Search result for sequence:
TACGAAGGGGGCTAGCGTTGCTCGGAATCACTGGGCGTAAAGCGCACGTAGGCGGGTCTTTAAGTCAGGGGTGAAATCCTGGAGCTCAACTCCAGAACTGCCTTTGATACTGAGGATCTCGAGTCCGGGAGAGGTGAGTGGAACTCCGAG
common ontology terms
term enrichment score
TermScore
soil0.315375
grand river watershed0.300752
rare charitable research reserve0.300752
agricultural field0.254111
luvisol0.243902
cambridge0.207254
province of ontario0.187793
triticum aestivum0.165000
pot expreiment0.162162
depth 0-15cm0.162162
quercus velutina0.162162
quercus alba0.162162
quercus rubra0.162162
acer saccharum0.162162
acer saccharum subsp. nigrum0.162162
fagus grandifolia0.162162
forest0.162162
bulk soil0.157895
rhizosphere0.154176
maize field0.136808
dipsacus fullonum0.130841
solidago0.130841
apocynum0.130841
decomissioned agricultural field0.130841
meadow ecosystem0.130841
forested area0.130435
zea mays0.126697
depth (soil) 0-20cm0.125392
ph 7.60.122807
daucus carota0.122807
lettuce0.114286
crop rotation0.114286
bernburg0.114286
switzerland0.112450
germany0.100167
kingdom of denmark0.100000
ph 80.099502
depth (soil) 0-30 cm0.097087
depth 15-30cm0.097087
depth 30-45cm0.097087
mature forest0.097087
brunisol0.097087
fertilized soil0.094787
china0.094132
haplic luvisol0.092593
kaiyang county0.079208
guizhou province0.079208
state of sabah0.079208
alabama0.079208
ultisol0.079208
preston flats0.079208
LOWER IN depth 15-30cm0.079208
old growth forest0.079208
calcic chernozem0.079208
south moravian region0.079208
colluvial soil0.079208
malaysia0.076190
land snail0.076190
auburn0.076190
wheat0.070796
ph 70.070796
gastrointestinal system0.066116
czech republic0.064000
minas gerais state0.060606
campos rupestres0.060606
elevation 2000-3000m0.060606
after 6 years0.060606
alycaeus jagori0.060606
oak0.060606
panax notoginseng0.060606
sanqi plants0.060606
xundian county0.060606
organic fertilization0.060606
thyrow0.060606
therwil0.060606
cultivator tillage0.060606
maize pre-crop0.060606
foot slope 0.060606
dekalb county0.060606
illinois0.060606
ph 50.059701
mountain0.058824
sugarcane0.058824
saccharum0.058824
park0.058824
quercus0.058824
yunnan province0.058824
manure fertilization0.058824
conservation tillage0.058824
luancheng county0.058824
canada0.057720
biochar0.057143
guangzhou city prefecture0.055556
ph 60.054054
manured soil0.054054
ph 4-50.053333
state of illinois0.051282
topsoil0.050000
stomach0.049689
depth (soil) 0-10cm0.045455
Fraction of dbbact annotations with this term covered by the query
TermScore
quaternary laterite soil1.000000
cucurbita moschata1.000000
pumpkin1.000000
banana1.000000
musa acuminata1.000000
volcan sumaco1.000000
cinnamomum camphora1.000000
anxi county1.000000
maize field0.750000
ph 80.666667
arachis hypogaea0.500000
peanut0.500000
minas gerais state0.500000
campos rupestres0.500000
barbacenia macrantha0.500000
orthic anthrosol0.500000
elevation 2000-3000m0.500000
siliceous parent material0.500000
rhone river valley0.500000
ph 4.5-70.500000
canton of graubunden0.500000
calcareous parent material0.500000
high biochar0.500000
low biochar0.500000
straw0.500000
kaiyang county0.500000
guizhou province0.500000
after 6 years0.500000
alycaeus jagori0.500000
state of sabah0.500000
LOWER IN plectostoma concinnum0.500000
LOWER IN opisthostoma concinnum0.500000
georissa0.500000
georissa similis0.500000
LOWER IN georissa similis0.500000
LOWER IN georissa0.500000
depth (soil) 0-30 cm0.500000
oak0.500000
acute oak decline0.500000
LOWER IN acute oak decline0.500000
luojiazhuang0.500000
panax notoginseng0.500000
sanqi plants0.500000
xundian county0.500000
pot expreiment0.500000
lower saxony0.500000
sandy soil0.500000
organic fertilization0.500000
thyrow0.500000
