08-03v4No1 / 974
821sheryoCommon in soil of switchgrass field at 25-50cm depth, Michigan USA (common panicum virgatum, depth (soil) 25-50cm, kellogg biological station, mesic type hapludalf, kalamazoo loam, state of michigan, soil, united states of america)2021-08-03v4No1 / 974
842sheryoCommon in soil depth of 15-30cm in a Decomissioned Agricultural Field in Ontario, Canada (common depth 15-30cm, luvisol, dipsacus fullonum, solidago, apocynum, daucus carota, decomissioned agricultural field, meadow ecosystem, grand river watershed, rare charitable research reserve, cambridge, province of ontario, canada, soil)2021-11-14v3No1 / 974
266amnoncommon in soil from MIL garden (common soil, united states of america, state of idaho, ph 6.5)2017-12-18v4No1 / 980
828sheryoCommon in gleysol soil of poplar plantation at 20-30cm depth, sihong, china (common depth (soil) 20-30cm, ph 6-7, clay loam, gleysol, china, jiangsu province, sihong county, chenwei forest, soil, poplar plantation, poplar)2021-08-25v4No1 / 989
462amnoncommon depth (soil) 0-30 cm, depth (soil) 0-20cm, united states of america, state of tennessee, rhizosphere, populus, tree, silt loam, cultivated environment2019-01-13v4No1 / 997
809amnoncommon dendrobium moniliforme, lu'an city prefecture, flowerpot, research facility, greenhouse, rhizosphere, china2021-06-20v4No1 / 1002
933amnoncommon guangxi zhuang autonomous region, ph 5.5, quaternary laterite soil, research facility, china, cucurbita moschata, pumpkin, rhizosphere2022-09-11v3No1 / 1002
479amnoncommon rhizosphere, united states of america, state of california, heteromeles arbutifolia, ph 6-72019-02-05v4No1 / 1006
786sheryoCommon in flood plain soil near cosumnes river, california, at 100-133cm depth (common depth (soil) 100-133cm, cosumnes river preserve, sacramento, state of california, united states of america, soil, flood plain)2021-05-18v3No1 / 1015
628sheryocommon in bulk soil with barley plants after 180 days in treatments amended with biochar (common biochar, bulk soil, china, zhejiang province, quzhou county, soil, depth (soil) 15cm, ph 4-5, hordeum vulgare, days 180, mature barley plants)2020-05-18v4No1 / 1023
824sheryoHigher at 20-40cm depth compared to 40-60cm depth in soil after grazing exclusion, Ningxia china ( high in depth 20-40cm compared to depth 40-60cm in yunwushan national natural grassland protection zone ningxia province calci-orthic aridisol haplic calcisol grazing exclusion china soil )2021-08-08v4No1 / 1025
266amnoncommon in soil from PAR garden (common soil, united states of america, state of idaho, ph 5.5)2017-12-18v4No1 / 1032
768sheryoCommon in maize fields in Brittany, France (common zea mays, maize field, cambisol, bretagne region, french republic, soil)2021-04-18v3No1 / 1034
801sheryoHigher at depth 0-15cm compared to depth 60-90cm in corn and soybean agriculture fields, Iowa USA ( high in depth (soil) 0-15cm compared to depth (soil) 60-90cm in subsurface drainage glycine max kelley nicollet soil series des moines united states agricultural field iowa zea mays soil )2021-06-16v4No1 / 1036
824sheryoHigher at 10-20cm depth compared to 20-40cm depth in soil after grazing exclusion, Ningxia china ( high in depth 10-20cm compared to depth 20-40cm in yunwushan national natural grassland protection zone ningxia province calci-orthic aridisol haplic calcisol grazing exclusion china soil )2021-08-08v4No1 / 1038
548amnoncommon minas gerais state, campos rupestres, brazil, rhizosphere, vellozia epidendroides2019-08-15v4No1 / 1040
786sheryocommon in flood plain soil near cosumnes river, california, at 0-30cm depth (common depth (soil) 0-30 cm, depth (soil) 0-20cm, flood plain, soil, united states of america, state of california, sacramento, cosumnes river preserve)2021-05-18v3No1 / 1048
422amnoncommon soil, paddy field soil, oryza sativa, heilongjiang province, china, cultivated environment2018-12-02v4No1 / 1049
837sheryoCommon in soil after 10 years reforestation with Black locust trees at 100-300cm depth, shaanxi, China (common depth 100-300cm, robinia pseudoacacia, 10 years, reforestation, silt loam, china, loess plateau, shaanxi province, soil)2021-09-26v4No1 / 1061
837sheryoCommon in soil after 10 years reforestation with Black locust trees at 40-100cm depth, shaanxi, China (common depth 40-100cm, robinia pseudoacacia, 10 years, reforestation, silt loam, china, loess plateau, shaanxi province, soil)2021-09-26v4No1 / 1065
828sheryoCommon in gleysol soil of poplar plantation at 0-10cm depth, sihong, china (common depth (soil) 0-10cm, ph 6-7, clay loam, gleysol, china, jiangsu province, sihong county, chenwei forest, soil, poplar plantation, poplar)2021-08-25v4No1 / 1069
