Search result for sequence:
TACGAAGGGGGCTAGCGTTGCTCGGAATCACTGGGCGTAAAGGGCGCGTAGGCGGCCATTCAAGTCAGAGGTGAAAGCCCAAGGCTCAACCTTGGAATTGCCTTTGATACTGTTTGGCTTGAGACCGGAAGAGGTTAGTGGAACTGCGAG
common ontology terms
term enrichment score
TermScore
soil0.171872
canada0.159151
zoological garden0.148760
captive0.129496
mexico0.127660
china0.125744
skin0.119318
desert0.111940
african lion safari0.105882
agricultural field0.095745
jejunum0.093750
leaf0.086207
toronto zoo0.084337
kingdom of spain0.076923
land snail0.074534
whole body0.073491
farm0.070796
air0.067416
israel0.064516
yak0.063025
bos grunniens0.062370
australia0.062338
la rioja province0.061728
pot expreiment0.061728
tobacco0.061728
cigar0.061728
nicotiana tabacum0.059880
stomach0.059113
tick0.058140
rhizosphere0.057582
sheep0.055710
ovis aries0.054201
city0.053004
wild0.051195
cow milk (raw)0.050633
milk0.050633
myrtillocactus geometrizans0.050000
opuntia robusta0.050000
agave0.050000
guanajuato0.050000
minas gerais state0.050000
campos rupestres0.050000
external acoustic meatus0.050000
pomacea canaliculata0.050000
golden apple snail0.050000
nanheng river0.050000
state of sabah0.050000
late weichselian glaciation0.050000
clayey till0.050000
lund0.050000
tibet autonomous region0.050000
united states of america0.049419
leaf surface0.049383
cactus0.048780
semi-arid0.048780
qingpu district0.048780
malaysia0.048780
loam soil0.048780
luancheng county0.048780
body proper0.047170
fertilized soil0.046512
duodenum0.044944
gastrointestinal system0.044444
italy0.044118
kingdom of denmark0.042553
state of california0.038835
riwoqe county0.038710
age 7 weeks0.038710
wuhan0.038710
ear0.038710
cow milk (fluid)0.038339
size < 10um0.037975
state of utah0.037975
barbacenia macrantha0.037975
panax notoginseng0.037975
sanqi plants0.037975
xundian county0.037975
state of tabasco0.037975
cocoa mass0.037975
theobroma cacao0.037975
mongolia0.037618
dust0.037267
yunnan province0.037267
western australia0.037267
epidermis0.036585
coast0.036585
bird0.036145
age 1 year0.035928
research facility0.035907
cow0.035608
province of ontario0.035294
ph 60.035294
brazil0.035088
depth (soil) 0-10cm0.034985
bos taurus0.033520
feces0.033326
depth (water) 20-100cm0.032967
rumen0.032172
surface water0.031915
control0.031579
Fraction of dbbact annotations with this term covered by the query
TermScore
riwoqe county1.000000
LOWER IN lumen of jejunum1.000000
jejunal mucosa1.000000
age 7 weeks1.000000
wuhan1.000000
lumen of jejunum1.000000
egg chorion1.000000
black soldier fly1.000000
hermetia illucens1.000000
tours1.000000
fully formed stage1.000000
deep bay1.000000
mirs bay1.000000
LOWER IN mirs bay1.000000
sediment depth 20-50cm1.000000
aldabra atoll1.000000
seychelles1.000000
ear1.000000
department of peten1.000000
ngamba island1.000000
LOWER IN wild diet1.000000
feed supplement diet1.000000
porphyrio hochstetteri1.000000
takahe1.000000
LOWER IN no iron deficiency anemia1.000000
iron deficiency anemia1.000000
yak0.750000
cow milk (raw)0.666667
cow milk (fluid)0.666667
milk0.666667
land snail0.666667
bos grunniens0.600000
achatinella mustelina0.500000
non-seleniferous0.500000
LOWER IN seleniferous0.500000
hedera hibernica0.500000
ivy0.500000
LOWER IN moor0.500000
myrtillocactus geometrizans0.500000
opuntia robusta0.500000
ph 6-6.50.500000
root zone soil0.500000
size < 10um0.500000
clear day0.500000
dust storm0.500000
LOWER IN clear day0.500000
LOWER IN wound0.500000
LOWER IN ulcer0.500000
grassland0.500000
steppe0.500000
state of utah0.500000
depth 1cm0.500000
soil crust0.500000
agave0.500000
agave deserti0.500000
agave salmiana0.500000
guanajuato0.500000
agave tequiliana0.500000
LOWER IN agave0.500000
pseudomyrmex spinicola0.500000
30-60 days0.500000
LOWER IN 0-2 days0.500000
sandstone0.500000
