Search result for sequence:
TACGAAGGGGGCTAGCGTTGCTCGGAATCACTGGGCGTAAAGGGCGCGTAGGCGGACTCTTAAGTCGGGGGTGAAAGCCCAGGGCTCAACCCTGGAATTGCCTTCGATACTGAGAGTCTTGAGTTCGGAAGAGGTTGGTGGAACTGCGAG
common ontology terms
term enrichment score
TermScore
soil0.321070
rhizosphere0.315881
china0.233363
water0.178571
drinking water0.169014
united states of america0.159197
cultivated environment0.143646
depth 0-20cm0.140288
wheat0.114286
agricultural feature0.107784
citrus0.106825
river0.101925
tree0.101408
germany0.097130
new york0.095808
root0.086486
skin0.083430
fresh water0.082902
ph 60.082840
state of florida0.073684
ph 7-80.072508
glycine max0.071856
orchard0.071856
north china plain0.071856
triticum aestivum0.070588
research facility0.070559
winter0.067470
intestine0.067039
usa0.064865
coarse-loamy soil0.060606
populus0.060606
woodland area0.057971
depth 0-5cm0.057143
state of tennessee0.055556
farm0.052632
beagle dog0.049080
distribution system0.049080
LOWER IN water treatment plant0.049080
taxus0.049080
cambridgeshire0.049080
day 820.049080
soybean0.047904
newt0.047904
LOWER IN soil0.046784
topsoil0.043716
depth 0-10cm0.042781
city0.041885
united kingdom0.041885
forest ecosystem0.041885
site e0.037618
pasture0.037618
heilongjiang province0.037618
bronchoalveolar lavage0.037267
tomato0.037267
state of rhode island0.037267
pomacea canaliculata0.037267
golden apple snail0.037267
nanheng river0.037267
qingpu district0.037267
wastewater treatment plant0.037267
taxus cuspidata0.037267
spring water0.037267
temperate0.037267
difenoconazole0.037267
fungicide0.037267
tobacco field0.037267
limestone0.037267
merlot0.037267
grapevine0.037267
rock0.036923
site c0.036585
site a0.036585
mucus0.036585
northeast china0.036585
vitis vinifera0.036585
canis lupus familiaris0.036530
israel0.035714
solanum lycopersicum0.035294
biofilm0.034682
fish0.034384
leaf0.034286
adult0.034188
state of california0.032698
kingdom of spain0.030928
control0.027027
canada0.025316
root structure0.025157
southern united states0.025157
epilithic0.025157
kitchen0.025157
sink0.025157
rana pipiens0.025157
northern leopard frog0.025157
hong kong0.025157
koshi river0.025157
carnivorous beetle0.025157
poland0.025157
heavy metal0.025157
lissotriton vulgaris0.025157
triturus cristatus0.025157
Fraction of dbbact annotations with this term covered by the query
TermScore
agricultural feature0.750000
drinking water0.666667
site e0.666667
new york0.666667
canada0.666667
pasture0.666667
citrus0.666667
heilongjiang province0.666667
ph 7-80.571429
dracaena fragrans0.500000
epipremnum aureum0.500000
beagle dog0.500000
bronchoalveolar lavage0.500000
tap water0.500000
stagnant water0.500000
LOWER IN infectious bronchitis virus0.500000
LOWER IN bronchitis0.500000
glycine max0.500000
root structure0.500000
root nodule0.500000
tomato0.500000
blossom0.500000
southern united states0.500000
carphophis amoenus0.500000
worm snake0.500000
fossorial snake0.500000
distribution system0.500000
LOWER IN water treatment plant0.500000
cadmium0.500000
uganda0.500000
LOWER IN ceftriaxone0.500000
no ceftriaxone0.500000
pneumonia0.500000
epilithic0.500000
LOWER IN epipsammic0.500000
nicotiana galuca0.500000
kitchen0.500000
sink0.500000
LOWER IN bathroom0.500000
LOWER IN shower0.500000
LOWER IN tile0.500000
LOWER IN building wall0.500000
rana pipiens0.500000
northern leopard frog0.500000
cabbage0.500000
state of rhode island0.500000
aquatic snake0.500000
nerodia sipedon0.500000
northern water snake0.500000
LOWER IN chronic rhinosinusitis0.500000