252amnoncommon in river rock biofilm (common biofilm, kingdom of spain, biofilm, river, rock, epilithic)2017-11-22v4No1 / 1081
842sheryoCommon in soil depth of 0-15cm in a Decomissioned Agricultural Field in Ontario, Canada (common depth 0-15cm, dipsacus fullonum, solidago, apocynum, daucus carota, brunisol, decomissioned agricultural field, meadow ecosystem, grand river watershed, rare charitable research reserve, cambridge, province of ontario, canada, soil)2021-11-14v3No1 / 1082
791sheryoCommon at 40cm depth in low saline low sodicity soil in China (common depth (soil) 40cm, ph 9, low salinity, low sodicity, soil, salic solonetz, da'an station, china, songnen plain)2021-06-08v4No1 / 1085
765sheryocommon in wheat field in the loess plateau in china (common triticum aestivum, ph 7.7, loess plateau, silt loam, chromic cambisol, shanxi province, china, soil)2021-04-12v3No1 / 1087
265amnoncommon canada, province of quebec, soil2017-12-11v4No1 / 1090
415amnoncommon rhizosphere, soil, citrus, orchard, brazil, cultivated environment2018-11-27v4No1 / 1091
415amnoncommon rhizosphere, soil, citrus, orchard, kingdom of spain, cultivated environment2018-11-27v4No1 / 1099
801sheryoHigher at depth 0-15cm compared to depth 60-90cm in soybean and corn agriculture fields , Iowa USA ( high in depth (soil) 0-15cm compared to depth (soil) 60-90cm in united states nicollet soil series glycine max zea mays ames des moines iowa agricultural field soil )2021-06-15v4No1 / 1102
84amnoncommon soil, peatland, peat soil, sphagnum bog, temperate grassland biome, depth 5cm, wetland area2017-03-06v4No1 / 1103
357amnon high in ph<5 compared to ph>5 in soil topsoil depth (soil) 0-10cm temperate woodland biome temperate deciduos forest woodland area forest ecosystem 2018-08-18v4No1 / 1104
101amnoncommon state of new york, merlot, vitis vinifera, grapevine, united states of america, root2017-04-03v4No1 / 1106
917amnoncommon qiao nature reserve, depth (soil) 0-20cm, sonneratia apetala, china, marsh, mangrove, ph 7-8, soil2022-07-08v3No1 / 1107
827sheryoCommon in soil at 25cm depth in clayey till loam soil, Lund Denmark (common depth (soil) 20-30cm, plough layer , loam soil, late weichselian glaciation, clayey till, agricultural field, kingdom of denmark, lund)2021-08-24v3No1 / 1111
824sheryocommon in soil after 0-9 years of grazing exclusion at 40-60cm depth, Ningxia china (common 0-9 years of grazing exclusion, yunwushan national natural grassland protection zone, ningxia province, calci-orthic aridisol, haplic calcisol, grazing exclusion, depth 40-60cm, china, soil)2021-08-08v4No1 / 1113
698amnoncommon depth (soil) 0-30 cm, depth (soil) 0-20cm, control, ph 6-7, park, united kingdom, oak, quercus, rhizosphere2028-04-01v3No1 / 1115
828sheryoCommon in gleysol soil of poplar plantation at 10-20cm depth, sihong, china (common depth 10-20cm, ph 6-7, clay loam, gleysol, china, jiangsu province, sihong county, chenwei forest, soil, poplar plantation, poplar)2021-08-25v4No1 / 1123
791sheryoCommon at 80cm depth in low saline low sodicity soil in China (common depth (soil) 80cm, ph 9, low salinity, low sodicity, soil, salic solonetz, da'an station, china, songnen plain)2021-06-08v4No1 / 1128
764sheryocommon in leoss soil in wheat field grown under crop rotation with rapeseed pre-crop in germany (common bernburg, germany, soil, triticum aestivum, crop rotation, ph 7.6, brassica napus, rapeseed pre-crop)2021-04-12v3No1 / 1129
146amnon high in soil compared to rhizosphere in united states of america solanum lycopersicum tomato slit loam ph 6 2017-04-20v4No1 / 1135
628sheryocommon in bulk soil with barley plants after 180 days in treatments unamended with biochar (common bulk soil, china, zhejiang province, quzhou county, soil, depth (soil) 15cm, ph 4-5, hordeum vulgare, days 180, mature barley plants)2020-05-18v4No1 / 1136
764sheryoCommon in leoss soil in wheat field grown under conservation tillage and crop rotation in germany (common ph 7.6, crop rotation, cultivator tillage, conservation tillage, triticum aestivum, soil, germany, bernburg)2021-04-12v3No1 / 1140
134amnoncommon rhizosphere, tree, taxus, northeast china, temperate, taxus cuspidata, china2017-04-16v4No1 / 1141
146amnoncommon united states of america, solanum lycopersicum, tomato, soil, slit loam soil, ph 62017-04-20v4No1 / 1144