albic luvisol0.500000
ph 6.40.500000
lettuce0.500000
mineral fertilization0.500000
therwil0.500000
ph 6.60.500000
bio-dynamic fertilizer0.500000
LOWER IN mineral fertilization0.500000
crop rotation0.500000
mouldboard plough0.500000
loess chernozem0.500000
bernburg0.500000
cultivator tillage0.500000
LOWER IN rapeseed pre-crop0.500000
maize pre-crop0.500000
LOWER IN mouldboard plough0.500000
rapeseed pre-crop0.500000
chromic cambisol0.500000
bretagne region0.500000
flood plain0.500000
sacramento0.500000
cosumnes river preserve0.500000
litter bag0.500000
apricot0.500000
prunus armeniaca0.500000
apennine mountains0.500000
okinawa islands0.500000
LOWER IN normal weather0.500000
tropical storm0.500000
depth 50-70cm0.500000
alabama0.500000
upland soil0.500000
ultisol0.500000
foot slope 0.500000
LOWER IN depth 50-90cm0.500000
plough layer 0.500000
late weichselian glaciation0.500000
clayey till0.500000
lund0.500000
depth 300-350cm0.500000
depth 0-27cm0.500000
dekalb county0.500000
illinois0.500000
depth 0-12cm0.500000
hapludalf0.500000
alfisol0.500000
LOWER IN depth 12-44cm0.500000
LOWER IN depth 30-60cm0.500000
depth 0-15cm0.500000
preston flats0.500000
luvisol0.500000
Fraction of annotations for the query sequences containing the term
TermScore
soil0.774194
china0.225806
grand river watershed0.215054
canada0.215054
province of ontario0.215054
cambridge0.215054
rare charitable research reserve0.215054
agricultural field0.182796
luvisol0.161290
rhizosphere0.129032
depth (soil) 0-20cm0.129032
triticum aestivum0.118280
germany0.107527
bulk soil0.096774
pot expreiment0.096774
depth 0-15cm0.096774
quercus velutina0.096774
quercus alba0.096774
quercus rubra0.096774
acer saccharum0.096774
acer saccharum subsp. nigrum0.096774
fagus grandifolia0.096774
forest0.096774
forested area0.096774
switzerland0.075269
maize field0.075269
ph 7.60.075269
zea mays0.075269
dipsacus fullonum0.075269
solidago0.075269
apocynum0.075269
daucus carota0.075269
decomissioned agricultural field0.075269
meadow ecosystem0.075269
kingdom of denmark0.064516
lettuce0.064516
crop rotation0.064516
bernburg0.064516
fertilized soil0.053763
ph 80.053763
depth (soil) 0-30 cm0.053763
haplic luvisol0.053763
united states of america0.053763
depth 15-30cm0.053763
depth 30-45cm0.053763
mature forest0.053763
brunisol0.053763
wheat0.043011
ph 70.043011
kaiyang county0.043011
guizhou province0.043011
state of sabah0.043011
malaysia0.043011
gastrointestinal system0.043011
stomach0.043011
land snail0.043011
alabama0.043011
auburn0.043011
ultisol0.043011
preston flats0.043011
LOWER IN depth 15-30cm0.043011
old growth forest0.043011
calcic chernozem0.043011
czech republic0.043011
south moravian region0.043011
colluvial soil0.043011
ph 50.032258
minas gerais state0.032258
campos rupestres0.032258
brazil0.032258
farm0.032258
mountain0.032258
depth (soil) 0-10cm0.032258
elevation 2000-3000m0.032258
sugarcane0.032258
saccharum0.032258
topsoil0.032258
guangzhou city prefecture0.032258
biochar0.032258
after 6 years0.032258
alycaeus jagori0.032258
park0.032258
united kingdom0.032258
oak0.032258
quercus0.032258
panax notoginseng0.032258
sanqi plants0.032258
ph 60.032258
xundian county0.032258
yunnan province0.032258
manured soil0.032258
manure fertilization0.032258
organic fertilization0.032258
thyrow0.032258
therwil0.032258
cultivator tillage0.032258
conservation tillage0.032258
maize pre-crop0.032258
foot slope 0.032258
dekalb county0.032258
Exp. ID User ID Description Date Region Flag Sequences
764sheryoHigh in maize pre-crop compared to rapeseed pre-crop in leoss soil in wheat field grown under conservation tillage and crop rotation in germany ( high in maize pre-crop zea mays compared to rapeseed pre-crop brassica napus in ph 7.6 crop rotation cultivator tillage conservation tillage triticum aestivum soil germany bernburg )2021-04-12v3No1 / 31
