Search result for sequence:
TACGAAGGGGGCTAGCGTTGCTCGGAATCACTGGGCGTAAAGCGCGCGTAGGCGGATCGTTAAGTCGGGGGTGAAATCCTGGAGCTCAACTCCAGAACTGCCTTTGATACTGGCGATCTTGAGTCCGGGAGAGGTGAGTGGAACTCCGAG
common ontology terms
term enrichment score
TermScore
soil0.339750
agricultural field0.338129
grand river watershed0.269841
rare charitable research reserve0.269841
alabama0.192982
ultisol0.192982
luvisol0.192982
cambridge0.192090
auburn0.176000
province of ontario0.175258
quercus velutina0.163636
quercus alba0.163636
quercus rubra0.163636
acer saccharum0.163636
acer saccharum subsp. nigrum0.163636
fagus grandifolia0.163636
forest0.163636
dekalb county0.155963
illinois0.155963
depth (soil) 0-20cm0.154630
forested area0.131387
rhizosphere0.128837
depth 15-30cm0.123810
upland soil0.115385
mature forest0.115385
brunisol0.115385
depth 30-45cm0.106796
dipsacus fullonum0.106796
solidago0.106796
apocynum0.106796
decomissioned agricultural field0.106796
meadow ecosystem0.106796
state of illinois0.106250
bulk soil0.104928
china0.104861
daucus carota0.101382
kingdom of denmark0.100840
canada0.099448
pot expreiment0.098039
foot slope 0.098039
silt loam0.093458
triticum aestivum0.090634
mollisol0.085308
maize field0.082192
lettuce0.080000
late weichselian glaciation0.080000
clayey till0.080000
lund0.080000
hapludalf0.080000
alfisol0.080000
depth 0-15cm0.080000
fertilized soil0.078431
germany0.076923
loam soil0.076923
sandy loam0.076923
sandy loam soil0.076923
depth (soil) 0-10cm0.076190
flood plain0.070707
sacramento0.070707
cosumnes river preserve0.070707
zea mays0.067524
switzerland0.064965
ph 80.062176
depth (soil) 0-30 cm0.061224
old growth forest0.061224
ph 4-50.061002
ph 7.60.059406
luancheng county0.059406
marsh0.059406
topsoil0.056872
ph 7-80.054054
cinnamomum camphora0.052910
anxi county0.052910
farm0.051788
oak0.051546
thyrow0.051546
crop rotation0.051546
bernburg0.051546
mangrove0.051546
preston flats0.051546
calcic chernozem0.051546
south moravian region0.051546
colluvial soil0.051546
sugarcane0.050251
saccharum0.050251
park0.050251
quercus0.050251
haplic luvisol0.050251
guangzhou city prefecture0.047847
surface water0.046729
czech republic0.044643
depth (soil) 10-25cm0.042105
kaiyang county0.041667
guizhou province0.041667
mineral fertilization0.041667
albic luvisol0.041667
npk fertilization0.040816
wheat0.039216
ph 70.039216
state of california0.037534
Fraction of dbbact annotations with this term covered by the query
TermScore
qiao nature reserve1.000000
sonneratia apetala1.000000
quaternary laterite soil1.000000
cucurbita moschata1.000000
pumpkin1.000000
banana1.000000
musa acuminata1.000000
volcan sumaco1.000000
sediment depth 20-50cm1.000000
aldabra atoll1.000000
seychelles1.000000
cinnamomum camphora1.000000
anxi county1.000000
low nutrient availability1.000000
LOWER IN high nutrient availability1.000000
LOWER IN downhill1.000000
uphill1.000000
river water1.000000
fuzhou city prefecture1.000000
xiyuan river1.000000
baltic salmon1.000000
lithuania1.000000
salmo salar1.000000
maize field0.750000
ph 80.666667
depth (soil) 10-25cm0.666667
savanna0.500000
minas gerais state0.500000
campos rupestres0.500000
barbacenia macrantha0.500000
orthic anthrosol0.500000
cucumber0.500000
ammotragus lervia0.500000
barbary sheep0.500000
african lion safari0.500000
romania0.500000
ursu lake0.500000
hypersaline water0.500000
depth (water) 4-9m0.500000
monimolimnion0.500000
LOWER IN depth (water) 0-3m0.500000
LOWER IN mixolimnion0.500000
elevation 2000-3000m0.500000
siliceous parent material0.500000
rhone river valley0.500000
ph 4.5-70.500000
canton of graubunden0.500000
calcareous parent material0.500000
baijiu0.500000
hefei city prefecture0.500000
days 0-900.500000
agricultural field0.500000
high biochar0.500000
low biochar0.500000
straw0.500000
kaiyang county0.500000
guizhou province0.500000
after 6 years0.500000
treated wastewater0.500000
clay soil0.500000
neve yaar0.500000
loamy sand soil0.500000
LOWER IN plectostoma concinnum0.500000
LOWER IN opisthostoma concinnum0.500000
georissa0.500000
georissa similis0.500000
state of sabah0.500000
alycaeus jagori0.500000
depth (soil) 0-30 cm0.500000
oak0.500000
acute oak decline0.500000
panax notoginseng0.500000
sanqi plants0.500000
xundian county0.500000
pot expreiment0.500000
bacillus amyloliquefaciens sqr90.500000
lower saxony0.500000
sandy soil0.500000
mineral fertilization0.500000
thyrow0.500000
albic luvisol0.500000
ph 6.40.500000
lettuce0.500000
organic fertilization0.500000
therwil0.500000
ph 6.60.500000
bio-dynamic fertilizer0.500000
LOWER IN organic fertilization0.500000
LOWER IN bio-dynamic fertilizer0.500000
crop rotation0.500000
mouldboard plough0.500000
loess chernozem0.500000
bernburg0.500000
cultivator tillage0.500000
maize pre-crop0.500000
LOWER IN mouldboard plough0.500000
rapeseed pre-crop0.500000
chromic cambisol0.500000
bretagne region0.500000
flood plain0.500000
Fraction of annotations for the query sequences containing the term
TermScore
soil0.771739
agricultural field0.255435
china0.206522
canada0.195652
grand river watershed0.184783
province of ontario0.184783
cambridge0.184783
rare charitable research reserve0.184783
depth (soil) 0-20cm0.141304
united states of america0.130435
auburn0.119565
alabama0.119565
ultisol0.119565
luvisol0.119565
quercus velutina0.097826
quercus alba0.097826
quercus rubra0.097826
acer saccharum0.097826
acer saccharum subsp. nigrum0.097826
fagus grandifolia0.097826
forest0.097826
forested area0.097826
rhizosphere0.092391
dekalb county0.092391
illinois0.092391
state of illinois0.092391
depth 15-30cm0.070652
kingdom of denmark0.065217
germany0.065217
upland soil0.065217
mature forest0.065217
brunisol0.065217
bulk soil0.059783
depth 30-45cm0.059783
dipsacus fullonum0.059783
solidago0.059783
apocynum0.059783
daucus carota0.059783
decomissioned agricultural field0.059783
meadow ecosystem0.059783
triticum aestivum0.054348
pot expreiment0.054348
silt loam0.054348
foot slope 0.054348
mollisol0.048913
depth (soil) 0-10cm0.043478
fertilized soil0.043478
maize field0.043478
lettuce0.043478
loam soil0.043478
late weichselian glaciation0.043478
clayey till0.043478
lund0.043478
sandy loam0.043478
sandy loam soil0.043478
hapludalf0.043478
alfisol0.043478
depth 0-15cm0.043478