grand staircase-escalante national park0.500000
depth (soil) 0-1cm0.500000
minas gerais state0.500000
campos rupestres0.500000
barbacenia macrantha0.500000
urocyon littoralis0.500000
santa catalina island fox0.500000
urocyon littoralis catalinae0.500000
external acoustic meatus0.500000
LOWER IN perianal skin0.500000
cannabis sativa0.500000
no water addition0.500000
ambient precipitation0.500000
luvic gypsisols0.500000
cambic arenosols0.500000
dengkou county0.500000
ulan buh desert0.500000
bajada0.500000
sandy desert0.500000
100% above ambient precipitation0.500000
water addition0.500000
LOWER IN intact branch0.500000
severed branch0.500000
epiphytic material0.500000
olympic national park0.500000
canopy soil0.500000
yunwushan national natural grassland protection zone0.500000
ningxia province0.500000
calci-orthic aridisol0.500000
haplic calcisol0.500000
27-35 years of grazing exclusion0.500000
grazing exclusion0.500000
gallbladder0.500000
bile0.500000
alpine meadow0.500000
african lion safari0.500000
eastern gray squirrel0.500000
Fraction of annotations for the query sequences containing the term
TermScore
china0.230263
soil0.203947
canada0.197368
skin0.184211
zoological garden0.118421
captive0.118421
united states of america0.085526
mexico0.078947
desert0.065789
research facility0.065789
feces0.059211
african lion safari0.059211
agricultural field0.059211
leaf0.052632
homo sapiens0.052632
farm0.052632
adult0.052632
kingdom of spain0.052632
jejunum0.052632
toronto zoo0.046053
whole body0.046053
rhizosphere0.039474
air0.039474
israel0.039474
australia0.039474
control0.039474
stomach0.039474
land snail0.039474
city0.032895
wild0.032895
bos grunniens0.032895
yak0.032895
body proper0.032895
la rioja province0.032895
tick0.032895
sheep0.032895
ovis aries0.032895
pot expreiment0.032895
tobacco0.032895
nicotiana tabacum0.032895
cigar0.032895
myrtillocactus geometrizans0.026316
opuntia robusta0.026316
cactus0.026316
semi-arid0.026316
agave0.026316
state of california0.026316
leaf surface0.026316
guanajuato0.026316
minas gerais state0.026316
campos rupestres0.026316
brazil0.026316
external acoustic meatus0.026316
pomacea canaliculata0.026316
golden apple snail0.026316
nanheng river0.026316
qingpu district0.026316
italy0.026316
cow milk (raw)0.026316
milk0.026316
state of sabah0.026316
malaysia0.026316
gastrointestinal system0.026316
loam soil0.026316
late weichselian glaciation0.026316
clayey till0.026316
kingdom of denmark0.026316
lund0.026316
luancheng county0.026316
fertilized soil0.026316
duodenum0.026316
tibet autonomous region0.026316
dust0.019737
size < 10um0.019737
mongolia0.019737
state of utah0.019737
bos taurus0.019737
cow0.019737
barbacenia macrantha0.019737
depth (soil) 0-10cm0.019737
rumen0.019737
intestine0.019737
cow milk (fluid)0.019737
province of ontario0.019737
epidermis0.019737
bird0.019737
panax notoginseng0.019737
sanqi plants0.019737
ph 60.019737
xundian county0.019737
yunnan province0.019737
state of tabasco0.019737
cocoa mass0.019737
theobroma cacao0.019737
western australia0.019737
age 1 year0.019737
riwoqe county0.019737
age 7 weeks0.019737
wuhan0.019737
chicken0.019737
Exp. ID User ID Description Date Region Flag Sequences
565amnondominant skin, canada, canis lupus familiaris, dog2019-11-21v3No1 / 7
727amnoncommon brown dog tick, rhipicephalus sanguineus, body proper, whole body, la rioja province, kingdom of spain, tick2021-01-03v3No1 / 7
727amnoncommon red sheep tick, haemaphysalis punctata, body proper, whole body, la rioja province, kingdom of spain, tick2021-01-03v3No1 / 8
727amnoncommon ornate sheep tick, dermacentor marginatus, body proper, whole body, la rioja province, kingdom of spain, tick2021-01-03v3No1 / 10