764sheryoHigh in conservation tillage compared to conventional tillage in leoss soil in wheat field grown under crop rotation with maize pre-crop in germany ( high in cultivator tillage conservation tillage compared to mouldboard plough conventional tillage in maize pre-crop ph 7.6 crop rotation triticum aestivum soil germany bernburg )2021-04-12v3No1 / 56
854sheryoHigher at soil depth of 25-100cm compared to soil depth of 125-175cm of colluvial soil, Czech rebuplic ( high in depth 25-100cm compared to depth 125-175cm in calcic chernozem colluvial soil ph 8 south moravian region czech republic soil )2021-12-23v3No1 / 70
696amnoncommon alycaeus jagori, state of sabah, malaysia, gastrointestinal system, stomach, land snail2028-03-27v3No1 / 74
842sheryoCommon in soil depth of 30-45cm in a mature forest in Ontario, Canada (common depth 30-45cm, mature forest, brunisol, grand river watershed, rare charitable research reserve, quercus velutina, quercus alba, quercus rubra, acer saccharum, acer saccharum subsp. nigrum, fagus grandifolia, cambridge, forest, forested area, province of ontario, canada, soil)2021-11-14v3No1 / 227
583amnoncommon soil, mountain, switzerland, ph 4-6, depth (soil) 0-10cm, elevation 2000-3000m, siliceous parent material, rhone river valley2020-01-27v3No1 / 234
842sheryoCommon in soil depth of 0-15cm in a mature forest in Ontario, Canada (common mature forest, brunisol, grand river watershed, rare charitable research reserve, quercus velutina, quercus alba, quercus rubra, acer saccharum, acer saccharum subsp. nigrum, fagus grandifolia, cambridge, forest, forested area, province of ontario, canada, soil)2021-11-14v3No1 / 261
752sheryoHigher in treatments without biochar compared to treatments with biochar in soil planted with Panax notoginseng amended with 2% biochar ( high in without biochar compared to biochar in panax notoginseng sanqi plants ph 6 xundian county yunnan province china pot expreiment soil )2021-03-11v3No1 / 273
762sheryoHigher in bulk soil of a pot experiment with lettuce planted in organic fertilized compared to npk fertilized haplic luvisol Switzerland ( high in manured soil manure fertilization bio-dynamic fertilizer organic fertilization compared to npk fertilization mineral fertilization in therwil switzerland haplic luvisol soil bulk soil lettuce pot expreiment )2021-04-07v3No1 / 294
751sheryoCommon in tomato soil infected with Fusarium oxysporum (common china, shandong province, luojiazhuang, fusarium oxysporum, solanum lycopersicum, soil)2021-03-11v3No1 / 305
583amnoncommon soil, mountain, switzerland, depth (soil) 0-10cm, elevation 2000-3000m, siliceous parent material, ph 4.5-7, canton of graubunden2020-01-27v3No1 / 359
842sheryoCommon in soil depth of 30-45cm in an old growth forest in Ontario, Canada (common depth 30-45cm, old growth forest, luvisol, grand river watershed, rare charitable research reserve, quercus velutina, quercus alba, quercus rubra, acer saccharum, acer saccharum subsp. nigrum, fagus grandifolia, cambridge, forest, forested area, province of ontario, canada, soil)2021-11-14v3No1 / 390
842sheryoCommon in soil depth of 30-45cm in a mature forest in Ontario, Canada (common depth 30-45cm, luvisol, mature forest, grand river watershed, rare charitable research reserve, quercus velutina, quercus alba, quercus rubra, acer saccharum, acer saccharum subsp. nigrum, fagus grandifolia, cambridge, forest, forested area, province of ontario, canada, soil)2021-11-14v3No1 / 393