842sheryoCommon in soil depth of 0-15cm in a zea mays agricultural field in Ontario, Canada (common depth 0-15cm, zea mays, preston flats, agricultural field, soil, luvisol, grand river watershed, canada, province of ontario, cambridge, rare charitable research reserve)2021-11-14v3No1 / 1147
791sheryoCommon at 20cm depth in low saline low sodicity soil in China (common ph 9, depth 20cm, ph 8.5, low salinity, low sodicity, soil, salic solonetz, da'an station, china, songnen plain)2021-06-08v4No1 / 1155
507amnon high in sediment depth 0-5cm compared to sediment depth 8-10cm in lake sediment sediment canada quesnel lake province of british columbia 2019-03-17v4No1 / 1157
422amnoncommon soil, paddy field soil, oryza sativa, heilongjiang province, ph 7-8, cultivated environment, china2018-12-04v4No1 / 1169
786sheryoCommon in flood plain soil near cosumnes river, california, at 30-60cm depth (common depth (soil) 30-60cm, cosumnes river preserve, sacramento, state of california, united states of america, soil, flood plain)2021-05-18v3No1 / 1180
252amnoncommon in river sand biofilm (common biofilm, river, biofilm, kingdom of spain, sand)2017-11-22v4No1 / 1181
807amnon high in tropical storm compared to normal weather in summer okinawa islands japan filtered 0.2um near shore sea water surface water 2021-06-20v3No1 / 1191
628sheryocommon in rhizosphere of barley roots after 180 days in treatments amended with biochar (common mature barley plants, days 180, rhizosphere, hordeum vulgare, biochar, ph 4-5, depth (soil) 15cm, china, quzhou county, zhejiang province, soil)2020-05-18v4No1 / 1192
421amnoncommon soil, paddy field soil, zhejiang province, china2018-12-04v4No1 / 1194
823sheryoCommon at 0-15cm depth in foot slope ultisol soil in auburn, alabama (common foot slope , depth (soil) 0-15cm, alabama, auburn, ultisol, agricultural field, soil)2021-08-08v3No1 / 1199
801sheryoCommon at depth 0-15cm in corn and soybean agriculture fields, Iowa USA (common subsurface drainage, ph 6.2, depth (soil) 0-15cm, glycine max, kelley, nicollet soil series, des moines, united states, agricultural field, iowa, zea mays, soil)2021-06-15v4No1 / 1202
628sheryocommon in rhizosphere of barley roots after 180 days in treatments unamended with biochar (common china, zhejiang province, quzhou county, soil, depth (soil) 15cm, ph 4-5, hordeum vulgare, rhizosphere, days 180, mature barley plants)2020-05-18v4No1 / 1209
917amnoncommon qiao nature reserve, depth (soil) 0-20cm, china, mudflat, marsh, ph 7-8, soil, saline marsh2022-07-08v3No1 / 1211
764sheryoCommon in leoss soil in wheat field grown under conventional tillage and crop rotation in germany (common crop rotation, triticum aestivum, ph 7.6, mouldboard plough, conventional tillage, loess chernozem, bernburg, germany, soil)2021-04-12v3No1 / 1213
837sheryoCommon in agricultural field at depths 100-300cm, shaanxi, China (common depth 100-300cm, agricultural field, zea mays, triticum aestivum, silt loam, china, loess plateau, shaanxi province, soil)2021-09-26v4No1 / 1220
444amnonlower in continuously cropped strawberry soil ( high in age 1 year compared to age 5 years age 10 years continuous cropping in rhizosphere fragaria x ananassa strawberry greenhouse soil farm yellow brown soil nanjing city prefecture china cultivated environment )2019-01-07v4No1 / 1221
531amnoncommon rhizosphere, greenhouse soil, farm, orthic anthrosol, cucumis sativus, cucumber, china2019-07-21v3No1 / 1223
764sheryoCommon in leoss soil in wheat field grown under crop rotation with maize pre-crop in germany (common maize pre-crop, ph 7.6, crop rotation, triticum aestivum, soil, germany, bernburg)2021-04-12v3No1 / 1225
801sheryoCommon in soybean and corn agriculture fields at depth 0-15cm, Iowa USA (common united states, ph 7.5, nicollet soil series, depth (soil) 0-15cm, glycine max, zea mays, ames, des moines, iowa, agricultural field, soil)2021-06-15v4No1 / 1226
423amnon high in no human contact chernobyl exclusion zone compared to human contact in bank vole myodes glareolus ukraine skin 2018-12-05v4No1 / 1229
798amnoncommon depth (soil) 10 cm, depth (soil) 0-20cm, ph 7-8, soil, orchard, apricot, prunus armeniaca, apennine mountains, italy2021-06-13v3No1 / 1230
824sheryoCommon in soil after 27-35 years of grazing exclusion at 40-60cm depth, Ningxia china (common 27-35 years of grazing exclusion, depth 40-60cm, yunwushan national natural grassland protection zone, ningxia province, calci-orthic aridisol, haplic calcisol, grazing exclusion, china, soil)2021-08-08v4No1 / 1232
821sheryoCommon in soil of restored prairie at 10-25cm depth, Michigan USA (common depth (soil) 10-25cm, restored prairie, united states of america, state of michigan, kellogg biological station, mesic type hapludalf, kalamazoo loam, soil)2021-07-28v4No1 / 1241