LOWER IN sinusitis0.500000
procambarus clarkii0.500000
red swamp crayfish0.500000
turtle farm0.500000
pomacea canaliculata0.500000
golden apple snail0.500000
nanheng river0.500000
qingpu district0.500000
buccal mass0.500000
hong kong0.500000
low income0.500000
sewer0.500000
wastewater treatment plant0.500000
LOWER IN depth 10 cm0.500000
depth 60 cm0.500000
subway0.500000
koshi river0.500000
anaxyrus americanus0.500000
american toad0.500000
ginger0.500000
mine tailing0.500000
alkaline mine tailing0.500000
guangxi zhuang autonomous region0.500000
zone 10.500000
LOWER IN zone 2,30.500000
coarse-loamy soil0.500000
ph 60.500000
stover ammendment soil0.500000
day 120.500000
LOWER IN day 10.500000
food product type0.500000
alfalfa sprouts0.500000
medicago sativa0.500000
producer c20.500000
oropharynx0.500000
LOWER IN barn0.500000
LOWER IN hay0.500000
spring0.500000
taxus0.500000
taxus cuspidata0.500000
LOWER IN taxus media0.500000
bon portage island0.500000
oceanodroma leucorhoa0.500000
seabird0.500000
LOWER IN burrow0.500000
carnivorous beetle0.500000
poland0.500000
raba river0.500000
bembidion varicolor0.500000
LOWER IN meadow pea-vine0.500000
Fraction of annotations for the query sequences containing the term
TermScore
united states of america0.329032
soil0.309677
china0.283871
rhizosphere0.251613
water0.161290
drinking water0.096774
depth 0-20cm0.083871
cultivated environment0.083871
research facility0.077419
germany0.070968
wheat0.064516
skin0.058065
river0.058065
tree0.058065
citrus0.058065
agricultural feature0.058065
root0.051613
fresh water0.051613
new york0.051613
ph 60.045161
winter0.045161
state of florida0.045161
usa0.038710
glycine max0.038710
intestine0.038710
adult0.038710
orchard0.038710
ph 7-80.038710
triticum aestivum0.038710
north china plain0.038710
farm0.032258
depth 0-5cm0.032258
coarse-loamy soil0.032258
woodland area0.032258
state of tennessee0.032258
populus0.032258
canis lupus familiaris0.025806
beagle dog0.025806
control0.025806
soybean0.025806
distribution system0.025806
LOWER IN water treatment plant0.025806
LOWER IN soil0.025806
city0.025806
taxus0.025806
newt0.025806
cambridgeshire0.025806
united kingdom0.025806
topsoil0.025806
depth 0-10cm0.025806
forest ecosystem0.025806
day 820.025806
site c0.019355
leaf0.019355
bronchoalveolar lavage0.019355
site a0.019355
solanum lycopersicum0.019355
tomato0.019355
fish0.019355
site e0.019355
homo sapiens0.019355
kingdom of spain0.019355
biofilm0.019355
rock0.019355
israel0.019355
mucus0.019355
state of rhode island0.019355
pomacea canaliculata0.019355
golden apple snail0.019355
nanheng river0.019355
qingpu district0.019355
wastewater treatment plant0.019355
pasture0.019355
taxus cuspidata0.019355
spring water0.019355
northeast china0.019355
temperate0.019355
state of california0.019355
difenoconazole0.019355
fungicide0.019355
tobacco field0.019355
limestone0.019355
merlot0.019355
vitis vinifera0.019355
grapevine0.019355
heilongjiang province0.019355
root structure0.012903
digestive system0.012903
oreochromis niloticus0.012903
snake0.012903
southern united states0.012903
danio rerio0.012903
zebra fish0.012903
site d0.012903
sediment0.012903
epilithic0.012903
building0.012903
urban biome0.012903
kitchen0.012903
sink0.012903
Exp. ID User ID Description Date Region Flag Sequences
109amnondominant usa, water, drinking water, site c2017-04-08v4No1 / 12
361amnoncommon leaf, austria, greenhouse, plant, dracaena fragrans, epipremnum aureum2018-08-21v4No1 / 14