855sheryoHigher in soil depth of 350cm compared to soil depth of 800cm in fertilized soil in china ( high in depth 350cm compared to depth 800cm in luancheng county china agricultural field fertilized soil soil )2021-12-27v3No1 / 418
842sheryoCommon in soil depth of 15-30cm in a mature forest in Ontario, Canada (common depth 15-30cm, luvisol, mature forest, grand river watershed, rare charitable research reserve, quercus velutina, quercus alba, quercus rubra, acer saccharum, acer saccharum subsp. nigrum, fagus grandifolia, cambridge, forest, forested area, province of ontario, canada, soil)2021-11-14v3No1 / 433
698amnon high in ph 6-7 control compared to ph 5-6 disease plant disease acute oak decline in depth (soil) 0-30 cm depth (soil) 0-20cm park united kingdom oak quercus rhizosphere 2028-04-01v3No1 / 452
842sheryoCommon in soil depth of 0-15cm in a mature forest in Ontario, Canada (common depth 0-15cm, luvisol, mature forest, grand river watershed, rare charitable research reserve, quercus velutina, quercus alba, quercus rubra, acer saccharum, acer saccharum subsp. nigrum, fagus grandifolia, cambridge, forest, forested area, province of ontario, canada, soil)2021-11-14v3No1 / 460
964amnoncommon stratovolcano, ph 4-5, soil, depth (soil) 10-25cm, ecuador, volcan sumaco2022-12-21v3No1 / 472
989amnoncommon rhizosphere, depth (soil) 0-20cm, cinnamomum camphora, anxi county, ph 4-5, farm, china2022-12-26v3No1 / 476
942amnoncommon banana, rhizosphere, nanning city prefecture, china, musa acuminata2022-11-25v3No1 / 505
842sheryoCommon in soil depth of 15-30cm in an old growth forest in Ontario, Canada (common depth 15-30cm, old growth forest, luvisol, grand river watershed, rare charitable research reserve, quercus velutina, quercus alba, quercus rubra, acer saccharum, acer saccharum subsp. nigrum, fagus grandifolia, cambridge, forest, forested area, province of ontario, canada, soil)2021-11-14v3No1 / 507
798amnoncommon depth (soil) 10 cm, depth (soil) 0-20cm, hay, plant litter, litter bag, orchard, apricot, prunus armeniaca, apennine mountains, italy2021-06-13v3No1 / 508
548amnoncommon minas gerais state, campos rupestres, brazil, barbacenia macrantha, root endosphere, root2019-08-17v4No1 / 575
696amnon high in georissa georissa similis compared to plectostoma concinnum opisthostoma concinnum in land snail stomach gastrointestinal system malaysia state of sabah 2028-03-28v3No1 / 576
762sheryoHigh in bulk soil comparedc to rhizosphere of a pot experiment with lettuce planted in haplic luvisol Switzerland ( high in bulk soil compared to rhizosphere in thyrow switzerland haplic luvisol pot expreiment lettuce soil )2021-04-08v3No1 / 577
762sheryoHigh in bulk soil compared to rhizosphere of a pot experiment with lettuce planted in albic luvisol Germany ( high in bulk soil compared to rhizosphere in thyrow albic luvisol germany haplic luvisol pot expreiment lettuce soil )2021-04-08v3No1 / 578
842sheryoHigher in soil depth of 0-15cm compared soil depth of 15-30cm in a Decomissioned Agricultural Field in Ontario, Canada ( high in depth 0-15cm compared to depth 15-30cm in dipsacus fullonum solidago apocynum daucus carota brunisol decomissioned agricultural field meadow ecosystem grand river watershed rare charitable research reserve cambridge province of ontario canada soil )2021-11-14v3No1 / 601
762sheryoCommon in bulk soil of a pot experiment with lettuce planted in organic fertilized haplic luvisol Switzerland (common ph 6.6, manured soil, manure fertilization, organic fertilization, bio-dynamic fertilizer, therwil, switzerland, haplic luvisol, soil, bulk soil, lettuce, pot expreiment)2021-04-07v3No1 / 602