farm0.038043
switzerland0.038043
zea mays0.038043
flood plain0.038043
state of california0.038043
sacramento0.038043
cosumnes river preserve0.038043
ph 4-50.038043
topsoil0.032609
ph 7-80.032609
ph 80.032609
ph 7.60.032609
depth (soil) 0-30 cm0.032609
old growth forest0.032609
luancheng county0.032609
marsh0.032609
sugarcane0.027174
saccharum0.027174
guangzhou city prefecture0.027174
park0.027174
united kingdom0.027174
oak0.027174
quercus0.027174
thyrow0.027174
haplic luvisol0.027174
crop rotation0.027174
bernburg0.027174
mangrove0.027174
surface water0.027174
preston flats0.027174
calcic chernozem0.027174
czech republic0.027174
south moravian region0.027174
colluvial soil0.027174
cinnamomum camphora0.027174
anxi county0.027174
wheat0.021739
ph 70.021739
kaiyang county0.021739
guizhou province0.021739
israel0.021739
mineral fertilization0.021739
Exp. ID User ID Description Date Region Flag Sequences
616amnondominant in topsoil of PK/NP/NPK/NK fertilized sugarcane field (dominant depth (soil) 0-20cm, fertilized soil, ph 5.5-6, sugarcane, saccharum, soil, topsoil, china, guangzhou city prefecture)2020-04-27v3No1 / 2
842sheryoDominant in soil depth of 0-15cm in a mature forest in Ontario, Canada (dominant depth 0-15cm, luvisol, mature forest, grand river watershed, rare charitable research reserve, quercus velutina, quercus alba, quercus rubra, acer saccharum, acer saccharum subsp. nigrum, fagus grandifolia, cambridge, forest, forested area, province of ontario, canada, soil)2021-11-14v3No1 / 3
827sheryoDominant in soil at 95cm depth in clayey till loam soil, Lund Denmark (dominant sandy till , depth 70-120cm, loam soil, late weichselian glaciation, clayey till, agricultural field, kingdom of denmark, lund)2021-08-24v3No1 / 4
823sheryoDominant at 0-15cm depth in foot slope ultisol soil in auburn, alabama (dominant foot slope , depth (soil) 0-15cm, alabama, auburn, ultisol, agricultural field, soil)2021-08-08v3No1 / 5
842sheryoDominant in soil depth of 0-15cm in an old growth forest in Ontario, Canada (dominant depth 0-15cm, old growth forest, luvisol, grand river watershed, rare charitable research reserve, quercus velutina, quercus alba, quercus rubra, acer saccharum, acer saccharum subsp. nigrum, fagus grandifolia, cambridge, forest, forested area, province of ontario, canada, soil)2021-11-14v3No1 / 5
616amnondominant in topsoil of non-fertilized sugarcane field (dominant depth (soil) 0-20cm, ph 6.7, sugarcane, saccharum, soil, topsoil, china, guangzhou city prefecture, non-fertilized soil)2020-04-27v3No1 / 6
698amnondominant depth (soil) 0-30 cm, depth (soil) 0-20cm, control, ph 6-7, park, united kingdom, oak, quercus, rhizosphere2028-04-01v3No1 / 6
754sheryoDominant in soil planted with cucmber, fertilized with bioorganic fertilizer (Bacillus amyloliquefaciens SQR 9) and infected with Fusarium oxysporum f. sp. cucumerinum (dominant bacillus amyloliquefaciens sqr9, zhejiang province, cucumber, fusarium oxysporum, bio-organic fertilizer, soil, china)2021-03-15v3No1 / 6
842sheryoDominant in soil depth of 0-15cm in a mature forest in Ontario, Canada (dominant forest, fagus grandifolia, acer saccharum subsp. nigrum, acer saccharum, quercus velutina, quercus alba, quercus rubra, mature forest, forested area, brunisol, soil, grand river watershed, canada, province of ontario, cambridge, rare charitable research reserve)2021-11-14v3No1 / 6
842sheryoDominant in soil depth of 15-30cm in a mature forest in Ontario, Canada (dominant depth 15-30cm, luvisol, mature forest, grand river watershed, rare charitable research reserve, quercus velutina, quercus alba, quercus rubra, acer saccharum, acer saccharum subsp. nigrum, fagus grandifolia, cambridge, forest, forested area, province of ontario, canada, soil)2021-11-14v3No1 / 6
842sheryoDominant in soil depth of 0-15cm in a Decomissioned Agricultural Field in Ontario, Canada (dominant depth 0-15cm, dipsacus fullonum, solidago, apocynum, daucus carota, brunisol, decomissioned agricultural field, meadow ecosystem, grand river watershed, rare charitable research reserve, cambridge, province of ontario, canada, soil)2021-11-14v3No1 / 6
933amnondominant quaternary laterite soil, pumpkin, cucurbita moschata, china, ph 5.5, guangxi zhuang autonomous region, rhizosphere, research facility2022-09-11v3No1 / 6
823sheryoDominant at 15-30cm depth in foot slope ultisol soil in auburn, alabama (dominant depth (soil) 15-30cm, foot slope , alabama, auburn, ultisol, agricultural field, soil)2021-08-08v3No1 / 7
829sheryoDominant in soil depth of 12-44m in Alfisol soil, Dekalb, Illinois, united states of america (dominant depth 12-44cm, sandy loam, sandy loam soil, hapludalf, alfisol, united states of america, soil, state of illinois, illinois, dekalb county)2021-08-26v3No1 / 7
842sheryoDominant in soil depth of 30-45cm in a mature forest in Ontario, Canada (dominant depth 30-45cm, mature forest, brunisol, grand river watershed, rare charitable research reserve, quercus velutina, quercus alba, quercus rubra, acer saccharum, acer saccharum subsp. nigrum, fagus grandifolia, cambridge, forest, forested area, province of ontario, canada, soil)2021-11-14v3No1 / 7
842sheryoDominant in soil depth of 30-45cm in a mature forest in Ontario, Canada (dominant depth 30-45cm, luvisol, mature forest, grand river watershed, rare charitable research reserve, quercus velutina, quercus alba, quercus rubra, acer saccharum, acer saccharum subsp. nigrum, fagus grandifolia, cambridge, forest, forested area, province of ontario, canada, soil)2021-11-14v3No1 / 7
842sheryoDominant in soil depth of 30-45cm in an old growth forest in Ontario, Canada (dominant depth 30-45cm, old growth forest, luvisol, grand river watershed, rare charitable research reserve, quercus velutina, quercus alba, quercus rubra, acer saccharum, acer saccharum subsp. nigrum, fagus grandifolia, cambridge, forest, forested area, province of ontario, canada, soil)2021-11-14v3No1 / 7
842sheryoDominant in soil depth of 15-30cm in a Decomissioned Agricultural Field in Ontario, Canada (dominant depth 15-30cm, dipsacus fullonum, solidago, apocynum, daucus carota, brunisol, decomissioned agricultural field, meadow ecosystem, grand river watershed, rare charitable research reserve, cambridge, province of ontario, canada, soil)2021-11-14v3No1 / 7