69amnondominant canis lupus familiaris, beagle dog, united states of america, research facility, bronchoalveolar lavage2017-02-21v4No1 / 15
341amnonlower in fresh drinking water compared to week old water ( high in stagnant water compared to fresh water in water drinking water united states of america tap water state of illinois )2018-05-28v4No1 / 15
604amnon high in control compared to infectious bronchitis virus bronchitis in chicken gallus gallus cecal content caecum china research facility 2020-04-06v3No1 / 16
109amnondominant usa, water, drinking water, site a2017-04-08v4No1 / 17
271amnoncommon depth 0-20cm, glycine max, soybean, root structure, root, root nodule, china2018-01-09v4No1 / 20
146amnoncommon united states of america, solanum lycopersicum, tomato, blossom, flower structure2017-04-20v4No1 / 26
267amnoncommon fish, digestive system, oreochromis niloticus, research facility, china2017-12-24v4No1 / 28
109amnoncommon water, drinking water, united states of america, site b2017-04-08v4No1 / 31
536amnoncommon snake, skin, united states of america, southern united states, carphophis amoenus, worm snake, fossorial snake2019-07-28v4No1 / 35
109amnon high in distribution system compared to water treatment plant in usa water drinking water site a 2017-04-08v4No1 / 41
112amnoncommon danio rerio, zebra fish, intestine, research facility, china2017-04-09v4No1 / 41
117amnoncommon zebra fish, danio rerio, research facility, larval stage, united states of america, intestine2017-04-10v4No1 / 41
267amnonhigher in gut of fish in water with cadmium contamination compared to control ( high in cadmium compared to control in fish digestive system oreochromis niloticus research facility china )2017-12-24v4No1 / 41
69amnoncommon canis lupus familiaris, beagle dog, united states of america, research facility, bronchoalveolar lavage2017-02-21v4No1 / 44
110amnoncommon water, drinking water, scotland, site e2017-04-08v4No1 / 44
109amnon high in distribution system compared to water treatment plant in water drinking water united states of america site d 2017-04-08v4No1 / 46
258amnonhigher lungs of hiv pneumonia patients not treated with ceftriaxone ( high in no ceftriaxone compared to ceftriaxone in homo sapiens hiv infection uganda bronchoalveolar lavage bronchial epithelium lung pneumonia )2017-11-27v4No1 / 47
109amnoncommon usa, water, drinking water, site a2017-04-08v4No1 / 54
252amnonlower on sand biofilm compared to rock biofilm in river ( high in rock epilithic compared to sand epipsammic in kingdom of spain biofilm river sediment )2017-11-22v4No1 / 56
56amnoncommon nicotiana galuca, flower, nectar, israel2017-01-30v4No1 / 57
199amnonlower in bathroom shower compared to kitchen sink ( high in kitchen sink compared to bathroom shower tile building wall in building urban biome united states of america )2017-10-01v4No1 / 61
109amnoncommon water, drinking water, united states of america, site d2017-04-08v4No1 / 67
69amnoncommon canis lupus familiaris, beagle dog, united states of america, research facility, nasal cavity, mucus2017-02-21v4No1 / 77
109amnoncommon water, drinking water, united states of america, site e2017-04-08v4No1 / 80
109amnon high in distribution system compared to water treatment plant in usa water drinking water site c 2017-04-08v4No1 / 81
114amnoncommon rana pipiens, northern leopard frog, research facility, digesta, intestine, state of wisconsin, united states of america, tadpole2017-04-10v4No1 / 84
311amnoncommon in salted cabbage (common cabbage, united states of america, state of rhode island, foodon product type)2018-04-09v4No1 / 85