823sheryoCommon at 50-70cm depth in ultisol soil in auburn, alabama (common depth 50-70cm, alabama, auburn, upland soil, ultisol, agricultural field, soil)2021-08-07v3No1 / 620
786sheryoHigher at 0-30cm depth compared to 30-60cm depth in flood plain soil near cosumnes river, california ( high in depth (soil) 0-30 cm depth (soil) 0-20cm compared to depth 30-60cm in flood plain soil united states of america state of california sacramento cosumnes river preserve )2021-09-13v3No1 / 627
616amnon high in ph 5.5-6 fertilized soil compared to ph 6.7 non-fertilized soil in depth (soil) 0-20cm sugarcane saccharum soil topsoil china guangzhou city prefecture 2020-04-27v3No1 / 648
762sheryoCommon in bulk soil of a pot experiment with lettuce planted in npk fertilized haplic luvisol Switzerland (common npk fertilization, mineral fertilization, ph 5.6, therwil, switzerland, haplic luvisol, soil, bulk soil, lettuce, pot expreiment)2021-04-07v3No1 / 648
548amnoncommon minas gerais state, campos rupestres, brazil, barbacenia macrantha, rhizosphere2019-08-17v4No1 / 651
842sheryoHigher in soil depth of 0-15cm compared to soil depth of 15-30cm in an old growth forest in Ontario, Canada ( high in depth 0-15cm compared to depth 15-30cm in old growth forest luvisol grand river watershed rare charitable research reserve quercus velutina quercus alba quercus rubra acer saccharum acer saccharum subsp. nigrum fagus grandifolia cambridge forest forested area province of ontario canada soil )2021-11-14v3No1 / 653
842sheryoCommon in soil depth of 30-45cm in a zea mays agricultural field in Ontario, Canada (common depth 30-45cm, zea mays, preston flats, agricultural field, soil, luvisol, grand river watershed, canada, province of ontario, cambridge, rare charitable research reserve)2021-11-14v3No1 / 676
829sheryohigher soil depth of 0-12cm compared to 12-44cm in Alfisol soil, Dekalb, Illinois, united states of america ( high in depth 0-12cm compared to depth 12-44cm in sandy loam sandy loam soil hapludalf alfisol united states of america soil state of illinois illinois dekalb county )2021-08-26v3No1 / 685
762sheryoCommon in bulk soil of a pot experiment with lettuce planted in organic fertilized albic luvisol from Germany (common manured soil, manure fertilization, germany, organic fertilization, soil, bulk soil, thyrow, albic luvisol, ph 6.4, lettuce, pot expreiment)2021-04-07v3No1 / 704
752sheryoCommon in soil planted with Panax notoginseng (common panax notoginseng, sanqi plants, ph 6, xundian county, yunnan province, china, pot expreiment, soil)2021-03-11v3No1 / 730
829sheryoCommon in soil depth of 0-12m in Alfisol soil, Dekalb, Illinois, united states of america (common depth 0-12cm, sandy loam, sandy loam soil, hapludalf, alfisol, united states of america, soil, state of illinois, illinois, dekalb county)2021-08-26v3No1 / 737
989amnoncommon depth (soil) 0-20cm, cinnamomum camphora, anxi county, ph 4-5, farm, china, soil2022-12-26v3No1 / 738
761sheryoCommon in maize rhizosphere sandy soil maize field in Germany (common zea mays, rhizosphere, ph 5, lower saxony, sandy soil, germany, maize field)2021-04-06v3No1 / 742
854sheryoCommon in soil depth of 275-325cm of colluvial soil, Czech rebuplic (common depth 275-325cm, calcic chernozem, colluvial soil, ph 8, south moravian region, czech republic, soil)2021-12-23v3No1 / 749
752sheryoCommon in soil planted with Panax notoginseng amended with2% biochar (common biochar, panax notoginseng, sanqi plants, ph 6, xundian county, yunnan province, china, pot expreiment, soil)2021-03-11v3No1 / 783
829sheryoCommon in soil depth of 0-27cm in Mollisol soil, Dekalb, Illinois, united states of america (common depth 0-27cm, dekalb county, illinois, state of illinois, mollisol, silt loam, soil, united states of america)2021-08-26v3No1 / 798