842sheryoDominant in soil depth of 30-45cm in a Decomissioned Agricultural Field in Ontario, Canada (dominant depth 30-45cm, dipsacus fullonum, solidago, apocynum, daucus carota, brunisol, decomissioned agricultural field, meadow ecosystem, grand river watershed, rare charitable research reserve, cambridge, province of ontario, canada, soil)2021-11-14v3No1 / 7
829sheryoDominanmt in soil depth of 108-140cm in Alfisol soil, Dekalb, Illinois, united states of america (dominant depth 108-140cm, sandy loam, sandy loam soil, hapludalf, alfisol, united states of america, soil, state of illinois, illinois, dekalb county)2021-08-26v3No1 / 8
842sheryoDominant in soil depth of 15-30cm in an old growth forest in Ontario, Canada (dominant depth 15-30cm, old growth forest, luvisol, grand river watershed, rare charitable research reserve, quercus velutina, quercus alba, quercus rubra, acer saccharum, acer saccharum subsp. nigrum, fagus grandifolia, cambridge, forest, forested area, province of ontario, canada, soil)2021-11-14v3No1 / 8
964amnondominant volcan sumaco, ecuador, depth (soil) 10-25cm, soil, ph 4-5, stratovolcano2022-12-21v3No1 / 8
698amnondominant depth (soil) 0-30 cm, depth (soil) 0-20cm, ph 5-6, disease, plant disease, acute oak decline, park, united kingdom, oak, quercus, rhizosphere2028-04-01v3No1 / 9
823sheryoDominant at 0-10cm depth in ultisol soil in auburn, alabama (dominant depth (soil) 0-10cm, auburn, alabama, upland soil, agricultural field, ultisol, soil)2021-08-07v3No1 / 9
842sheryoDominant in soil depth of 15-30cm in a mature forest in Ontario, Canada (dominant depth 15-30cm, forest, fagus grandifolia, acer saccharum subsp. nigrum, acer saccharum, quercus velutina, quercus alba, quercus rubra, mature forest, forested area, brunisol, soil, grand river watershed, canada, province of ontario, cambridge, rare charitable research reserve)2021-11-14v3No1 / 9
823sheryoDominant at 30-50cm depth in foot slope ultisol soil in auburn, alabama (dominant depth 30-50cm, foot slope , alabama, auburn, ultisol, agricultural field, soil)2021-08-08v3No1 / 10
829sheryoDominant in soil depth of 0-27cm in Mollisol soil, Dekalb, Illinois, united states of america (dominant depth 0-27cm, dekalb county, illinois, state of illinois, mollisol, silt loam, soil, united states of america)2021-08-26v3No1 / 10
829sheryoDominant in soil depth of 116-140cm in Mollisol soil, Dekalb, Illinois, united states of america (dominant depth 116-140cm, dekalb county, illinois, state of illinois, mollisol, silt loam, soil, united states of america)2021-08-26v3No1 / 10
989amnondominant soil, china, farm, ph 4-5, anxi county, cinnamomum camphora, depth (soil) 0-20cm2022-12-26v3No1 / 10
823sheryoDominant at 10-25cm depth in ultisol soil in auburn, alabama (dominant depth (soil) 10-25cm, alabama, auburn, upland soil, ultisol, agricultural field, soil)2021-08-07v3No1 / 11
829sheryoDominant in soil depth of 27-56cm in Mollisol soil, Dekalb, Illinois, united states of america (dominant depth 27-56cm, dekalb county, illinois, state of illinois, mollisol, silt loam, soil, united states of america)2021-08-26v3No1 / 11
829sheryoDominant in soil depth of 44-108cm in Alfisol soil, Dekalb, Illinois, united states of america (dominant depth 44-108cm, sandy loam, sandy loam soil, hapludalf, alfisol, united states of america, soil, state of illinois, illinois, dekalb county)2021-08-26v3No1 / 11
989amnondominant china, farm, ph 4-5, anxi county, cinnamomum camphora, depth (soil) 0-20cm, rhizosphere2022-12-26v3No1 / 11
842sheryoDominant in soil depth of 30-45cm in a zea mays agricultural field in Ontario, Canada (dominant depth 30-45cm, zea mays, preston flats, agricultural field, soil, luvisol, grand river watershed, canada, province of ontario, cambridge, rare charitable research reserve)2021-11-14v3No1 / 12
823sheryoDominant at 50-90cm depth in foot slope ultisol soil in auburn, alabama (dominant depth 50-90cm, foot slope , alabama, auburn, ultisol, agricultural field, soil)2021-08-08v3No1 / 17
829sheryoDominant in soil depth of 56-116cm in Mollisol soil, Dekalb, Illinois, united states of america (dominant depth 56-116cm, dekalb county, illinois, state of illinois, mollisol, silt loam, soil, united states of america)2021-08-26v3No1 / 17
823sheryoDopminant at 25-50cm depth in ultisol soil in auburn, alabama (dominant depth (soil) 25-50cm, alabama, auburn, upland soil, ultisol, agricultural field, soil)2021-08-07v3No1 / 18
823sheryoDominant at 90-100cm depth in foot slope ultisol soil in auburn, alabama (dominant depth 90-100cm, foot slope , alabama, auburn, ultisol, agricultural field, soil)2021-08-08v3No1 / 18
823sheryoDominant at 50-70cm depth in ultisol soil in auburn, alabama (dominant depth 50-70cm, alabama, auburn, upland soil, ultisol, agricultural field, soil)2021-08-07v3No1 / 20
823sheryoDominant at 70-100cm depth in ultisol soil in auburn, alabama (dominant depth 70-100cm, alabama, auburn, upland soil, ultisol, agricultural field, soil)2021-08-07v3No1 / 23
764sheryoHigh in conservation tillage compared to conventional tillage in leoss soil in wheat field grown under crop rotation with maize pre-crop in germany ( high in cultivator tillage conservation tillage compared to mouldboard plough conventional tillage in maize pre-crop ph 7.6 crop rotation triticum aestivum soil germany bernburg )2021-04-12v3No1 / 56
989amnon high in low nutrient availability uphill compared to high nutrient availability downhill in depth (soil) 0-20cm cinnamomum camphora anxi county ph 4-5 farm china soil 2022-12-26v3No1 / 96
823sheryoHigher in 50-70cm depth compared to 70-100cm depth in ultisol soil in auburn, alabama ( high in depth 50-70cm compared to depth 70-100cm in alabama auburn upland soil ultisol agricultural field soil )2021-08-08v3No1 / 127
823sheryoHigher in 25-50cm depth compared to 50-70cm depth in ultisol soil in auburn, alabama ( high in depth (soil) 25-50cm compared to depth 50-70cm in alabama auburn upland soil ultisol agricultural field soil )2021-08-07v3No1 / 161
