Search result for sequence:
TACGAAGGGGGCTAGCGTTGCTCGGAATCACTGGGCGTAAAGGGCGCGTAGGCGGACTCTTAAGTCGGGGGTGAAAGCCCAGGGCTCAACCCTGGAATTGCCTTCGATACTGAGAGTCTTGAGTTCGGAAGAGGTTGGTGGAACTGCGAG
common ontology terms
term enrichment score
TermScore
rhizosphere0.374614
soil0.315789
china0.194192
drinking water0.192926
water0.165517
cultivated environment0.163522
united states of america0.155249
wheat0.135135
depth 0-20cm0.130719
agricultural feature0.124138
citrus0.122867
river0.116429
tree0.115756
germany0.113695
root0.100629
skin0.096257
glycine max0.082759
orchard0.082759
triticum aestivum0.082759
north china plain0.082759
winter0.075472
usa0.073620
research facility0.070777
populus0.069930
woodland area0.066445
state of tennessee0.063291
fresh water0.061350
beagle dog0.056738
distribution system0.056738
LOWER IN water treatment plant0.056738
taxus0.056738
cambridgeshire0.056738
soybean0.055172
newt0.055172
LOWER IN soil0.054176
intestine0.051392
topsoil0.050955
state of florida0.050314
depth 0-10cm0.049689
farm0.049281
city0.047904
united kingdom0.047337
forest ecosystem0.047337
ph 7-80.043796
site e0.043636
pasture0.043636
heilongjiang province0.043636
bronchoalveolar lavage0.043165
tomato0.043165
state of rhode island0.043165
wastewater treatment plant0.043165
taxus cuspidata0.043165
temperate0.043165
merlot0.043165
grapevine0.043165
new york0.043165
rock0.042705
canis lupus familiaris0.042328
site c0.042254
site a0.042254
mucus0.042254
northeast china0.042254
vitis vinifera0.042254
solanum lycopersicum0.041379
biofilm0.039735
leaf0.039474
state of california0.037152
kingdom of spain0.036810
root structure0.029197
southern united states0.029197
epilithic0.029197
kitchen0.029197
sink0.029197
rana pipiens0.029197
northern leopard frog0.029197
hong kong0.029197
koshi river0.029197
carnivorous beetle0.029197
heavy metal0.029197
lissotriton vulgaris0.029197
triturus cristatus0.029197
temperate woodland biome0.029197
temperate deciduos forest0.029197
taxus media0.029197
plantago lanceolata0.029197
ribwort plantain0.029197
slit loam soil0.029197
black soil0.029197
mollisol0.029197
zebra fish0.028986
oryza sativa0.028986
oreochromis niloticus0.028777
snake0.028777
danio rerio0.028777
site d0.028777
building0.028777
digesta0.028777
state of wisconsin0.028777
freshwater lake0.028777
south america0.028777
Fraction of dbbact annotations with this term covered by the query
TermScore
ph 7-80.750000
agricultural feature0.750000
drinking water0.666667
site e0.666667
pasture0.666667
citrus0.666667
heilongjiang province0.666667
wheat0.666667
rhizosphere0.518519
greenhouse0.500000
dracaena fragrans0.500000
epipremnum aureum0.500000
beagle dog0.500000
bronchoalveolar lavage0.500000
tap water0.500000
stagnant water0.500000
depth 0-20cm0.500000
glycine max0.500000
root structure0.500000
root nodule0.500000
tomato0.500000
blossom0.500000
southern united states0.500000
carphophis amoenus0.500000
worm snake0.500000
fossorial snake0.500000
distribution system0.500000
LOWER IN water treatment plant0.500000
cadmium0.500000
scotland0.500000
uganda0.500000
LOWER IN ceftriaxone0.500000
no ceftriaxone0.500000
pneumonia0.500000
epilithic0.500000
LOWER IN epipsammic0.500000
nicotiana galuca0.500000
kitchen0.500000
sink0.500000
LOWER IN bathroom0.500000
LOWER IN shower0.500000
LOWER IN tile0.500000
LOWER IN building wall0.500000
rana pipiens0.500000
northern leopard frog0.500000
cabbage0.500000
state of rhode island0.500000
aquatic snake0.500000
nerodia sipedon0.500000