109amnoncommon usa, water, drinking water, site c2017-04-08v4No1 / 86
114amnon high in tadpole compared to adult in rana pipiens northern leopard frog research facility digesta intestine state of wisconsin united states of america 2017-04-10v4No1 / 90
271amnon high in root structure root compared to soil rhizosphere in depth 0-20cm glycine max soybean china 2018-01-09v4No1 / 110
536amnoncommon snake, skin, united states of america, southern united states, aquatic snake, nerodia sipedon, northern water snake2019-07-28v4No1 / 111
567amnon high in control compared to chronic rhinosinusitis sinusitis in homo sapiens adult belgium nasopharynx 2019-12-05v4No1 / 114
581amnoncommon in red swamp crayfish grown in flooded rice field (common procambarus clarkii, red swamp crayfish, fish, intestine, adult, china, jiangsu province, rice field)2020-01-21v3No1 / 122
557amnoncommon lake, freshwater lake, fresh water, water, french republic, depth 10m2019-09-14v3No1 / 123
590amnoncommon in turtle pond water (common china, turtle farm, farm, hainan autonomous prefecture, pond water, water)2020-02-10v4No1 / 127
557amnoncommon lake, freshwater lake, fresh water, water, french republic, depth 40m2019-09-14v3No1 / 129
199amnoncommon in kitchen sink (common building, urban biome, united states of america, kitchen, sink)2017-10-01v4No1 / 130
585amnoncommon china, pomacea canaliculata, golden apple snail, nanheng river, qingpu district, buccal mass2020-02-02v3No1 / 136
109amnon high in distribution system compared to water treatment plant in water drinking water united states of america site e 2017-04-08v4No1 / 143
475amnoncommon in air next to subway stations in hong kong (common air, hong kong, city)2019-01-20v4No1 / 147
53amnonhigher in sewer and wastewater influent comapred to feces in low income south america ( high in sewer wastewater treatment plant compared to feces in south america city low income )2017-01-21v4No1 / 148
512amnon high in depth 60 cm compared to depth 10 cm in fen peatland peat soil soil china 2019-03-22v4No1 / 155
475amnoncommon in air in subway train in hong kong (common air, hong kong, city, subway)2019-01-20v4No1 / 161
534amnoncommon river, water, fresh water, depth 10 cm, koshi river, nepal, free floating, filtered 0.2um2019-07-22v4No1 / 172
99amnoncommon commonwealth of virginia, united states of america, skin, mucus, anaxyrus americanus, american toad2017-04-02v4No1 / 176
196amnoncommon water, drinking water, united states of america2017-09-12v4No1 / 178
311amnoncommon ginger, united states of america, state of rhode island, foodon product type2018-04-09v4No1 / 180
402amnon high in zone 1 compared to zone 2,3 in sediment soil mine tailing alkaline mine tailing guangxi zhuang autonomous region china 2018-11-18v4No1 / 189
585amnoncommon china, pomacea canaliculata, golden apple snail, nanheng river, qingpu district, stomach2020-02-02v3No1 / 194
600sheryoIncearses after 12 days of stover ammendment in soil ( high in day 12 compared to day 1 in soil depth 0-5cm united states of america new york coarse-loamy soil ph 6 stover ammendment soil )2020-03-27v4No1 / 196
587amnoncommon israel, food product type, alfalfa sprouts, medicago sativa, producer c22020-02-10v3No1 / 215
196amnonhigher in water compared to biofilm ( high in water compared to biofilm in drinking water united states of america )2017-09-12v4No1 / 223
585amnoncommon china, pomacea canaliculata, golden apple snail, nanheng river, qingpu district, intestine2020-02-02v3No1 / 240