583amnoncommon soil, mountain, switzerland, depth (soil) 0-10cm, elevation 2000-3000m, canton of graubunden, calcareous parent material, ph 7-82020-01-28v3No1 / 830
842sheryoCommon in soil depth of 0-15cm in an old growth forest in Ontario, Canada (common depth 0-15cm, old growth forest, luvisol, grand river watershed, rare charitable research reserve, quercus velutina, quercus alba, quercus rubra, acer saccharum, acer saccharum subsp. nigrum, fagus grandifolia, cambridge, forest, forested area, province of ontario, canada, soil)2021-11-14v3No1 / 834
761sheryoCommon in bulk sandy soil maize field in Germany (common ph 5, lower saxony, sandy soil, germany, maize field, bulk soil)2021-04-06v3No1 / 835
698amnoncommon depth (soil) 0-30 cm, depth (soil) 0-20cm, ph 5-6, disease, plant disease, acute oak decline, park, united kingdom, oak, quercus, rhizosphere2028-04-01v3No1 / 848
827sheryoCommon in soil at 325cm depth in clayey till loam soil, Lund Denmark (common lund, kingdom of denmark, agricultural field, clayey till, late weichselian glaciation, loam soil, depth 300-350cm)2021-08-24v3No1 / 866
854sheryoCommon in soil depth of 75-100cm of colluvial soil, Czech rebuplic (common depth 75-100cm, calcic chernozem, colluvial soil, ph 8, south moravian region, czech republic, soil)2021-12-23v3No1 / 879
807amnoncommon tropical storm, summer, okinawa islands, japan, filtered 0.2um, near shore, sea water, surface water2021-06-20v3No1 / 905
842sheryoCommon in soil depth of 15-30cm in a Decomissioned Agricultural Field in Ontario, Canada (common depth 15-30cm, dipsacus fullonum, solidago, apocynum, daucus carota, brunisol, decomissioned agricultural field, meadow ecosystem, grand river watershed, rare charitable research reserve, cambridge, province of ontario, canada, soil)2021-11-14v3No1 / 905
854sheryoCommon in soil depth of 25-50cm of colluvial soil, Czech rebuplic (common ph 8, calcic chernozem, czech republic, south moravian region, colluvial soil, depth 25-50cm, soil)2021-12-23v3No1 / 905
548amnoncommon minas gerais state, campos rupestres, brazil, rock2019-08-17v4No1 / 924
842sheryoHigher in soil depth of 0-15cm compared to soil depth 15-30cm in a zea mays agricultural field in Ontario, Canada ( high in depth 0-15cm compared to depth 15-30cm in zea mays preston flats agricultural field soil luvisol grand river watershed canada province of ontario cambridge rare charitable research reserve )2021-11-14v3No1 / 924
842sheryoCommon in soil depth of 15-30cm in a zea mays agricultural field in Ontario, Canada (common depth 15-30cm, zea mays, preston flats, agricultural field, soil, luvisol, grand river watershed, canada, province of ontario, cambridge, rare charitable research reserve)2021-11-14v3No1 / 944
823sheryoHigher at 15-30cm depth compared to 50-90cm depth in foot slope ultisol soil in auburn, alabama ( high in depth (soil) 15-30cm compared to depth 50-90cm in foot slope alabama auburn ultisol agricultural field soil )2021-08-08v3No1 / 968
842sheryoCommon in soil depth of 30-45cm in a Decomissioned Agricultural Field in Ontario, Canada (common depth 30-45cm, luvisol, dipsacus fullonum, solidago, apocynum, daucus carota, decomissioned agricultural field, meadow ecosystem, grand river watershed, rare charitable research reserve, cambridge, province of ontario, canada, soil)2021-11-14v3No1 / 970
842sheryoCommon in soil depth of 15-30cm in a Decomissioned Agricultural Field in Ontario, Canada (common depth 15-30cm, luvisol, dipsacus fullonum, solidago, apocynum, daucus carota, decomissioned agricultural field, meadow ecosystem, grand river watershed, rare charitable research reserve, cambridge, province of ontario, canada, soil)2021-11-14v3No1 / 974