842sheryoCommon in soil depth of 15-30cm in a mature forest in Ontario, Canada (common depth 15-30cm, forest, fagus grandifolia, acer saccharum subsp. nigrum, acer saccharum, quercus velutina, quercus alba, quercus rubra, mature forest, forested area, brunisol, soil, grand river watershed, canada, province of ontario, cambridge, rare charitable research reserve)2021-11-14v3No1 / 182
565amnoncommon skin, canada, ammotragus lervia, barbary sheep, zoological garden, captive, african lion safari2019-11-21v3No1 / 205
786sheryoHigher at 166-200cm depth compared to 400-700cm depth in flood plain soil near cosumnes river, california ( high in depth 166-200cm compared to depth 400-700cm in flood plain soil united states of america state of california sacramento cosumnes river preserve )2021-09-13v3No1 / 206
842sheryoCommon in soil depth of 30-45cm in a mature forest in Ontario, Canada (common depth 30-45cm, mature forest, brunisol, grand river watershed, rare charitable research reserve, quercus velutina, quercus alba, quercus rubra, acer saccharum, acer saccharum subsp. nigrum, fagus grandifolia, cambridge, forest, forested area, province of ontario, canada, soil)2021-11-14v3No1 / 227
583amnoncommon soil, mountain, switzerland, ph 4-6, depth (soil) 0-10cm, elevation 2000-3000m, siliceous parent material, rhone river valley2020-01-27v3No1 / 234
855sheryoCommon in soil depth of 350cm in fertilized soil in china (common depth 350cm, luancheng county, china, agricultural field, fertilized soil, soil)2021-12-27v3No1 / 242
842sheryoHigher in soil depth of 15-30cm compared to soil depth of 30-45cm in a Decomissioned Agricultural Field in Ontario, Canada ( high in depth 15-30cm compared to depth 30-45cm in luvisol dipsacus fullonum solidago apocynum daucus carota decomissioned agricultural field meadow ecosystem grand river watershed rare charitable research reserve cambridge province of ontario canada soil )2021-11-14v3No1 / 253
996amnoncommon in river water without anthropogenic effect (common river water, china, upstream, fuzhou city prefecture, xiyuan river, fresh water, surface water, river)2022-12-28v3No1 / 254
842sheryoCommon in soil depth of 0-15cm in a mature forest in Ontario, Canada (common mature forest, brunisol, grand river watershed, rare charitable research reserve, quercus velutina, quercus alba, quercus rubra, acer saccharum, acer saccharum subsp. nigrum, fagus grandifolia, cambridge, forest, forested area, province of ontario, canada, soil)2021-11-14v3No1 / 261
761sheryoHigher in bulk soil compared to maize rhizosphere in sandy soil maize field in Germany ( high in bulk soil compared to rhizosphere in ph 5 lower saxony sandy soil germany maize field )2021-04-06v3No1 / 294
827sheryoHigher in soil depth of 60cm compared to soil depth of 275cm in clayey till loam soil, Lund Denmark ( high in depth 20-120cm compared to depth 200-350cm in lund kingdom of denmark agricultural field clayey till late weichselian glaciation loam soil )2021-09-13v3No1 / 295
1009amnoncommon baltic salmon, wild, lithuania, salmo salar, intestinal contents, intestine, fish2023-01-29v3No1 / 297
807amnonhigher during typhoon with red soil pollution compared to normal weather ( high in storm typhoon compared to normal weather in autumn near shore japan filtered 0.2um surface water okinawa islands sea water )2021-06-20v3No1 / 318
827sheryoCommon in soil at 575cm depth in clayey till loam soil, Lund Denmark (common depth 550-600cm, lund, kingdom of denmark, agricultural field, clayey till, late weichselian glaciation, loam soil)2021-09-13v3No1 / 318
565amnoncommon skin, canada, equus asinus africanus, donkey, farm2019-11-21v3No1 / 335
762sheryoHigher in bulk soil of a pot experiment with lettuce planted in npk fertilized compared to organic fertilized haplic luvisol Switzerland ( high in npk fertilization mineral fertilization compared to organic fertilization bio-dynamic fertilizer manure fertilization manured soil in therwil switzerland haplic luvisol soil bulk soil lettuce pot expreiment )2021-04-07v3No1 / 347
762sheryoCommon in rhizosphere soil of a pot experiment with lettuce planted in npk fertilized albic luvisol Germany (common pot expreiment, lettuce, soil, rhizosphere, germany, thyrow, albic luvisol, mineral fertilization, npk fertilization)2021-04-08v3No1 / 353
583amnoncommon soil, mountain, switzerland, depth (soil) 0-10cm, elevation 2000-3000m, siliceous parent material, ph 4.5-7, canton of graubunden2020-01-27v3No1 / 359
842sheryoCommon in soil depth of 30-45cm in an old growth forest in Ontario, Canada (common depth 30-45cm, old growth forest, luvisol, grand river watershed, rare charitable research reserve, quercus velutina, quercus alba, quercus rubra, acer saccharum, acer saccharum subsp. nigrum, fagus grandifolia, cambridge, forest, forested area, province of ontario, canada, soil)2021-11-14v3No1 / 390
842sheryoCommon in soil depth of 30-45cm in a mature forest in Ontario, Canada (common depth 30-45cm, luvisol, mature forest, grand river watershed, rare charitable research reserve, quercus velutina, quercus alba, quercus rubra, acer saccharum, acer saccharum subsp. nigrum, fagus grandifolia, cambridge, forest, forested area, province of ontario, canada, soil)2021-11-14v3No1 / 393
662amnoncommon clay soil, irrigated, neve yaar, depth (soil) 0-10cm, soil, agricultural field, israel2020-09-21v3No1 / 402
855sheryoHigher in soil depth of 350cm compared to soil depth of 800cm in fertilized soil in china ( high in depth 350cm compared to depth 800cm in luancheng county china agricultural field fertilized soil soil )2021-12-27v3No1 / 418
842sheryoCommon in soil depth of 15-30cm in a mature forest in Ontario, Canada (common depth 15-30cm, luvisol, mature forest, grand river watershed, rare charitable research reserve, quercus velutina, quercus alba, quercus rubra, acer saccharum, acer saccharum subsp. nigrum, fagus grandifolia, cambridge, forest, forested area, province of ontario, canada, soil)2021-11-14v3No1 / 433
577amnon high in hypersaline water high salinity depth (water) 4-9m monimolimnion compared to depth (water) 20-100cm depth (water) 1-5m depth (water) 0-3m mixolimnion low salinity in lake romania ursu lake water lake water 2020-01-09v3No1 / 439
823sheryoCommon at 70-100cm depth in ultisol soil in auburn, alabama (common depth 70-100cm, alabama, auburn, upland soil, ultisol, agricultural field, soil)2021-08-07v3No1 / 459