northern water snake0.500000
hong kong0.500000
low income0.500000
sewer0.500000
wastewater treatment plant0.500000
LOWER IN depth 10 cm0.500000
depth 60 cm0.500000
subway0.500000
koshi river0.500000
anaxyrus americanus0.500000
american toad0.500000
ginger0.500000
mine tailing0.500000
alkaline mine tailing0.500000
guangxi zhuang autonomous region0.500000
zone 10.500000
LOWER IN zone 2,30.500000
oropharynx0.500000
LOWER IN barn0.500000
LOWER IN hay0.500000
taxus0.500000
taxus cuspidata0.500000
LOWER IN taxus media0.500000
bon portage island0.500000
oceanodroma leucorhoa0.500000
seabird0.500000
LOWER IN burrow0.500000
carnivorous beetle0.500000
raba river0.500000
bembidion varicolor0.500000
LOWER IN meadow pea-vine0.500000
LOWER IN lathyrus pratensis0.500000
other plants0.500000
food processing factory0.500000
heavy metal0.500000
achatinella mustelina0.500000
LOWER IN whole plant0.500000
lissotriton vulgaris0.500000
cambridgeshire0.500000
pseudacris crucifer0.500000
peeper0.500000
sewage0.500000
influent0.500000
LOWER IN effluent0.500000
triturus cristatus0.500000
orchard0.500000
cultivated environment0.500000
immokalee, fl0.500000
quarry0.500000
ph 70.500000
greenschist0.500000
Fraction of annotations for the query sequences containing the term
TermScore
united states of america0.323308
rhizosphere0.293233
soil0.285714
china0.240602
water0.157895
drinking water0.112782
cultivated environment0.097744
research facility0.082707
germany0.082707
depth 0-20cm0.075188
wheat0.075188
skin0.067669
river0.067669
tree0.067669
citrus0.067669
agricultural feature0.067669
root0.060150
winter0.052632
usa0.045113
glycine max0.045113
orchard0.045113
triticum aestivum0.045113
north china plain0.045113
fresh water0.037594
woodland area0.037594
state of tennessee0.037594
populus0.037594
canis lupus familiaris0.030075
beagle dog0.030075
soybean0.030075
distribution system0.030075
LOWER IN water treatment plant0.030075
intestine0.030075
LOWER IN soil0.030075
city0.030075
farm0.030075
taxus0.030075
newt0.030075
adult0.030075
cambridgeshire0.030075
united kingdom0.030075
state of florida0.030075
topsoil0.030075
depth 0-10cm0.030075
forest ecosystem0.030075
site c0.022556
leaf0.022556
bronchoalveolar lavage0.022556
site a0.022556
solanum lycopersicum0.022556
tomato0.022556
site e0.022556
kingdom of spain0.022556
biofilm0.022556
rock0.022556
mucus0.022556
state of rhode island0.022556
wastewater treatment plant0.022556
pasture0.022556
taxus cuspidata0.022556
northeast china0.022556
temperate0.022556
state of california0.022556
ph 7-80.022556
merlot0.022556
vitis vinifera0.022556
grapevine0.022556
new york0.022556
heilongjiang province0.022556
root structure0.015038
fish0.015038
digestive system0.015038
oreochromis niloticus0.015038
snake0.015038
southern united states0.015038
danio rerio0.015038
zebra fish0.015038
site d0.015038
homo sapiens0.015038
sediment0.015038
epilithic0.015038
israel0.015038
building0.015038
urban biome0.015038
kitchen0.015038
sink0.015038
rana pipiens0.015038
northern leopard frog0.015038
digesta0.015038
state of wisconsin0.015038
tadpole0.015038
foodon product type0.015038
lake0.015038
freshwater lake0.015038
french republic0.015038
air0.015038
hong kong0.015038
south america0.015038
depth 10 cm0.015038
koshi river0.015038
Exp. ID User ID Description Date Region Flag Sequences
109amnonhighfreq usa, water, drinking water, site c2017-04-08v4No1 / 12
361amnoncommon leaf, austria, greenhouse, plant, dracaena fragrans, epipremnum aureum2018-08-21v4No1 / 14