610sheryoCommon in agricultural field soil amended with straw (common straw, triticum aestivum, ph 7, wheat, kingdom of denmark, agricultural field, soil)2020-04-21v3No1 / 998
933amnoncommon guangxi zhuang autonomous region, ph 5.5, quaternary laterite soil, research facility, china, cucurbita moschata, pumpkin, rhizosphere2022-09-11v3No1 / 1002
610sheryoCommon in agricultural field soil amended with low biochar (common low biochar, triticum aestivum, ph 7, wheat, kingdom of denmark, agricultural field, soil)2020-04-21v3No1 / 1009
768sheryoCommon in maize fields in Brittany, France (common zea mays, maize field, cambisol, bretagne region, french republic, soil)2021-04-18v3No1 / 1034
786sheryocommon in flood plain soil near cosumnes river, california, at 0-30cm depth (common depth (soil) 0-30 cm, depth (soil) 0-20cm, flood plain, soil, united states of america, state of california, sacramento, cosumnes river preserve)2021-05-18v3No1 / 1048
610sheryoCommon in agricultural field soil (common triticum aestivum, ph 7, wheat, kingdom of denmark, agricultural field, soil)2020-04-21v3No1 / 1053
610sheryoCommon in agricultural field soil amended with high biochar (common soil, agricultural field, kingdom of denmark, wheat, ph 7, high biochar, triticum aestivum)2020-04-21v3No1 / 1079
842sheryoCommon in soil depth of 0-15cm in a Decomissioned Agricultural Field in Ontario, Canada (common depth 0-15cm, dipsacus fullonum, solidago, apocynum, daucus carota, brunisol, decomissioned agricultural field, meadow ecosystem, grand river watershed, rare charitable research reserve, cambridge, province of ontario, canada, soil)2021-11-14v3No1 / 1082
765sheryocommon in wheat field in the loess plateau in china (common triticum aestivum, ph 7.7, loess plateau, silt loam, chromic cambisol, shanxi province, china, soil)2021-04-12v3No1 / 1087
827sheryoCommon in soil at 25cm depth in clayey till loam soil, Lund Denmark (common depth (soil) 20-30cm, plough layer , loam soil, late weichselian glaciation, clayey till, agricultural field, kingdom of denmark, lund)2021-08-24v3No1 / 1111
698amnoncommon depth (soil) 0-30 cm, depth (soil) 0-20cm, control, ph 6-7, park, united kingdom, oak, quercus, rhizosphere2028-04-01v3No1 / 1115
764sheryocommon in leoss soil in wheat field grown under crop rotation with rapeseed pre-crop in germany (common bernburg, germany, soil, triticum aestivum, crop rotation, ph 7.6, brassica napus, rapeseed pre-crop)2021-04-12v3No1 / 1129
764sheryoCommon in leoss soil in wheat field grown under conservation tillage and crop rotation in germany (common ph 7.6, crop rotation, cultivator tillage, conservation tillage, triticum aestivum, soil, germany, bernburg)2021-04-12v3No1 / 1140
842sheryoCommon in soil depth of 0-15cm in a zea mays agricultural field in Ontario, Canada (common depth 0-15cm, zea mays, preston flats, agricultural field, soil, luvisol, grand river watershed, canada, province of ontario, cambridge, rare charitable research reserve)2021-11-14v3No1 / 1147
807amnon high in tropical storm compared to normal weather in summer okinawa islands japan filtered 0.2um near shore sea water surface water 2021-06-20v3No1 / 1191
823sheryoCommon at 0-15cm depth in foot slope ultisol soil in auburn, alabama (common foot slope , depth (soil) 0-15cm, alabama, auburn, ultisol, agricultural field, soil)2021-08-08v3No1 / 1199
764sheryoCommon in leoss soil in wheat field grown under conventional tillage and crop rotation in germany (common crop rotation, triticum aestivum, ph 7.6, mouldboard plough, conventional tillage, loess chernozem, bernburg, germany, soil)2021-04-12v3No1 / 1213