901amnoncommon taihu lake, depth (sediment) 0-20cm, depth (water) 20-100cm, taihu national park, china, lake sediment2022-04-25v4No1 / 1246
800amnoncommon 7-18 days following heavy metal contamination (common spring, reservoir, sediment depth 0-10cm, heavy metal, china, xiannv lake, lake, fresh water, sediment)2021-06-15v4No1 / 1248
134amnoncommon rhizosphere, tree, taxus, taxus media, northeast china, temperate, china2017-04-16v4No1 / 1251
855sheryoCommon in soil depth of 10cm in fertilized soil in china (common luancheng county, china, depth (water) 10cm, fertilized soil, agricultural field, soil)2021-12-27v3No1 / 1253
837sheryoCommon in agricultural field at depths 40-100cm, shaanxi, China (common depth 40-100cm, agricultural field, zea mays, triticum aestivum, silt loam, china, loess plateau, shaanxi province, soil)2021-09-26v4No1 / 1263
824sheryoCommoon in soil after 0-9 years of grazing exclusion at 20-40cm depth, Ningxia china (common depth 20-40cm, 0-9 years of grazing exclusion, yunwushan national natural grassland protection zone, ningxia province, calci-orthic aridisol, haplic calcisol, grazing exclusion, china, soil)2021-08-08v4No1 / 1274
616amnoncommon in topsoil of non-fertilized sugarcane field (common depth (soil) 0-20cm, ph 6.7, sugarcane, saccharum, soil, topsoil, china, guangzhou city prefecture, non-fertilized soil)2020-04-27v3No1 / 1277
415amnoncommon rhizosphere, soil, citrus, orchard, italy, cultivated environment2018-11-27v4No1 / 1279
788amnon high in soil compared to plant litter in mesocosm state of georgia united states of america 2021-05-31v4No1 / 1280
842sheryoCommon in soil depth of 0-15cm in a Decomissioned Agricultural Field in Ontario, Canada (common depth 0-15cm, luvisol, dipsacus fullonum, solidago, apocynum, daucus carota, decomissioned agricultural field, meadow ecosystem, grand river watershed, rare charitable research reserve, cambridge, province of ontario, canada, soil)2021-11-14v3No1 / 1281
414amnoncommon soil, heilongjiang province, agricultural feature, triticum aestivum, glycine max, zea mays, black soil, mollisol, ph>6, china2018-11-26v4No1 / 1282
798amnon high in ph 7-8 soil compared to hay plant litter litter bag in depth (soil) 10 cm depth (soil) 0-20cm orchard apricot prunus armeniaca apennine mountains italy 2021-06-13v3No1 / 1285
821sheryoCommon in soil of restored prairie at 0-10cm depth, Michigan USA (common ph 6.5, depth (soil) 0-10cm, restored prairie, united states of america, state of michigan, kellogg biological station, mesic type hapludalf, kalamazoo loam, soil)2021-07-28v4No1 / 1291
837sheryoCommon in soil at 0-40-100cm depth after 20 years reforestation with Black locust trees, shaanxi, China (common depth 40-100cm, 20 years, robinia pseudoacacia, reforestation, silt loam, china, loess plateau, shaanxi province, soil)2021-09-26v4No1 / 1294
837sheryoCommon in soil at 40-100cm depth after 30 years reforestation with Black locust trees, shaanxi, China (common depth 40-100cm, 30 years, robinia pseudoacacia, reforestation, silt loam, china, loess plateau, shaanxi province, soil)2021-09-26v4No1 / 1311
101amnon high in rhizosphere compared to root in state of new york vitis vinifera united states of america merlot grapevine 2017-04-03v4No1 / 1315
837sheryoCommon in soil after 10 years reforestation with Black locust trees at 0-40cm depth, shaanxi, China (common depth 0-40cm, robinia pseudoacacia, 10 years, reforestation, silt loam, china, loess plateau, shaanxi province, soil)2021-09-26v4No1 / 1317
837sheryoCommon in soil at 100-300cm depth after 20 years reforestation with Black locust trees, shaanxi, China (common depth 100-300cm, 20 years, robinia pseudoacacia, reforestation, silt loam, china, loess plateau, shaanxi province, soil)2021-09-26v4No1 / 1317
837sheryoCommon in soil at 0-40cm depth after 20 years reforestation with Black locust trees, shaanxi, China (common 20 years, depth 0-40cm, robinia pseudoacacia, loess plateau, shaanxi province, china, reforestation, silt loam, soil)2021-09-26v4No1 / 1323
600sheryoCommon in biochar ammended soil after 82 days (common depth (soil) 0-5cm, state of new york, soil, biochar, united states of america, coarse-loamy soil, ph 6, day 82)2020-03-27v4No1 / 1326
600sheryoCommon in stover ammended soil after 82 days (common depth (soil) 0-5cm, state of new york, soil, united states of america, coarse-loamy soil, ph 6, day 82, stover ammendment )2020-03-27v4No1 / 1327