69amnonhighfreq canis lupus familiaris, beagle dog, united states of america, research facility, bronchoalveolar lavage2017-02-21v4No1 / 15
341amnonlower in fresh drinking water compared to week old water ( high in stagnant water compared to fresh water in water drinking water united states of america tap water state of illinois )2018-05-28v4No1 / 15
109amnonhighfreq usa, water, drinking water, site a2017-04-08v4No1 / 17
271amnoncommon depth 0-20cm, glycine max, soybean, root structure, root, root nodule, china2018-01-09v4No1 / 20
146amnoncommon united states of america, solanum lycopersicum, tomato, blossom, flower structure2017-04-20v4No1 / 26
267amnoncommon fish, digestive system, oreochromis niloticus, research facility, china2017-12-24v4No1 / 28
109amnoncommon water, drinking water, united states of america, site b2017-04-08v4No1 / 31
536amnoncommon snake, skin, united states of america, southern united states, carphophis amoenus, worm snake, fossorial snake2019-07-28v4No1 / 35
109amnon high in distribution system compared to water treatment plant in usa water drinking water site a 2017-04-08v4No1 / 41
112amnoncommon danio rerio, zebra fish, intestine, research facility, china2017-04-09v4No1 / 41
117amnoncommon zebra fish, danio rerio, research facility, larval stage, united states of america, intestine2017-04-10v4No1 / 41
267amnonhigher in gut of fish in water with cadmium contamination compared to control ( high in cadmium compared to control in fish digestive system oreochromis niloticus research facility china )2017-12-24v4No1 / 41
69amnoncommon canis lupus familiaris, beagle dog, united states of america, research facility, bronchoalveolar lavage2017-02-21v4No1 / 44
110amnoncommon water, drinking water, scotland, site e2017-04-08v4No1 / 44
109amnon high in distribution system compared to water treatment plant in water drinking water united states of america site d 2017-04-08v4No1 / 46
258amnonhigher lungs of hiv pneumonia patients not treated with ceftriaxone ( high in no ceftriaxone compared to ceftriaxone in homo sapiens hiv infection uganda bronchoalveolar lavage bronchial epithelium lung pneumonia )2017-11-27v4No1 / 47
109amnoncommon usa, water, drinking water, site a2017-04-08v4No1 / 54
252amnonlower on sand biofilm compared to rock biofilm in river ( high in rock epilithic compared to sand epipsammic in kingdom of spain biofilm river sediment )2017-11-22v4No1 / 56
56amnoncommon nicotiana galuca, flower, nectar, israel2017-01-30v4No1 / 57
199amnonlower in bathroom shower compared to kitchen sink ( high in kitchen sink compared to bathroom shower tile building wall in building urban biome united states of america )2017-10-01v4No1 / 61
109amnoncommon water, drinking water, united states of america, site d2017-04-08v4No1 / 67
69amnoncommon canis lupus familiaris, beagle dog, united states of america, research facility, nasal cavity, mucus2017-02-21v4No1 / 77
109amnoncommon water, drinking water, united states of america, site e2017-04-08v4No1 / 80
109amnon high in distribution system compared to water treatment plant in usa water drinking water site c 2017-04-08v4No1 / 81
114amnoncommon rana pipiens, northern leopard frog, research facility, digesta, intestine, state of wisconsin, united states of america, tadpole2017-04-10v4No1 / 84
311amnoncommon in salted cabbage (common cabbage, united states of america, state of rhode island, foodon product type)2018-04-09v4No1 / 85