823sheryoCommon at 15-30cm depth in foot slope ultisol soil in auburn, alabama (common depth (soil) 15-30cm, foot slope , alabama, auburn, ultisol, agricultural field, soil)2021-08-08v3No1 / 1218
531amnoncommon rhizosphere, greenhouse soil, farm, orthic anthrosol, cucumis sativus, cucumber, china2019-07-21v3No1 / 1223
764sheryoCommon in leoss soil in wheat field grown under crop rotation with maize pre-crop in germany (common maize pre-crop, ph 7.6, crop rotation, triticum aestivum, soil, germany, bernburg)2021-04-12v3No1 / 1225
798amnoncommon depth (soil) 10 cm, depth (soil) 0-20cm, ph 7-8, soil, orchard, apricot, prunus armeniaca, apennine mountains, italy2021-06-13v3No1 / 1230
855sheryoCommon in soil depth of 10cm in fertilized soil in china (common luancheng county, china, depth (water) 10cm, fertilized soil, agricultural field, soil)2021-12-27v3No1 / 1253
616amnoncommon in topsoil of non-fertilized sugarcane field (common depth (soil) 0-20cm, ph 6.7, sugarcane, saccharum, soil, topsoil, china, guangzhou city prefecture, non-fertilized soil)2020-04-27v3No1 / 1277
842sheryoCommon in soil depth of 0-15cm in a Decomissioned Agricultural Field in Ontario, Canada (common depth 0-15cm, luvisol, dipsacus fullonum, solidago, apocynum, daucus carota, decomissioned agricultural field, meadow ecosystem, grand river watershed, rare charitable research reserve, cambridge, province of ontario, canada, soil)2021-11-14v3No1 / 1281
259amnoncommon in soil and rhizpsphere of peanut plants (common soil, rhizosphere, ph 5, arachis hypogaea, peanut, china)2017-12-02v4No1 / 1334
631sheryoCommon in maize field biochar amended rhizosphere soil (common ph 7.85, biochar, rhizosphere, china, guizhou province, kaiyang county, soil, maize field, after 6 years)2020-06-02v3No1 / 1492
631sheryocommon in maize field unamended rhizosphere soil (common unamended soil, ph 7.6, rhizosphere, china, guizhou province, kaiyang county, soil, maize field, after 6 years)2020-06-02v3No1 / 1637
696amnon high in alycaeus jagori compared to opisthostoma concinnum plectostoma concinnum in land snail stomach gastrointestinal system malaysia state of sabah 2028-03-28v3No1 / 1672
855sheryoHigher in soil depth of 10cm compared to soil depth of 75cm in fertilized soil in china ( high in depth (water) 10cm compared to depth 75cm in luancheng county china agricultural field fertilized soil soil )2021-12-27v3No1 / 1678
696amnon high in alycaeus jagori compared to georissa similis georissa in land snail stomach gastrointestinal system malaysia state of sabah 2028-03-28v3No1 / 1698
616amnoncommon in topsoil of PK/NP/NPK/NK fertilized sugarcane field (common depth (soil) 0-20cm, fertilized soil, ph 5.5-6, sugarcane, saccharum, soil, topsoil, china, guangzhou city prefecture)2020-04-27v3No1 / 1710
842sheryoHigher in soil depth of 0-15cm compared to 15-30cm in a Decomissioned Agricultural Field in Ontario, Canada ( high in depth 0-15cm compared to depth 15-30cm in luvisol dipsacus fullonum solidago apocynum daucus carota decomissioned agricultural field meadow ecosystem grand river watershed rare charitable research reserve cambridge province of ontario canada soil )2021-11-14v3No1 / 1723
631sheryoCommon in maize field unamended bulk soil (common bulk soil, unamended soil, ph 7.9, maize field, soil, kaiyang county, guizhou province, china)2020-06-02v3No1 / 1814
631sheryocommon in maize field biochar amended bulk soil, after 6 years of biochar amended (common ph 8, china, guizhou province, kaiyang county, soil, maize field, bulk soil, biochar, after 6 years)2020-06-02v3No1 / 1872

Problems / suggestions? Please email info AT dbbact DOT org