259amnoncommon in soil and rhizpsphere of peanut plants (common soil, rhizosphere, ph 5, arachis hypogaea, peanut, china)2017-12-02v4No1 / 1334
98amnoncommon citrus, rhizosphere, ft. pierce, fl, root, state of florida2017-04-01v4No1 / 1340
837sheryoCommon in soil at 0-40 cm depth after 30 years reforestation with Black locust trees, shaanxi, China (common 30 years, depth 0-40cm, robinia pseudoacacia, reforestation, silt loam, china, loess plateau, shaanxi province, soil)2021-09-26v4No1 / 1346
837sheryoCommon in soil at 100-300cm depth after 30 years reforestation with Black locust trees, shaanxi, China (common depth 100-300cm, 30 years, robinia pseudoacacia, reforestation, silt loam, china, loess plateau, shaanxi province, soil)2021-09-26v4No1 / 1354
809amnoncommon dendrobium huoshanense, lu'an city prefecture, flowerpot, research facility, greenhouse, rhizosphere, china2021-06-20v4No1 / 1356
917amnoncommon ph 6-6.5, kandelia candel, depth (soil) 0-20cm, marsh, china, qiao nature reserve, mangrove, soil2022-07-08v3No1 / 1364
824sheryoCommon in soil after 27-35 years of grazing exclusion at 20-40cm depth, Ningxia china (common depth 20-40cm, 27-35 years of grazing exclusion, yunwushan national natural grassland protection zone, ningxia province, calci-orthic aridisol, haplic calcisol, grazing exclusion, china, soil)2021-08-08v4No1 / 1369
98amnoncommon citrus, rhizosphere, gainesville, fl, root, state of florida2017-04-01v4No1 / 1371
420amnoncommon in soil of vegetable open field (common soil, ph>7, ph 7-8, agricultural feature, farm, shanghai proper, clay loam, npk fertilizer, cultivated environment, china)2018-12-02v4No1 / 1376
821sheryoCommon in soil of miscanthus field at 10-25cm depth, Michigan USA (common depth (soil) 10-25cm, miscanthus, restored prairie, united states of america, state of michigan, kellogg biological station, mesic type hapludalf, kalamazoo loam, soil)2021-08-02v4No1 / 1377
901amnoncommon in macrophyte plant rhizosphere (common rhizosphere, depth (sediment) 0-20cm, taihu lake, taihu national park, china, depth (water) 20-100cm, lake sediment)2022-04-25v4No1 / 1378
821sheryoCommon in soil of continuous corn field at 0-10cm depth, Michigan USA (common united states of america, state of michigan, kellogg biological station, ph 5.9, mesic type hapludalf, kalamazoo loam, depth (soil) 0-10cm, continuous corn, corn, soil)2021-07-28v4No1 / 1380
883amnon high in non-contaminated soil compared to oil contaminated soil oilfield in yellow river delta china shengli oilfield soil 2022-03-20v4No1 / 1381
821sheryoCommon in soil of switchgrass field at 10-25cm depth, Michigan USA (common depth (soil) 10-25cm, kellogg biological station, mesic type hapludalf, kalamazoo loam, panicum virgatum, state of michigan, soil, united states of america)2021-08-02v4No1 / 1387
1008amnoncommon ph 7-8, jinxiang county, garlic, allium sativum, fertilized soil, farm, china, rhizosphere2023-01-26v4No1 / 1393
600sheryoCommon in unammended soil after 82 days (common depth (soil) 0-5cm, state of new york, soil, united states of america, coarse-loamy soil, ph 6, day 82)2020-03-27v4No1 / 1395
824sheryoCommon in soil after 0-9 years of grazing exclusion at 10-20cm depth, Ningxia china (common depth 10-20cm, 0-9 years of grazing exclusion, yunwushan national natural grassland protection zone, ningxia province, calci-orthic aridisol, haplic calcisol, grazing exclusion, china, soil)2021-08-08v4No1 / 1397
422amnoncommon soil, paddy field soil, oryza sativa, hunan province, hubei province, china, cultivated environment2018-12-02v4No1 / 1399
76amnoncommon in non-seleniferous soil (common soil, rhizosphere, united states of america, non-seleniferous, state of florida)2017-02-28v4No1 / 1414
40amnoncommon soil, field soil, nicotiana tabacum, rhizosphere, china2016-12-09v4No1 / 1420
76amnoncommon in seleniferous soil (common soil, rhizosphere, united states of america, selenium, seleniferous, woodland area)2017-02-28v4No1 / 1438
444amnoncommon rhizosphere, fragaria x ananassa, strawberry, greenhouse soil, farm, yellow brown soil, nanjing city prefecture, age 1 year, china, cultivated environment2019-01-07v4No1 / 1439
783sheryocommon in desert soil in mongolia under water addition treatment (common 100% above ambient precipitation, water addition, ph 7.85, luvic gypsisols, cambic arenosols, china, mongolia, dengkou county, ulan buh desert, bajada, sandy desert, soil)2021-05-11v4No1 / 1442
821sheryoCommon in soil of miscanthus field at 0-10cm depth, Michigan USA (common depth (soil) 0-10cm, miscanthus, restored prairie, united states of america, state of michigan, kellogg biological station, mesic type hapludalf, kalamazoo loam, soil)2021-07-28v4No1 / 1447