109amnoncommon usa, water, drinking water, site c2017-04-08v4No1 / 86
114amnon high in tadpole compared to adult in rana pipiens northern leopard frog research facility digesta intestine state of wisconsin united states of america 2017-04-10v4No1 / 90
271amnon high in root structure root compared to soil rhizosphere in depth 0-20cm glycine max soybean china 2018-01-09v4No1 / 110
536amnoncommon snake, skin, united states of america, southern united states, aquatic snake, nerodia sipedon, northern water snake2019-07-28v4No1 / 111
557amnoncommon lake, freshwater lake, fresh water, water, french republic, depth 10m2019-09-14v3No1 / 123
557amnoncommon lake, freshwater lake, fresh water, water, french republic, depth 40m2019-09-14v3No1 / 129
199amnoncommon in kitchen sink (common building, urban biome, united states of america, kitchen, sink)2017-10-01v4No1 / 130
109amnon high in distribution system compared to water treatment plant in water drinking water united states of america site e 2017-04-08v4No1 / 143
475amnoncommon in air next to subway stations in hong kong (common air, hong kong, city)2019-01-20v4No1 / 147
53amnonhigher in sewer and wastewater influent comapred to feces in low income south america ( high in sewer wastewater treatment plant compared to feces in south america city low income )2017-01-21v4No1 / 148
512amnon high in depth 60 cm compared to depth 10 cm in fen peatland peat soil soil china 2019-03-22v4No1 / 155
475amnoncommon in air in subway train in hong kong (common air, hong kong, city, subway)2019-01-20v4No1 / 161
534amnoncommon river, water, fresh water, depth 10 cm, koshi river, nepal, free floating, filtered 0.2um2019-07-22v4No1 / 172
99amnoncommon commonwealth of virginia, united states of america, skin, mucus, anaxyrus americanus, american toad2017-04-02v4No1 / 176
196amnoncommon water, drinking water, united states of america2017-09-12v4No1 / 178
311amnoncommon ginger, united states of america, state of rhode island, foodon product type2018-04-09v4No1 / 180
402amnon high in zone 1 compared to zone 2,3 in sediment soil mine tailing alkaline mine tailing guangxi zhuang autonomous region china 2018-11-18v4No1 / 189
196amnonhigher in water compared to biofilm ( high in water compared to biofilm in drinking water united states of america )2017-09-12v4No1 / 223
69amnoncommon canis lupus familiaris, beagle dog, united states of america, research facility, oropharynx2017-02-21v4No1 / 241
384amnon high in pasture compared to barn hay in equus caballus horse canada farm saliva mouth 2018-10-22v4No1 / 245
160amnoncommon in river water upstream of WTP effluent in spring in china (common river, water, spring, china)2017-07-12v4No1 / 278
134amnon high in taxus cuspidata compared to taxus media in rhizosphere tree taxus china 2017-04-16v4No1 / 279
237amnonlower in burrow soil compared to bird ( high in oceanodroma leucorhoa bird seabird compared to soil burrow in canada bon portage island )2017-11-07v4No1 / 298
515amnoncommon carnivorous beetle, river, poland, raba river, whole body, beetle, bembidion varicolor2019-04-18v4No1 / 308
534amnoncommon river, water, fresh water, depth 10 cm, koshi river, nepal, particle bound, filtered 2.7um2019-07-22v4No1 / 315
309amnon high in other plants compared to meadow pea-vine lathyrus pratensis in rhizosphere germany 2018-04-05v4No1 / 316
311amnoncommon in floor of kimchi production facility (common united states of america, state of rhode island, floor, food processing factory)2018-04-09v4No1 / 324