842sheryoCommon in soil depth of 0-15cm in a mature forest in Ontario, Canada (common depth 0-15cm, luvisol, mature forest, grand river watershed, rare charitable research reserve, quercus velutina, quercus alba, quercus rubra, acer saccharum, acer saccharum subsp. nigrum, fagus grandifolia, cambridge, forest, forested area, province of ontario, canada, soil)2021-11-14v3No1 / 460
964amnoncommon stratovolcano, ph 4-5, soil, depth (soil) 10-25cm, ecuador, volcan sumaco2022-12-21v3No1 / 472
662amnoncommon water, wastewater treatment plant, treated wastewater, israel2020-09-20v3No1 / 473
989amnoncommon rhizosphere, depth (soil) 0-20cm, cinnamomum camphora, anxi county, ph 4-5, farm, china2022-12-26v3No1 / 476
829sheryoCommon in soil depth of 56-116cm in Mollisol soil, Dekalb, Illinois, united states of america (common depth 56-116cm, dekalb county, illinois, state of illinois, mollisol, silt loam, soil, united states of america)2021-08-26v3No1 / 491
616amnon high in ph 6.7 non-fertilized soil compared to ph 5.5-6 fertilized soil in depth (soil) 0-20cm sugarcane saccharum soil topsoil china guangzhou city prefecture 2020-04-27v3No1 / 504
942amnoncommon banana, rhizosphere, nanning city prefecture, china, musa acuminata2022-11-25v3No1 / 505
842sheryoCommon in soil depth of 15-30cm in an old growth forest in Ontario, Canada (common depth 15-30cm, old growth forest, luvisol, grand river watershed, rare charitable research reserve, quercus velutina, quercus alba, quercus rubra, acer saccharum, acer saccharum subsp. nigrum, fagus grandifolia, cambridge, forest, forested area, province of ontario, canada, soil)2021-11-14v3No1 / 507
798amnoncommon depth (soil) 10 cm, depth (soil) 0-20cm, hay, plant litter, litter bag, orchard, apricot, prunus armeniaca, apennine mountains, italy2021-06-13v3No1 / 508
829sheryoCommon in soil depth of 116-140cm in Mollisol soil, Dekalb, Illinois, united states of america (common depth 116-140cm, dekalb county, illinois, state of illinois, mollisol, silt loam, soil, united states of america)2021-08-26v3No1 / 516
762sheryocommin in bulk soil of a pot experiment with lettuce planted in npk fertilzed albic luvisol from Germany (common mineral fertilization, npk fertilization, germany, soil, bulk soil, thyrow, albic luvisol, ph 6.4, lettuce, pot expreiment)2021-04-07v3No1 / 531
603amnoncommon in baijiu fermentation pit mud in first 2 batches (common mud, fermentation pit mud, baijiu, china, hefei city prefecture, days 0-90)2020-04-05v3No1 / 542
662amnon high in treated wastewater wastewater treatment plant compared to drinking water tap water in water israel 2020-09-20v3No1 / 565
548amnoncommon minas gerais state, campos rupestres, brazil, barbacenia macrantha, root endosphere, root2019-08-17v4No1 / 575
696amnon high in georissa georissa similis compared to plectostoma concinnum opisthostoma concinnum in land snail stomach gastrointestinal system malaysia state of sabah 2028-03-28v3No1 / 576
762sheryoHigh in bulk soil comparedc to rhizosphere of a pot experiment with lettuce planted in haplic luvisol Switzerland ( high in bulk soil compared to rhizosphere in thyrow switzerland haplic luvisol pot expreiment lettuce soil )2021-04-08v3No1 / 577
762sheryoHigh in bulk soil compared to rhizosphere of a pot experiment with lettuce planted in albic luvisol Germany ( high in bulk soil compared to rhizosphere in thyrow albic luvisol germany haplic luvisol pot expreiment lettuce soil )2021-04-08v3No1 / 578
842sheryoHigher in soil depth 15-30cm compared soil depth of 0-15cm to in a zea mays agricultural field in Ontario, Canada ( high in depth 15-30cm compared to depth 0-15cm in zea mays preston flats agricultural field soil luvisol grand river watershed canada province of ontario cambridge rare charitable research reserve )2021-11-14v3No1 / 598
762sheryoCommon in bulk soil of a pot experiment with lettuce planted in organic fertilized haplic luvisol Switzerland (common ph 6.6, manured soil, manure fertilization, organic fertilization, bio-dynamic fertilizer, therwil, switzerland, haplic luvisol, soil, bulk soil, lettuce, pot expreiment)2021-04-07v3No1 / 602
662amnoncommon loamy sand soil, irrigated, neve yaar, depth (soil) 0-10cm, soil, agricultural field, israel2020-09-22v3No1 / 609
357amnoncommon soil, topsoil, depth (soil) 0-10cm, savanna, forest ecosystem, woodland area2018-08-19v4No1 / 614
823sheryoCommon at 50-70cm depth in ultisol soil in auburn, alabama (common depth 50-70cm, alabama, auburn, upland soil, ultisol, agricultural field, soil)2021-08-07v3No1 / 620
698amnoncommon depth (soil) 0-30 cm, depth (soil) 0-20cm, ph 4-4.5, park, london, united kingdom, oak, quercus, rhizosphere2028-04-01v3No1 / 623
829sheryoHigher in soil depth of 0-56cm compared to soil depth of 56-140cm in Mollisol soil, Dekalb, Illinois, united states of america ( high in depth 0-56 compared to depth 56-140 in united states of america soil silt loam mollisol state of illinois illinois dekalb county )2021-08-26v3No1 / 631
827sheryoCommon in soil at 230cm depth in clayey till loam soil, Lund Denmark (common depth 200-260cm, loam soil, late weichselian glaciation, clayey till, agricultural field, kingdom of denmark, lund)2021-08-24v3No1 / 644
762sheryoCommon in bulk soil of a pot experiment with lettuce planted in npk fertilized haplic luvisol Switzerland (common npk fertilization, mineral fertilization, ph 5.6, therwil, switzerland, haplic luvisol, soil, bulk soil, lettuce, pot expreiment)2021-04-07v3No1 / 648
548amnoncommon minas gerais state, campos rupestres, brazil, barbacenia macrantha, rhizosphere2019-08-17v4No1 / 651
823sheryoCommon at 25-50cm depth in ultisol soil in auburn, alabama (common depth (soil) 25-50cm, alabama, auburn, upland soil, ultisol, agricultural field, soil)2021-08-07v3No1 / 652
793amnoncommon depth (soil) 0-20cm, ceriops tagal, kenya, rhizosphere, mangrove biome, mangrove2021-06-08v3No1 / 662
842sheryoCommon in soil depth of 30-45cm in a zea mays agricultural field in Ontario, Canada (common depth 30-45cm, zea mays, preston flats, agricultural field, soil, luvisol, grand river watershed, canada, province of ontario, cambridge, rare charitable research reserve)2021-11-14v3No1 / 676