414amnon high in ph>6 compared to ph<6 npk fertilizer in soil heilongjiang province agricultural feature triticum aestivum glycine max zea mays black soil mollisol china 2018-11-26v4No1 / 1451
686sheryoCommon in vanilla field soil infected with Fusarium oxysporum, fertilized with chemical fertilizer and had high Fusarium cumulative disease incidence (common ph 7.6, wanning city, pot expreiment, vanilla planifolia, soil from vanilla field, fusarium oxysporum f. sp. vanillae, chemical fertilization n,p,k, high fusarium cumulative disease incidence )2028-03-08v4No1 / 1456
271amnoncommon depth (soil) 0-20cm, rhizosphere, glycine max, soybean, china2018-01-09v4No1 / 1459
837sheryoCommon in agricultural field at depths 0-40cm, shaanxi, China (common depth 0-40cm, agricultural field, zea mays, triticum aestivum, silt loam, china, loess plateau, shaanxi province, soil)2021-09-26v4No1 / 1470
824sheryoCommon in soil after 27-35 years of grazing exclusion at 10-20cm depth, Ningxia china (common depth 10-20cm, 27-35 years of grazing exclusion, yunwushan national natural grassland protection zone, ningxia province, calci-orthic aridisol, haplic calcisol, grazing exclusion, china, soil)2021-08-08v4No1 / 1477
548amnoncommon in phosphorus impoverished soil (common soil, minas gerais state, campos rupestres, brazil, ph 3.5)2019-08-15v4No1 / 1483
631sheryoCommon in maize field biochar amended rhizosphere soil (common ph 7.85, biochar, rhizosphere, china, guizhou province, kaiyang county, soil, maize field, after 6 years)2020-06-02v3No1 / 1492
760sheryoCommon in rhizosphere soil of rice plants without fertilization in a long term fertilization experiment (common ph 5.9, china, soil, qiyang county, hunan province, quaternary red clay, no fertilization, oryza sativa, rhizosphere)2021-04-06v4No1 / 1506
145amnoncommon soil, rhizosphere, oryza sativa, rice, united states of america, ph 5.62017-04-19v4No1 / 1515
855sheryoHigher in soil depth of 75cm compared to soil depth of 175cm in fertilized soil in china ( high in depth 75cm compared to depth 175cm in luancheng county china agricultural field fertilized soil soil )2021-12-27v3No1 / 1522
901amnoncommon sediment surface, depth (sediment) 0cm, taihu lake, depth (water) 20-100cm, taihu national park, china, lake sediment2022-04-25v4No1 / 1550
600sheryolower in stover ammendment soil ( high in unamended soil compared to stover amended in depth (soil) 0-5cm state of new york soil united states of america coarse-loamy soil ph 6 day 82 )2020-03-27v4No1 / 1612
631sheryocommon in maize field unamended rhizosphere soil (common unamended soil, ph 7.6, rhizosphere, china, guizhou province, kaiyang county, soil, maize field, after 6 years)2020-06-02v3No1 / 1637
462amnon high in depth (soil) 0-30 cm depth (soil) 0-20cm silt loam compared to detph 30-75cm silt clay loam in soil united states of america state of tennessee cultivated environment 2019-01-12v4No1 / 1648
821sheryoCommon in soil of continuous corn field at 10-25cm depth, Michigan USA (common depth (soil) 10-25cm, united states of america, state of michigan, kellogg biological station, mesic type hapludalf, kalamazoo loam, continuous corn, corn, soil)2021-07-28v4No1 / 1649
824sheryoCommon in soil after 27-35 years of grazing exclusion at 0-10cm depth, Ningxia china (common yunwushan national natural grassland protection zone, ningxia province, calci-orthic aridisol, haplic calcisol, 27-35 years of grazing exclusion, grazing exclusion, china, depth (soil) 0-10cm, soil)2021-08-08v4No1 / 1659
686sheryoCommon in vanilla field soil infected with Fusarium oxysporum, fertilized with fungal bio-fertilizer and had low Fusarium cumulative disease incidence (common trichoderma guizhouense njau 4742, fungal enriched bio-fertilizer, fusarium oxysporum f. sp. vanillae, soil from vanilla field, vanilla planifolia, pot expreiment, wanning city, ph 7.6, low fusarium cumulative disease incidence )2028-03-08v4No1 / 1661
154amnon high in control compared to uranium high uranium in soil australia kakadu national park sediment 2017-06-29v4No1 / 1663
760sheryoCommon in rhizosphere soil of rice plants with manure fertilization in a long term fertilization experiment (common manure fertilization, manured soil, ph 5.9, china, soil, qiyang county, hunan province, quaternary red clay, oryza sativa, rhizosphere)2021-04-06v4No1 / 1670
696amnon high in alycaeus jagori compared to opisthostoma concinnum plectostoma concinnum in land snail stomach gastrointestinal system malaysia state of sabah 2028-03-28v3No1 / 1672