69amnoncommon canis lupus familiaris, beagle dog, united states of america, research facility, oropharynx2017-02-21v4No1 / 241
384amnon high in pasture compared to barn hay in equus caballus horse canada farm saliva mouth 2018-10-22v4No1 / 245
160amnoncommon in river water upstream of WTP effluent in spring in china (common river, water, spring, china)2017-07-12v4No1 / 278
134amnon high in taxus cuspidata compared to taxus media in rhizosphere tree taxus china 2017-04-16v4No1 / 279
237amnonlower in burrow soil compared to bird ( high in oceanodroma leucorhoa bird seabird compared to soil burrow in canada bon portage island )2017-11-07v4No1 / 298
515amnoncommon carnivorous beetle, river, poland, raba river, whole body, beetle, bembidion varicolor2019-04-18v4No1 / 308
534amnoncommon river, water, fresh water, depth 10 cm, koshi river, nepal, particle bound, filtered 2.7um2019-07-22v4No1 / 315
309amnon high in other plants compared to meadow pea-vine lathyrus pratensis in rhizosphere germany 2018-04-05v4No1 / 316
311amnoncommon in floor of kimchi production facility (common united states of america, state of rhode island, floor, food processing factory)2018-04-09v4No1 / 324
175amnonhigher in winter compared to summer in heavy metal contaminated soils in china ( high in winter compared to summer in soil heavy metal china )2017-07-29v4No1 / 337
612amnoncommon state of florida, united states of america, spring water, water, fresh water, location 52020-04-22v4No1 / 383
28amnon high in feces achatinella mustelina compared to whole plant leaf in hawaii 2016-12-05v4No1 / 413
353amnoncommon in wild Lissotriton vulgaris newts skin (common newt, adult, skin, lissotriton vulgaris, cambridgeshire, united kingdom)2018-07-30v4No1 / 418
99amnoncommon commonwealth of virginia, united states of america, skin, mucus, pseudacris crucifer, peeper2017-04-02v4No1 / 438
53amnonlower in wastewater plant effluent compared to influent and sewer in south america ( high in sewage influent compared to effluent in south america wastewater treatment plant city )2017-01-21v4No1 / 440
353amnoncommon in wild Triturus cristatus newts skin (common newt, adult, skin, cambridgeshire, triturus cristatus, united kingdom)2018-07-30v4No1 / 456
415amnoncommon rhizosphere, soil, citrus, orchard, united states of america, cultivated environment2018-11-27v4No1 / 494
603amnoncommon in baijiu fermentation pit mud in first 2 batches (common mud, fermentation pit mud, baijiu, china, hefei city prefecture, days 0-90)2020-04-05v3No1 / 542
98amnoncommon citrus, rhizosphere, immokalee, fl, root, state of florida2017-04-01v4No1 / 543
205amnonhigher in depth 15cm compared to 2.5cm in Ely Greenstone rock piles ( high in depth depth 15cm compared to depth 2.5cm in rock united states of america quarry state of minnesota ph 7 greenschist )2017-10-03v4No1 / 562
357amnoncommon soil, topsoil, depth 0-10cm, mediterranean forest biome, forest ecosystem, woodland area2018-08-19v4No1 / 564
600sheryohigher in stover ammendment soil ( high in stover amended soil compared to unamended soil in soil depth 0-5cm united states of america new york coarse-loamy soil ph 6 day 82 )2020-03-27v4No1 / 567
612amnoncommon state of florida, united states of america, spring water, water, fresh water, location 22020-04-22v4No1 / 596
415amnoncommon rhizosphere, soil, citrus, orchard, south africa, cultivated environment2018-11-27v4No1 / 600