829sheryohigher soil depth of 12-44cm compared to 0-12cm in Alfisol soil, Dekalb, Illinois, united states of america ( high in depth 12-44cm compared to depth 0-12cm in sandy loam sandy loam soil hapludalf alfisol united states of america soil state of illinois illinois dekalb county )2021-08-26v3No1 / 692
754sheryoCommon in soil planted with cucmber, fertilized with bioorganic fertilizer (Bacillus amyloliquefaciens SQR 9) and infected with Fusarium oxysporum f. sp. cucumerinum (common bacillus amyloliquefaciens sqr9, zhejiang province, cucumber, fusarium oxysporum, bio-organic fertilizer, soil, china)2021-03-15v3No1 / 701
762sheryoCommon in bulk soil of a pot experiment with lettuce planted in organic fertilized albic luvisol from Germany (common manured soil, manure fertilization, germany, organic fertilization, soil, bulk soil, thyrow, albic luvisol, ph 6.4, lettuce, pot expreiment)2021-04-07v3No1 / 704
829sheryoCommon in soil depth of 12-44m in Alfisol soil, Dekalb, Illinois, united states of america (common depth 12-44cm, sandy loam, sandy loam soil, hapludalf, alfisol, united states of america, soil, state of illinois, illinois, dekalb county)2021-08-26v3No1 / 721
752sheryoCommon in soil planted with Panax notoginseng (common panax notoginseng, sanqi plants, ph 6, xundian county, yunnan province, china, pot expreiment, soil)2021-03-11v3No1 / 730
823sheryoCommon at 0-10cm depth in ultisol soil in auburn, alabama (common depth (soil) 0-10cm, auburn, alabama, upland soil, agricultural field, ultisol, soil)2021-08-07v3No1 / 730
823sheryoCommon at 10-25cm depth in ultisol soil in auburn, alabama (common depth (soil) 10-25cm, alabama, auburn, upland soil, ultisol, agricultural field, soil)2021-08-07v3No1 / 732
829sheryoCommon in soil depth of 0-12m in Alfisol soil, Dekalb, Illinois, united states of america (common depth 0-12cm, sandy loam, sandy loam soil, hapludalf, alfisol, united states of america, soil, state of illinois, illinois, dekalb county)2021-08-26v3No1 / 737
989amnoncommon depth (soil) 0-20cm, cinnamomum camphora, anxi county, ph 4-5, farm, china, soil2022-12-26v3No1 / 738
761sheryoCommon in maize rhizosphere sandy soil maize field in Germany (common zea mays, rhizosphere, ph 5, lower saxony, sandy soil, germany, maize field)2021-04-06v3No1 / 742
854sheryoCommon in soil depth of 275-325cm of colluvial soil, Czech rebuplic (common depth 275-325cm, calcic chernozem, colluvial soil, ph 8, south moravian region, czech republic, soil)2021-12-23v3No1 / 749
829sheryoCommon in soil depth of 44-108cm in Alfisol soil, Dekalb, Illinois, united states of america (common depth 44-108cm, sandy loam, sandy loam soil, hapludalf, alfisol, united states of america, soil, state of illinois, illinois, dekalb county)2021-08-26v3No1 / 751
823sheryoCommon at 30-50cm depth in foot slope ultisol soil in auburn, alabama (common depth 30-50cm, foot slope , alabama, auburn, ultisol, agricultural field, soil)2021-08-08v3No1 / 753
842sheryoCommoon in soil depth of 30-45cm in a Decomissioned Agricultural Field in Ontario, Canada (common depth 30-45cm, dipsacus fullonum, solidago, apocynum, daucus carota, brunisol, decomissioned agricultural field, meadow ecosystem, grand river watershed, rare charitable research reserve, cambridge, province of ontario, canada, soil)2021-11-14v3No1 / 768
823sheryoCommon at 90-100cm depth in foot slope ultisol soil in auburn, alabama (common depth 90-100cm, foot slope , alabama, auburn, ultisol, agricultural field, soil)2021-08-08v3No1 / 782
752sheryoCommon in soil planted with Panax notoginseng amended with2% biochar (common biochar, panax notoginseng, sanqi plants, ph 6, xundian county, yunnan province, china, pot expreiment, soil)2021-03-11v3No1 / 783
827sheryoCommon in soil at 465cm depth in clayey till loam soil, Lund Denmark (common depth 450-480cm, lund, kingdom of denmark, agricultural field, clayey till, late weichselian glaciation, loam soil)2021-09-13v3No1 / 786
829sheryoCommon in soil depth of 0-27cm in Mollisol soil, Dekalb, Illinois, united states of america (common depth 0-27cm, dekalb county, illinois, state of illinois, mollisol, silt loam, soil, united states of america)2021-08-26v3No1 / 798
823sheryoCommon at 50-90cm depth in foot slope ultisol soil in auburn, alabama (common depth 50-90cm, foot slope , alabama, auburn, ultisol, agricultural field, soil)2021-08-08v3No1 / 815
583amnoncommon soil, mountain, switzerland, depth (soil) 0-10cm, elevation 2000-3000m, canton of graubunden, calcareous parent material, ph 7-82020-01-28v3No1 / 830
842sheryoCommon in soil depth of 0-15cm in an old growth forest in Ontario, Canada (common depth 0-15cm, old growth forest, luvisol, grand river watershed, rare charitable research reserve, quercus velutina, quercus alba, quercus rubra, acer saccharum, acer saccharum subsp. nigrum, fagus grandifolia, cambridge, forest, forested area, province of ontario, canada, soil)2021-11-14v3No1 / 834
761sheryoCommon in bulk sandy soil maize field in Germany (common ph 5, lower saxony, sandy soil, germany, maize field, bulk soil)2021-04-06v3No1 / 835
698amnoncommon depth (soil) 0-30 cm, depth (soil) 0-20cm, ph 5-6, disease, plant disease, acute oak decline, park, united kingdom, oak, quercus, rhizosphere2028-04-01v3No1 / 848
827sheryoCommon in soil at 325cm depth in clayey till loam soil, Lund Denmark (common lund, kingdom of denmark, agricultural field, clayey till, late weichselian glaciation, loam soil, depth 300-350cm)2021-08-24v3No1 / 866
829sheryoCommon in soil depth of 108-140cm in Alfisol soil, Dekalb, Illinois, united states of america (common depth 108-140cm, sandy loam, sandy loam soil, hapludalf, alfisol, united states of america, soil, state of illinois, illinois, dekalb county)2021-08-26v3No1 / 871
855sheryoCommon in soil depth of 75cm in fertilized soil in china (common depth 75cm, luancheng county, china, agricultural field, fertilized soil, soil)2021-12-27v3No1 / 873
786sheryoCommon in flood plain soil near cosumnes river, california, at 60-100cm depth (common depth (soil) 60-100cm, cosumnes river preserve, sacramento, state of california, united states of america, soil, flood plain)2021-05-18v3No1 / 878