855sheryoHigher in soil depth of 10cm compared to soil depth of 75cm in fertilized soil in china ( high in depth (water) 10cm compared to depth 75cm in luancheng county china agricultural field fertilized soil soil )2021-12-27v3No1 / 1678
507amnonhigher in mine tailing contaminated sediment compared to uncontaminated control ( high in contaminated sediment compared to control in lake sediment sediment canada quesnel lake province of british columbia )2019-03-17v4No1 / 1681
696amnon high in alycaeus jagori compared to georissa similis georissa in land snail stomach gastrointestinal system malaysia state of sabah 2028-03-28v3No1 / 1698
616amnoncommon in topsoil of PK/NP/NPK/NK fertilized sugarcane field (common depth (soil) 0-20cm, fertilized soil, ph 5.5-6, sugarcane, saccharum, soil, topsoil, china, guangzhou city prefecture)2020-04-27v3No1 / 1710
155amnonhigher in tightly bound root soil compared to loose soil and bulk soil ( high in root compared to bulk soil in triticum aestivum wheat soil china )2017-07-02v4No1 / 1714
842sheryoHigher in soil depth of 0-15cm compared to 15-30cm in a Decomissioned Agricultural Field in Ontario, Canada ( high in depth 0-15cm compared to depth 15-30cm in luvisol dipsacus fullonum solidago apocynum daucus carota decomissioned agricultural field meadow ecosystem grand river watershed rare charitable research reserve cambridge province of ontario canada soil )2021-11-14v3No1 / 1723
686sheryoCommon in vanilla field soil infected with Fusarium oxysporum, fertilized with bacterial bio-fertilizer and had low Fusarium cumulative disease incidence (common fusarium oxysporum f. sp. vanillae, soil from vanilla field, vanilla planifolia, pot expreiment, wanning city, ph 7.6, bacterial enriched bio-fertilizer, bacillus amyloliquefaciens w19, low fusarium cumulative disease incidence )2028-03-08v4No1 / 1726
686sheryoCommon in vanilla field soil infected with Fusarium oxysporum, fertilized with organic fertilizer and had high Fusarium cumulative disease incidence (common organic fertilizer- chicken manure compost, ph 7.6, wanning city, pot expreiment, vanilla planifolia, soil from vanilla field, fusarium oxysporum f. sp. vanillae, high fusarium cumulative disease incidence )2028-03-08v4No1 / 1765
631sheryoCommon in maize field unamended bulk soil (common bulk soil, unamended soil, ph 7.9, maize field, soil, kaiyang county, guizhou province, china)2020-06-02v3No1 / 1814
631sheryocommon in maize field biochar amended bulk soil, after 6 years of biochar amended (common ph 8, china, guizhou province, kaiyang county, soil, maize field, bulk soil, biochar, after 6 years)2020-06-02v3No1 / 1872
156amnoncommon soil, rhizosphere, brassica, brassica oleracea, china2017-07-27v4No1 / 1885
296amnoncommon depth (soil) 0-20cm, soil, north china plain, agricultural feature, wheat, winter, ph>4, ph<5, china2018-02-11v4No1 / 1886
824sheryoCommon in soil after 0-9 years of grazing exclusion at 0-10cm depth, Ningxia china (common depth (soil) 0-10cm, 0-9 years of grazing exclusion, yunwushan national natural grassland protection zone, ningxia province, calci-orthic aridisol, haplic calcisol, grazing exclusion, china, soil)2021-08-08v4No1 / 1903
800amnonlower at 100-250 days compared to 7-28 days following heavy metal contamination ( high in spring compared to autumn summer in reservoir sediment depth 0-10cm heavy metal china xiannv lake lake fresh water sediment )2021-06-15v4No1 / 1962
155amnoncommon in soil tightly bound to wheat root (common triticum aestivum, wheat, soil, root, china)2017-07-02v4No1 / 1977
101amnoncommon state of new york, vitis vinifera, united states of america, merlot, grapevine, rhizosphere2017-04-03v4No1 / 1980
821sheryoCommon in soil of switchgrass field at 0-10cm depth, Michigan USA (common kellogg biological station, mesic type hapludalf, kalamazoo loam, panicum virgatum, depth (soil) 0-10cm, state of michigan, soil, united states of america)2021-08-02v4No1 / 2067
175amnoncommon in heavy metal contaminated soils in china (common soil, heavy metal, ph 7-9, china)2017-07-29v4No1 / 2133
296amnoncommon depth (soil) 0-20cm, soil, north china plain, agricultural feature, wheat, winter, ph>7, ph<8, china2018-02-11v4No1 / 2160
296amnoncommon depth (soil) 0-20cm, soil, north china plain, agricultural feature, wheat, winter, ph>6, ph<7, china2018-02-11v4No1 / 2223
443amnon high in particles filtered 2.7um compared to free floating filtered 0.2um in water river fresh water depth (water) 1m united states of america mississippi river 2019-01-07v4No1 / 2266