175amnonhigher in winter compared to summer in heavy metal contaminated soils in china ( high in winter compared to summer in soil heavy metal china )2017-07-29v4No1 / 337
28amnon high in feces achatinella mustelina compared to whole plant leaf in hawaii 2016-12-05v4No1 / 413
353amnoncommon in wild Lissotriton vulgaris newts skin (common newt, adult, skin, lissotriton vulgaris, cambridgeshire, united kingdom)2018-07-30v4No1 / 418
99amnoncommon commonwealth of virginia, united states of america, skin, mucus, pseudacris crucifer, peeper2017-04-02v4No1 / 438
53amnonlower in wastewater plant effluent compared to influent and sewer in south america ( high in sewage influent compared to effluent in south america wastewater treatment plant city )2017-01-21v4No1 / 440
353amnoncommon in wild Triturus cristatus newts skin (common newt, adult, skin, cambridgeshire, triturus cristatus, united kingdom)2018-07-30v4No1 / 456
415amnoncommon rhizosphere, soil, citrus, orchard, united states of america, cultivated environment2018-11-27v4No1 / 494
98amnoncommon citrus, rhizosphere, immokalee, fl, root, state of florida2017-04-01v4No1 / 543
205amnonhigher in depth 15cm compared to 2.5cm in Ely Greenstone rock piles ( high in depth depth 15cm compared to depth 2.5cm in rock united states of america quarry state of minnesota ph 7 greenschist )2017-10-03v4No1 / 562
357amnoncommon soil, topsoil, depth 0-10cm, mediterranean forest biome, forest ecosystem, woodland area2018-08-19v4No1 / 564
415amnoncommon rhizosphere, soil, citrus, orchard, south africa, cultivated environment2018-11-27v4No1 / 600
200amnoncommon in river downstream of wastewater treatment plant (common river, fresh water, water, united states of america, wastewater treatment plant, effluent)2017-10-01v4No1 / 655
357amnoncommon in temperate deciduous forests around the world (common soil, topsoil, depth 0-10cm, temperate woodland biome, temperate deciduos forest, woodland area, forest ecosystem)2018-08-18v4No1 / 681
415amnoncommon rhizosphere, soil, citrus, orchard, reunion island, cultivated environment2018-11-27v4No1 / 721
134amnon high in taxus media taxus cuspidata northeast china temperate compared to taxus mairei southeast china subtropical in rhizosphere tree taxus china 2017-04-16v4No1 / 734
415amnoncommon rhizosphere, soil, citrus, australia, orchard, cultivated environment2018-11-27v4No1 / 743
271amnon high in rhizosphere glycine max soybean compared to soil in depth 0-20cm china 2018-01-09v4No1 / 750
309amnon high in plantago lanceolata ribwort plantain compared to other plants in rhizosphere germany 2018-04-05v4No1 / 800
480amnoncommon soil, pasture, farm, ireland2019-02-05v4No1 / 816
232amnonlower in diabetec foot ulcers compared to non-ulcer skin in diabetic patients ( high in control compared to wound ulcer in homo sapiens skin australia foot diabetes mellitus )2017-11-05v4No1 / 836
462amnon high in leaf compared to stem in united states of america state of tennessee populus tree cultivated environment 2019-01-13v4No1 / 890
146amnoncommon united states of america, solanum lycopersicum, tomato, slit loam soil, ph 6, rhizosphere2017-04-20v4No1 / 894
479amnoncommon rhizosphere, united states of america, state of california, ph 6-7, ceanothus jepsonii2019-02-05v4No1 / 900
462amnoncommon united states of america, state of tennessee, depth 30-75cm, silt clay loam, rhizosphere, populus, tree, cultivated environment2019-01-13v4No1 / 908