200amnoncommon in river downstream of wastewater treatment plant (common river, fresh water, water, united states of america, wastewater treatment plant, effluent)2017-10-01v4No1 / 655
612amnoncommon state of florida, united states of america, spring water, water, fresh water, location 42020-04-22v4No1 / 655
357amnoncommon in temperate deciduous forests around the world (common soil, topsoil, depth 0-10cm, temperate woodland biome, temperate deciduos forest, woodland area, forest ecosystem)2018-08-18v4No1 / 681
415amnoncommon rhizosphere, soil, citrus, orchard, reunion island, cultivated environment2018-11-27v4No1 / 721
134amnon high in taxus media taxus cuspidata northeast china temperate compared to taxus mairei southeast china subtropical in rhizosphere tree taxus china 2017-04-16v4No1 / 734
415amnoncommon rhizosphere, soil, citrus, australia, orchard, cultivated environment2018-11-27v4No1 / 743
271amnon high in rhizosphere glycine max soybean compared to soil in depth 0-20cm china 2018-01-09v4No1 / 750
309amnon high in plantago lanceolata ribwort plantain compared to other plants in rhizosphere germany 2018-04-05v4No1 / 800
480amnoncommon soil, pasture, farm, ireland2019-02-05v4No1 / 816
232amnonlower in diabetec foot ulcers compared to non-ulcer skin in diabetic patients ( high in control compared to wound ulcer in homo sapiens skin australia foot diabetes mellitus )2017-11-05v4No1 / 836
462amnon high in leaf compared to stem in united states of america state of tennessee populus tree cultivated environment 2019-01-13v4No1 / 890
146amnoncommon united states of america, solanum lycopersicum, tomato, slit loam soil, ph 6, rhizosphere2017-04-20v4No1 / 894
479amnoncommon rhizosphere, united states of america, state of california, ph 6-7, ceanothus jepsonii2019-02-05v4No1 / 900
462amnoncommon united states of america, state of tennessee, depth 30-75cm, silt clay loam, rhizosphere, populus, tree, cultivated environment2019-01-13v4No1 / 908
609sheryoCommon in soil without tobacco plants with difenoconazole fungicide amended and without biochar (common difenoconazole, fungicide, ph 7-8, china, tobacco field, limestone, depth 0-20cm, soil)2020-04-21v4No1 / 910
609sheryoDominant in soil without tobacco plants with difenoconazole fungicide amended and with biochar (common difenoconazole, fungicide, ph 7-8, china, tobacco field, limestone, depth 0-20cm, soil, biochar)2020-04-21v4No1 / 910
609sheryoCommon in soil without tobacco plants with difenoconazole fungicide amended and without biochar (common difenoconazole, fungicide, ph 7-8, china, tobacco field, limestone, depth 0-20cm, soil)2020-04-21v4No1 / 915
126amnoncommon rhizosphere, germany, hordeum vulgare, winter barley2017-04-14v4No1 / 925
37amnonlower in tomato plant leaves compared to plastic control ( high in control compared to solanum lycopersicum in maryland county leaf )2016-12-09v4No1 / 950
480amnoncommon soil, pasture, farm, new zealand2019-02-05v4No1 / 970
462amnoncommon united states of america, state of tennessee, rhizosphere, populus, tree, depth 0-30cm, silt loam, cultivated environment2019-01-13v4No1 / 997
479amnoncommon rhizosphere, united states of america, state of california, heteromeles arbutifolia, ph 6-72019-02-05v4No1 / 1006
263amnoncommon in desert soil irrigated daily in lab (common soil, israel, sandy loam soil, negev desert, ph 7-8, irrigated, research facility)2017-12-11v4No1 / 1076
252amnoncommon in river rock biofilm (common kingdom of spain, biofilm, river, rock, epilithic)2017-11-22v4No1 / 1081
415amnoncommon rhizosphere, soil, citrus, orchard, brazil, cultivated environment2018-11-27v4No1 / 1091