854sheryoCommon in soil depth of 75-100cm of colluvial soil, Czech rebuplic (common depth 75-100cm, calcic chernozem, colluvial soil, ph 8, south moravian region, czech republic, soil)2021-12-23v3No1 / 879
854sheryoCommon in soil depth of 200-250cm of colluvial soil, Czech rebuplic (common depth 200-250cm, calcic chernozem, colluvial soil, ph 8, south moravian region, czech republic, soil)2021-12-23v3No1 / 894
996amnon high in upstream compared to city anthropogenic environmental material downstream in river surface water fresh water xiyuan river fuzhou city prefecture china river water 2022-12-28v3No1 / 894
786sheryoCommon in flood plain soil near cosumnes river, california, at 133-166cm depth (common depth (soil) 133-166cm, cosumnes river preserve, sacramento, state of california, united states of america, soil, flood plain)2021-05-18v3No1 / 898
807amnoncommon tropical storm, summer, okinawa islands, japan, filtered 0.2um, near shore, sea water, surface water2021-06-20v3No1 / 905
842sheryoCommon in soil depth of 15-30cm in a Decomissioned Agricultural Field in Ontario, Canada (common depth 15-30cm, dipsacus fullonum, solidago, apocynum, daucus carota, brunisol, decomissioned agricultural field, meadow ecosystem, grand river watershed, rare charitable research reserve, cambridge, province of ontario, canada, soil)2021-11-14v3No1 / 905
854sheryoCommon in soil depth of 25-50cm of colluvial soil, Czech rebuplic (common ph 8, calcic chernozem, czech republic, south moravian region, colluvial soil, depth 25-50cm, soil)2021-12-23v3No1 / 905
829sheryoCommon in soil depth of 27-56cm in Mollisol soil, Dekalb, Illinois, united states of america (common depth 27-56cm, united states of america, soil, silt loam, mollisol, state of illinois, illinois, dekalb county)2021-08-26v3No1 / 906
548amnoncommon minas gerais state, campos rupestres, brazil, rock2019-08-17v4No1 / 924
786sheryoCommon in flood plain soil near cosumnes river, california, at 166-200cm depth (common depth (soil) 166-200cm, flood plain, soil, united states of america, state of california, sacramento, cosumnes river preserve)2021-05-18v3No1 / 936
842sheryoCommon in soil depth of 15-30cm in a zea mays agricultural field in Ontario, Canada (common depth 15-30cm, zea mays, preston flats, agricultural field, soil, luvisol, grand river watershed, canada, province of ontario, cambridge, rare charitable research reserve)2021-11-14v3No1 / 944
854sheryoCommon in soil depth of 125-175cm of colluvial soil, Czech rebuplic (common depth 125-175cm, calcic chernozem, colluvial soil, ph 8, south moravian region, czech republic, soil)2021-12-23v3No1 / 962
842sheryoCommon in soil depth of 30-45cm in a Decomissioned Agricultural Field in Ontario, Canada (common depth 30-45cm, luvisol, dipsacus fullonum, solidago, apocynum, daucus carota, decomissioned agricultural field, meadow ecosystem, grand river watershed, rare charitable research reserve, cambridge, province of ontario, canada, soil)2021-11-14v3No1 / 970
979amnon high in sediment depth 20-50cm compared to sediment depth 0-5cm in aldabra atoll seychelles sediment 2022-12-24v3No1 / 970
842sheryoCommon in soil depth of 15-30cm in a Decomissioned Agricultural Field in Ontario, Canada (common depth 15-30cm, luvisol, dipsacus fullonum, solidago, apocynum, daucus carota, decomissioned agricultural field, meadow ecosystem, grand river watershed, rare charitable research reserve, cambridge, province of ontario, canada, soil)2021-11-14v3No1 / 974
610sheryoCommon in agricultural field soil amended with straw (common straw, triticum aestivum, ph 7, wheat, kingdom of denmark, agricultural field, soil)2020-04-21v3No1 / 998
933amnoncommon guangxi zhuang autonomous region, ph 5.5, quaternary laterite soil, research facility, china, cucurbita moschata, pumpkin, rhizosphere2022-09-11v3No1 / 1002
610sheryoCommon in agricultural field soil amended with low biochar (common low biochar, triticum aestivum, ph 7, wheat, kingdom of denmark, agricultural field, soil)2020-04-21v3No1 / 1009
786sheryoCommon in flood plain soil near cosumnes river, california, at 100-133cm depth (common depth (soil) 100-133cm, cosumnes river preserve, sacramento, state of california, united states of america, soil, flood plain)2021-05-18v3No1 / 1015
768sheryoCommon in maize fields in Brittany, France (common zea mays, maize field, cambisol, bretagne region, french republic, soil)2021-04-18v3No1 / 1034
842sheryoHigher in soil depth of 15-30cm compared to soil depth of 0-15cm in a Decomissioned Agricultural Field in Ontario, Canada ( high in depth 15-30cm compared to depth 0-15cm in luvisol dipsacus fullonum solidago apocynum daucus carota decomissioned agricultural field meadow ecosystem grand river watershed rare charitable research reserve cambridge province of ontario canada soil )2021-11-14v3No1 / 1044
786sheryocommon in flood plain soil near cosumnes river, california, at 0-30cm depth (common depth (soil) 0-30 cm, depth (soil) 0-20cm, flood plain, soil, united states of america, state of california, sacramento, cosumnes river preserve)2021-05-18v3No1 / 1048
610sheryoCommon in agricultural field soil (common triticum aestivum, ph 7, wheat, kingdom of denmark, agricultural field, soil)2020-04-21v3No1 / 1053
610sheryoCommon in agricultural field soil amended with high biochar (common soil, agricultural field, kingdom of denmark, wheat, ph 7, high biochar, triticum aestivum)2020-04-21v3No1 / 1079
842sheryoCommon in soil depth of 0-15cm in a Decomissioned Agricultural Field in Ontario, Canada (common depth 0-15cm, dipsacus fullonum, solidago, apocynum, daucus carota, brunisol, decomissioned agricultural field, meadow ecosystem, grand river watershed, rare charitable research reserve, cambridge, province of ontario, canada, soil)2021-11-14v3No1 / 1082
765sheryocommon in wheat field in the loess plateau in china (common triticum aestivum, ph 7.7, loess plateau, silt loam, chromic cambisol, shanxi province, china, soil)2021-04-12v3No1 / 1087
917amnoncommon qiao nature reserve, depth (soil) 0-20cm, sonneratia apetala, china, marsh, mangrove, ph 7-8, soil2022-07-08v3No1 / 1107