126amnoncommon rhizosphere, germany, hordeum vulgare, winter barley2017-04-14v4No1 / 925
37amnonlower in tomato plant leaves compared to plastic control ( high in control compared to solanum lycopersicum in maryland county leaf )2016-12-09v4No1 / 950
480amnoncommon soil, pasture, farm, new zealand2019-02-05v4No1 / 970
462amnoncommon united states of america, state of tennessee, rhizosphere, populus, tree, depth 0-30cm, silt loam, cultivated environment2019-01-13v4No1 / 997
479amnoncommon rhizosphere, united states of america, state of california, heteromeles arbutifolia, ph 6-72019-02-05v4No1 / 1006
263amnoncommon in desert soil irrigated daily in lab (common soil, israel, sandy loam soil, negev desert, ph 7-8, irrigated, research facility)2017-12-11v4No1 / 1076
252amnoncommon in river rock biofilm (common kingdom of spain, biofilm, river, rock, epilithic)2017-11-22v4No1 / 1081
415amnoncommon rhizosphere, soil, citrus, orchard, brazil, cultivated environment2018-11-27v4No1 / 1091
101amnoncommon merlot, vitis vinifera, grapevine, new york, united states of america, root2017-04-03v4No1 / 1106
515amnon high in carabidae compared to staphylinidae in whole body beetle carnivorous beetle river poland 2019-04-19v4No1 / 1130
134amnoncommon rhizosphere, tree, taxus, northeast china, temperate, taxus cuspidata, china2017-04-16v4No1 / 1141
146amnoncommon united states of america, solanum lycopersicum, tomato, soil, slit loam soil, ph 62017-04-20v4No1 / 1144
357amnon high in ph>5 compared to ph<5 in soil topsoil depth 0-10cm temperate woodland biome temperate deciduos forest woodland area forest ecosystem 2018-08-18v4No1 / 1171
252amnoncommon in river sand biofilm (common river, biofilm, kingdom of spain, sand)2017-11-22v4No1 / 1181
309amnoncommon rhizosphere, germany, prunella vulgaris, woundwort2018-04-05v4No1 / 1217
134amnoncommon rhizosphere, tree, taxus, taxus media, northeast china, temperate, china2017-04-16v4No1 / 1251
415amnoncommon rhizosphere, soil, citrus, orchard, italy, cultivated environment2018-11-27v4No1 / 1279
414amnoncommon soil, heilongjiang province, agricultural feature, triticum aestivum, glycine max, zea mays, black soil, mollisol, ph>6, china2018-11-26v4No1 / 1282
309amnoncommon rhizosphere, germany, latyrus pratensis, meadow pea-vine2018-04-05v4No1 / 1296
309amnoncommon rhizosphere, germany, onobrychis viciifolia, common sainfoin2018-04-05v4No1 / 1323
98amnoncommon citrus, rhizosphere, ft. pierce, fl, root, state of florida2017-04-01v4No1 / 1340
98amnoncommon citrus, rhizosphere, gainesville, fl, root, state of florida2017-04-01v4No1 / 1371
420amnoncommon in soil of vegetable open field (common soil, ph>7, ph 7-8, agricultural feature, farm, shanghai proper, clay loam, npk fertilizer, cultivated environment, china)2018-12-02v4No1 / 1376
309amnoncommon rhizosphere, germany, plantago lanceolata, ribwort plantain2018-04-05v4No1 / 1386
76amnoncommon in non-seleniferous soil (common soil, rhizosphere, united states of america, non-seleniferous, state of florida)2017-02-28v4No1 / 1414
40amnoncommon soil, field soil, nicotiana tabacum, rhizosphere, china2016-12-09v4No1 / 1420
462amnon high in rhizosphere compared to soil in united states of america state of tennessee populus tree cultivated environment 2019-01-12v4No1 / 1428
309amnoncommon rhizosphere, germany, geranium pratense, meadow geranium2018-04-05v4No1 / 1434
76amnoncommon in seleniferous soil (common soil, rhizosphere, united states of america, selenium, seleniferous, woodland area)2017-02-28v4No1 / 1438