101amnoncommon merlot, vitis vinifera, grapevine, new york, united states of america, root2017-04-03v4No1 / 1106
515amnon high in carabidae compared to staphylinidae in whole body beetle carnivorous beetle river poland 2019-04-19v4No1 / 1130
134amnoncommon rhizosphere, tree, taxus, northeast china, temperate, taxus cuspidata, china2017-04-16v4No1 / 1141
146amnoncommon united states of america, solanum lycopersicum, tomato, soil, slit loam soil, ph 62017-04-20v4No1 / 1144
357amnon high in ph>5 compared to ph<5 in soil topsoil depth 0-10cm temperate woodland biome temperate deciduos forest woodland area forest ecosystem 2018-08-18v4No1 / 1171
252amnoncommon in river sand biofilm (common river, biofilm, kingdom of spain, sand)2017-11-22v4No1 / 1181
309amnoncommon rhizosphere, germany, prunella vulgaris, woundwort2018-04-05v4No1 / 1217
134amnoncommon rhizosphere, tree, taxus, taxus media, northeast china, temperate, china2017-04-16v4No1 / 1251
415amnoncommon rhizosphere, soil, citrus, orchard, italy, cultivated environment2018-11-27v4No1 / 1279
414amnoncommon soil, heilongjiang province, agricultural feature, triticum aestivum, glycine max, zea mays, black soil, mollisol, ph>6, china2018-11-26v4No1 / 1282
309amnoncommon rhizosphere, germany, latyrus pratensis, meadow pea-vine2018-04-05v4No1 / 1296
309amnoncommon rhizosphere, germany, onobrychis viciifolia, common sainfoin2018-04-05v4No1 / 1323
600sheryoCommon in biochar ammended soil after 82 days (common soil, biochar, depth 0-5cm, united states of america, new york, coarse-loamy soil, ph 6, day 82)2020-03-27v4No1 / 1326
600sheryoCommon in stover ammended soil after 82 days (common soil, depth 0-5cm, united states of america, new york, coarse-loamy soil, ph 6, day 82, stover ammendment )2020-03-27v4No1 / 1327
98amnoncommon citrus, rhizosphere, ft. pierce, fl, root, state of florida2017-04-01v4No1 / 1340
98amnoncommon citrus, rhizosphere, gainesville, fl, root, state of florida2017-04-01v4No1 / 1371
420amnoncommon in soil of vegetable open field (common soil, ph>7, ph 7-8, agricultural feature, farm, shanghai proper, clay loam, npk fertilizer, cultivated environment, china)2018-12-02v4No1 / 1376
309amnoncommon rhizosphere, germany, plantago lanceolata, ribwort plantain2018-04-05v4No1 / 1386
600sheryoCommon in unammended soil after 82 days (common soil, depth 0-5cm, united states of america, new york, coarse-loamy soil, ph 6, day 82)2020-03-27v4No1 / 1395
76amnoncommon in non-seleniferous soil (common soil, rhizosphere, united states of america, non-seleniferous, state of florida)2017-02-28v4No1 / 1414
40amnoncommon soil, field soil, nicotiana tabacum, rhizosphere, china2016-12-09v4No1 / 1420
462amnon high in rhizosphere compared to soil in united states of america state of tennessee populus tree cultivated environment 2019-01-12v4No1 / 1428
309amnoncommon rhizosphere, germany, geranium pratense, meadow geranium2018-04-05v4No1 / 1434
76amnoncommon in seleniferous soil (common soil, rhizosphere, united states of america, selenium, seleniferous, woodland area)2017-02-28v4No1 / 1438
414amnon high in ph>6 compared to ph<6 npk fertilizer in soil heilongjiang province agricultural feature triticum aestivum glycine max zea mays black soil mollisol china 2018-11-26v4No1 / 1451
271amnoncommon rhizosphere, glycine max, depth 0-20cm, soybean, china2018-01-09v4No1 / 1459
309amnoncommon rhizosphere, germany, festuca rubra, red fescue grass2018-04-05v4No1 / 1510