296amnoncommon in wheat field soil (common soil, north china plain, depth 5cm, agricultural feature, wheat, winter, china)2018-02-11v4No1 / 2341
718amnon high in hypolimnion compared to epilimnion in "mary lake" ph 5.5-6 meromictic lake freshwater lake bog lake united states of america state of wisconsin 2028-05-23v4No1 / 2370
155amnoncommon in soil loosely bound to wheat root (common triticum aestivum, wheat, soil, rhizosphere, china)2017-07-02v4No1 / 2425
101amnoncommon state of new york, vitis vinifera, united states of america, merlot, grapevine, soil2017-04-03v4No1 / 2537
155amnoncommon in bulk soil in wheat field (common triticum aestivum, wheat, soil, bulk soil, china)2017-07-02v4No1 / 2594
296amnoncommon depth (soil) 0-20cm, soil, north china plain, agricultural feature, wheat, winter, ph>8, china2018-02-11v4No1 / 2646
265amnon high in soil compared to soilwater water in canada province of quebec 2017-12-11v4No1 / 2715
271amnoncommon depth (soil) 0-20cm, soil, china2018-01-09v4No1 / 2856
84amnoncommon depth 20cm, soil, temperate grassland biome, fen, peat soil, flooded grassland biome, united kingdom2017-03-06v4No1 / 2866
166amnoncommon in river sediment (5cm) without mussels (common freshwater biome, river, united states of america, sediment, mississippi river, depth 5cm, upper mississippi river)2017-07-18v4No1 / 2877
837sheryoHigher in soil in agricultural feild compared after 10 years reforestation with Black locust trees, shaanxi, China ( high in triticum aestivum zea mays agricultural field compared to 10 years reforestation robinia pseudoacacia in silt loam china loess plateau shaanxi province soil )2021-09-26v4No1 / 2994
84amnoncommon depth 5cm, soil, temperate grassland biome, fen, peat soil, flooded grassland biome, united kingdom2017-03-07v4No1 / 3434
296amnoncommon depth (soil) 0-20cm, soil, north china plain, agricultural feature, wheat, winter, ph>5, ph<6, china2018-02-11v4No1 / 3508
103amnonhigher in particle bound fraction compared to free floating bacteria in mississippi river ( high in particles compared to free floating in river united states of america mississippi river fresh water aquatic biome )2017-04-05v4No1 / 3559
237amnonhigher in burrow soil compared to bird ( high in soil burrow compared to bird seabird oceanodroma leucorhoa in canada bon portage island )2017-11-07v4No1 / 3656
837sheryoHigher in soil after 30 years compared to 20 years of reforestation with Black locust trees, shaanxi, China ( high in 30 years compared to 20 years in robinia pseudoacacia reforestation silt loam china loess plateau shaanxi province soil )2021-09-27v4No1 / 3936
462amnon high in rhizosphere compared to root in united states of america state of tennessee populus tree cultivated environment 2019-01-13v4No1 / 4630
271amnon high in soil compared to rhizosphere glycine max soybean in depth (soil) 0-20cm china 2018-01-09v4No1 / 4853
837sheryoHigher in soil after 30 years compared to 10 years of reforestation with Black locust trees, shaanxi, China ( high in 30 years compared to 10 years in robinia pseudoacacia reforestation silt loam china loess plateau shaanxi province soil )2021-09-27v4No1 / 5245
837sheryoHigher in soil after 20 years compared to 10 years of reforestation with Black locust trees, shaanxi, China ( high in 20 years compared to 10 years in robinia pseudoacacia reforestation silt loam china loess plateau shaanxi province soil )2021-09-27v4No1 / 5270
837sheryoHigher in soil after 30 years reforestation with Black locust trees compared to agricultural feild, shaanxi, China ( high in robinia pseudoacacia reforestation 30 years compared to zea mays triticum aestivum agricultural field in silt loam china loess plateau shaanxi province soil )2021-09-27v4No1 / 5596
837sheryoHigher in soil after 20 years reforestation with Black locust trees compared agricultural feild, shaanxi, China ( high in robinia pseudoacacia reforestation 20 years compared to triticum aestivum zea mays agricultural field in silt loam china loess plateau shaanxi province soil )2021-09-26v4No1 / 5661
100amnon high in ph ph<6 compared to ph>6 in soil urban biome park new york city central park 2017-04-03v4No1 / 5770
266amnon high in root compared to leaf in brassicaceae boechera stricta plant united states of america state of idaho 2017-12-19v4No1 / 5886
271amnon high in soil rhizosphere compared to root structure root in depth (soil) 0-20cm glycine max soybean china 2018-01-09v4No1 / 7954

Problems / suggestions? Please email info AT dbbact DOT org