414amnon high in ph>6 compared to ph<6 npk fertilizer in soil heilongjiang province agricultural feature triticum aestivum glycine max zea mays black soil mollisol china 2018-11-26v4No1 / 1451
271amnoncommon rhizosphere, glycine max, depth 0-20cm, soybean, china2018-01-09v4No1 / 1459
309amnoncommon rhizosphere, germany, festuca rubra, red fescue grass2018-04-05v4No1 / 1510
309amnoncommon rhizosphere, germany, galium mollugo, hedge bedstraw2018-04-05v4No1 / 1599
155amnonhigher in tightly bound root soil compared to loose soil and bulk soil ( high in root compared to bulk soil in triticum aestivum wheat soil china )2017-07-02v4No1 / 1714
309amnoncommon rhizosphere, germany, veronica chamaedrys, germander speedwell2018-04-05v4No1 / 1788
353amnonlower in captive compared to wild caught Lissotriton vulgaris newts skin ( high in wild compared to research facility in newt adult skin cambridgeshire triturus cristatus united kingdom )2018-07-30v4No1 / 1834
296amnoncommon soil, north china plain, agricultural feature, wheat, winter, depth 0-20cm, ph>4, ph<5, china2018-02-11v4No1 / 1886
155amnoncommon in soil tightly bound to wheat root (common triticum aestivum, wheat, soil, root, china)2017-07-02v4No1 / 1977
101amnoncommon vitis vinifera, united states of america, merlot, grapevine, new york, rhizosphere2017-04-03v4No1 / 1980
175amnoncommon in heavy metal contaminated soils in china (common soil, heavy metal, ph 7-9, china)2017-07-29v4No1 / 2133
296amnoncommon soil, north china plain, agricultural feature, wheat, winter, depth 0-20cm, ph>7, ph<8, china2018-02-11v4No1 / 2160
353amnonlower in captive compared to wild caught Lissotriton vulgaris newts skin ( high in wild compared to research facility in newt adult skin cambridgeshire lissotriton vulgaris united kingdom )2018-07-30v4No1 / 2162
296amnoncommon soil, north china plain, agricultural feature, wheat, winter, depth 0-20cm, ph>6, ph<7, china2018-02-11v4No1 / 2223
296amnoncommon in wheat field soil (common soil, north china plain, depth 5cm, agricultural feature, wheat, winter, china)2018-02-11v4No1 / 2341
155amnoncommon in soil loosely bound to wheat root (common triticum aestivum, wheat, soil, rhizosphere, china)2017-07-02v4No1 / 2425
101amnoncommon vitis vinifera, united states of america, merlot, grapevine, new york, soil2017-04-03v4No1 / 2537
155amnoncommon in bulk soil in wheat field (common triticum aestivum, wheat, soil, bulk soil, china)2017-07-02v4No1 / 2594
296amnoncommon soil, north china plain, agricultural feature, wheat, winter, depth 0-20cm, ph>8, china2018-02-11v4No1 / 2646
357amnon high in ph>4.5 compared to ph<4.5 in soil topsoil depth 0-10cm moist tropical forest woodland area forest ecosystem 2018-08-18v4No1 / 2773
271amnoncommon depth 0-20cm, soil, china2018-01-09v4No1 / 2856
422amnon high in ph 7-8 compared to ph 5-6 in soil paddy field soil oryza sativa heilongjiang province cultivated environment china 2018-12-04v4No1 / 3267
296amnoncommon soil, north china plain, agricultural feature, wheat, winter, depth 0-20cm, ph>5, ph<6, china2018-02-11v4No1 / 3508
462amnon high in rhizosphere compared to root in united states of america state of tennessee populus tree cultivated environment 2019-01-13v4No1 / 4630
171amnonlower in roots compared to rhizosphere soil in rice ( high in rhizosphere soil compared to root in united states of america state of california oryza sativa rice )2017-07-25v4No1 / 7628

Problems / suggestions? Please email info AT dbbact DOT org