309amnoncommon rhizosphere, germany, galium mollugo, hedge bedstraw2018-04-05v4No1 / 1599
608sheryoCommon in wheat field in China, amended and unamended biochar, unamended with nitrogen fertilizer (common triticum aestivum l. cv., xiaoyan no. 22, china, silty clay, soil)2020-04-20v4No1 / 1643
608sheryoCommon in wheat field in China, amended and unamended biochar, amended with nitrogen fertilizer (common triticum aestivum l. cv., xiaoyan no. 22, china, silty clay, soil, urea enriched soil)2020-04-20v4No1 / 1682
155amnonhigher in tightly bound root soil compared to loose soil and bulk soil ( high in root compared to bulk soil in triticum aestivum wheat soil china )2017-07-02v4No1 / 1714
309amnoncommon rhizosphere, germany, veronica chamaedrys, germander speedwell2018-04-05v4No1 / 1788
353amnonlower in captive compared to wild caught Lissotriton vulgaris newts skin ( high in wild compared to research facility in newt adult skin cambridgeshire triturus cristatus united kingdom )2018-07-30v4No1 / 1834
296amnoncommon soil, north china plain, agricultural feature, wheat, winter, depth 0-20cm, ph>4, ph<5, china2018-02-11v4No1 / 1886
155amnoncommon in soil tightly bound to wheat root (common triticum aestivum, wheat, soil, root, china)2017-07-02v4No1 / 1977
101amnoncommon vitis vinifera, united states of america, merlot, grapevine, new york, rhizosphere2017-04-03v4No1 / 1980
175amnoncommon in heavy metal contaminated soils in china (common soil, heavy metal, ph 7-9, china)2017-07-29v4No1 / 2133
296amnoncommon soil, north china plain, agricultural feature, wheat, winter, depth 0-20cm, ph>7, ph<8, china2018-02-11v4No1 / 2160
353amnonlower in captive compared to wild caught Lissotriton vulgaris newts skin ( high in wild compared to research facility in newt adult skin cambridgeshire lissotriton vulgaris united kingdom )2018-07-30v4No1 / 2162
296amnoncommon soil, north china plain, agricultural feature, wheat, winter, depth 0-20cm, ph>6, ph<7, china2018-02-11v4No1 / 2223
296amnoncommon in wheat field soil (common soil, north china plain, depth 5cm, agricultural feature, wheat, winter, china)2018-02-11v4No1 / 2341
155amnoncommon in soil loosely bound to wheat root (common triticum aestivum, wheat, soil, rhizosphere, china)2017-07-02v4No1 / 2425
101amnoncommon vitis vinifera, united states of america, merlot, grapevine, new york, soil2017-04-03v4No1 / 2537
155amnoncommon in bulk soil in wheat field (common triticum aestivum, wheat, soil, bulk soil, china)2017-07-02v4No1 / 2594
296amnoncommon soil, north china plain, agricultural feature, wheat, winter, depth 0-20cm, ph>8, china2018-02-11v4No1 / 2646
357amnon high in ph>4.5 compared to ph<4.5 in soil topsoil depth 0-10cm moist tropical forest woodland area forest ecosystem 2018-08-18v4No1 / 2773
271amnoncommon depth 0-20cm, soil, china2018-01-09v4No1 / 2856
422amnon high in ph 7-8 compared to ph 5-6 in soil paddy field soil oryza sativa heilongjiang province cultivated environment china 2018-12-04v4No1 / 3267
296amnoncommon soil, north china plain, agricultural feature, wheat, winter, depth 0-20cm, ph>5, ph<6, china2018-02-11v4No1 / 3508
462amnon high in rhizosphere compared to root in united states of america state of tennessee populus tree cultivated environment 2019-01-13v4No1 / 4630
171amnonlower in roots compared to rhizosphere soil in rice ( high in rhizosphere soil compared to root in united states of america state of california oryza sativa rice )2017-07-25v4No1 / 7628

Problems / suggestions? Please email info AT dbbact DOT org