827sheryoCommon in soil at 25cm depth in clayey till loam soil, Lund Denmark (common depth (soil) 20-30cm, plough layer , loam soil, late weichselian glaciation, clayey till, agricultural field, kingdom of denmark, lund)2021-08-24v3No1 / 1111
698amnoncommon depth (soil) 0-30 cm, depth (soil) 0-20cm, control, ph 6-7, park, united kingdom, oak, quercus, rhizosphere2028-04-01v3No1 / 1115
764sheryocommon in leoss soil in wheat field grown under crop rotation with rapeseed pre-crop in germany (common bernburg, germany, soil, triticum aestivum, crop rotation, ph 7.6, brassica napus, rapeseed pre-crop)2021-04-12v3No1 / 1129
764sheryoCommon in leoss soil in wheat field grown under conservation tillage and crop rotation in germany (common ph 7.6, crop rotation, cultivator tillage, conservation tillage, triticum aestivum, soil, germany, bernburg)2021-04-12v3No1 / 1140
827sheryoCommon in soil at 95cm depth in clayey till loam soil, Lund Denmark (common sandy till , depth 70-120cm, loam soil, late weichselian glaciation, clayey till, agricultural field, kingdom of denmark, lund)2021-08-24v3No1 / 1142
842sheryoCommon in soil depth of 0-15cm in a zea mays agricultural field in Ontario, Canada (common depth 0-15cm, zea mays, preston flats, agricultural field, soil, luvisol, grand river watershed, canada, province of ontario, cambridge, rare charitable research reserve)2021-11-14v3No1 / 1147
786sheryoCommon in flood plain soil near cosumnes river, california, at 30-60cm depth (common depth (soil) 30-60cm, cosumnes river preserve, sacramento, state of california, united states of america, soil, flood plain)2021-05-18v3No1 / 1180
807amnon high in tropical storm compared to normal weather in summer okinawa islands japan filtered 0.2um near shore sea water surface water 2021-06-20v3No1 / 1191
917amnoncommon ph 7-8, futian national nature reserve, depth (soil) 0-20cm, kandelia candel, china, marsh, mangrove, soil2022-07-08v3No1 / 1197
823sheryoCommon at 0-15cm depth in foot slope ultisol soil in auburn, alabama (common foot slope , depth (soil) 0-15cm, alabama, auburn, ultisol, agricultural field, soil)2021-08-08v3No1 / 1199
917amnoncommon qiao nature reserve, depth (soil) 0-20cm, china, mudflat, marsh, ph 7-8, soil, saline marsh2022-07-08v3No1 / 1211
764sheryoCommon in leoss soil in wheat field grown under conventional tillage and crop rotation in germany (common crop rotation, triticum aestivum, ph 7.6, mouldboard plough, conventional tillage, loess chernozem, bernburg, germany, soil)2021-04-12v3No1 / 1213
823sheryoCommon at 15-30cm depth in foot slope ultisol soil in auburn, alabama (common depth (soil) 15-30cm, foot slope , alabama, auburn, ultisol, agricultural field, soil)2021-08-08v3No1 / 1218
531amnoncommon rhizosphere, greenhouse soil, farm, orthic anthrosol, cucumis sativus, cucumber, china2019-07-21v3No1 / 1223
764sheryoCommon in leoss soil in wheat field grown under crop rotation with maize pre-crop in germany (common maize pre-crop, ph 7.6, crop rotation, triticum aestivum, soil, germany, bernburg)2021-04-12v3No1 / 1225
798amnoncommon depth (soil) 10 cm, depth (soil) 0-20cm, ph 7-8, soil, orchard, apricot, prunus armeniaca, apennine mountains, italy2021-06-13v3No1 / 1230
855sheryoCommon in soil depth of 10cm in fertilized soil in china (common luancheng county, china, depth (water) 10cm, fertilized soil, agricultural field, soil)2021-12-27v3No1 / 1253
616amnoncommon in topsoil of non-fertilized sugarcane field (common depth (soil) 0-20cm, ph 6.7, sugarcane, saccharum, soil, topsoil, china, guangzhou city prefecture, non-fertilized soil)2020-04-27v3No1 / 1277
842sheryoCommon in soil depth of 0-15cm in a Decomissioned Agricultural Field in Ontario, Canada (common depth 0-15cm, luvisol, dipsacus fullonum, solidago, apocynum, daucus carota, decomissioned agricultural field, meadow ecosystem, grand river watershed, rare charitable research reserve, cambridge, province of ontario, canada, soil)2021-11-14v3No1 / 1281
798amnon high in ph 7-8 soil compared to hay plant litter litter bag in depth (soil) 10 cm depth (soil) 0-20cm orchard apricot prunus armeniaca apennine mountains italy 2021-06-13v3No1 / 1285
917amnoncommon ph 6-6.5, futian national nature reserve, depth (soil) 0-20cm, china, mudflat, marsh, soil, saline marsh2022-07-08v3No1 / 1290
917amnoncommon ph 6-6.5, kandelia candel, depth (soil) 0-20cm, marsh, china, qiao nature reserve, mangrove, soil2022-07-08v3No1 / 1364
917amnoncommon ph 6-7, depth (soil) 0-20cm, futian national nature reserve, sonneratia apetala, china, marsh, mangrove, soil2022-07-08v3No1 / 1379
631sheryoCommon in maize field biochar amended rhizosphere soil (common ph 7.85, biochar, rhizosphere, china, guizhou province, kaiyang county, soil, maize field, after 6 years)2020-06-02v3No1 / 1492
855sheryoHigher in soil depth of 75cm compared to soil depth of 175cm in fertilized soil in china ( high in depth 75cm compared to depth 175cm in luancheng county china agricultural field fertilized soil soil )2021-12-27v3No1 / 1522
631sheryocommon in maize field unamended rhizosphere soil (common unamended soil, ph 7.6, rhizosphere, china, guizhou province, kaiyang county, soil, maize field, after 6 years)2020-06-02v3No1 / 1637
696amnon high in alycaeus jagori compared to opisthostoma concinnum plectostoma concinnum in land snail stomach gastrointestinal system malaysia state of sabah 2028-03-28v3No1 / 1672
855sheryoHigher in soil depth of 10cm compared to soil depth of 75cm in fertilized soil in china ( high in depth (water) 10cm compared to depth 75cm in luancheng county china agricultural field fertilized soil soil )2021-12-27v3No1 / 1678
616amnoncommon in topsoil of PK/NP/NPK/NK fertilized sugarcane field (common depth (soil) 0-20cm, fertilized soil, ph 5.5-6, sugarcane, saccharum, soil, topsoil, china, guangzhou city prefecture)2020-04-27v3No1 / 1710
631sheryoCommon in maize field unamended bulk soil (common bulk soil, unamended soil, ph 7.9, maize field, soil, kaiyang county, guizhou province, china)2020-06-02v3No1 / 1814
631sheryocommon in maize field biochar amended bulk soil, after 6 years of biochar amended (common ph 8, china, guizhou province, kaiyang county, soil, maize field, bulk soil, biochar, after 6 years)2020-06-02v3No1 / 1872

Problems / suggestions? Please email info AT dbbact DOT org