857amnon high in control compared to bacillus thuringiensis toxin producing cotton in cotton field bollworm helicoverpa zea third instar larva stage larvae whole body state of north carolina agricultural feature 2022-01-10v3No1 / 10
565amnondominant skin, canada, sciurus carolinensis, eastern gray squirrel2019-11-21v3No1 / 11
981amnondominant alouatta pigra, monkey, wild, guatemala, department of peten, howler monkey, ear, external acoustic meatus2022-12-25v3No1 / 11
565amnondominant skin, acinonyx jubatus, cheetah, canada, zoological garden, captive, african lion safari2019-11-21v3No1 / 12
727amnondominant ixodes ricinus, body proper, whole body, la rioja province, kingdom of spain, tick2021-01-03v3No1 / 12
585amnondominant china, pomacea canaliculata, golden apple snail, nanheng river, qingpu district, stomach2020-02-02v3No1 / 14
526amnonhigh freq. in bile of healthy controls (dominant control, kingdom of spain, adult, bile, gallbladder, homo sapiens)2019-07-14v3No1 / 16
696amnondominant helicarionidae, kaliella, kaliella scandens, state of sabah, malaysia, gastrointestinal system, stomach, land snail2028-03-27v3No1 / 16
878amnondominant pm10, municipality of beijing, china, respirable suspended particulate matter, air, city2022-03-11v3No1 / 16
981amnoncommon external acoustic meatus, ear, ngamba island, uganda, chimpanzee, pan troglodytes schweinfurthii, wild, monkey2022-12-25v3No1 / 20
981amnoncommon external acoustic meatus, ear, howler monkey, department of peten, guatemala, wild, monkey, alouatta pigra2022-12-25v3No1 / 21
565amnoncommon skin, canada, felis catus, cat2019-11-21v3No1 / 26
605amnon high in control compared to recurrent otitis media in 2-year-old human stage 1-year-old human stage australia nasopharynx child age 1-3 years perth 2020-04-07v3No1 / 27
857amnoncommon whole body, state of north carolina, agricultural feature, cotton field, third instar larva stage, larvae, bollworm, helicoverpa zea2022-01-10v3No1 / 29
526amnoncommon in bile of healthy controls (common homo sapiens, gallbladder, bile, adult, kingdom of spain, control)2019-07-14v3No1 / 39
986amnon high in feed supplement diet compared to wild diet in feces new zealand bird porphyrio hochstetteri takahe 2022-12-26v3No1 / 40
1011amnoncommon captive, italy, canary, serinus canaria, feces, bird2023-02-03v3No1 / 41
696amnoncommon helicarionidae, kaliella, kaliella scandens, state of sabah, malaysia, gastrointestinal system, stomach, land snail2028-03-27v3No1 / 43
717amnoncommon chest, torso, adult, province of ontario, canada, epidermis, skin, homo sapiens2028-05-22v3No1 / 56
717amnoncommon palm of hand, palmar part of manus, adult, province of ontario, canada, epidermis, skin, homo sapiens2028-05-22v3No1 / 57
565amnoncommon skin, canada, equus caballus, horse, farm2019-11-21v3No1 / 58
717amnoncommon plantar part of pes, bottom of foot, adult, province of ontario, canada, epidermis, skin, homo sapiens2028-05-22v3No1 / 58
682amnoncommon city, madrid, kingdom of spain, air2028-03-04v3No1 / 67
789amnoncommon in traditionally harvested cocoa pulp before fementation (common state of tabasco, cocoa strain criollo, mexico, cocoa mass, theobroma cacao)2021-06-01v3No1 / 67
727amnoncommon ixodes ricinus, body proper, whole body, la rioja province, kingdom of spain, tick2021-01-03v3No1 / 69
742amnoncommon dalian city prefecture, captive, zoological garden, china, pygoscelis papua, gentoo penguin, bird, feces2021-02-18v3No1 / 70
653amnon high in tongue dermal layer of tongue compared to saliva in third decade human stage homo sapiens adult canada toronto 2020-09-13v3No1 / 72
934amnon high in jejunal mucosa compared to lumen of jejunum in age 7 weeks wuhan china chicken gallus gallus jejunum research facility 2022-09-18v3No1 / 72
934amnoncommon lumen of jejunum, age 7 weeks, wuhan, china, chicken, gallus gallus, jejunum, research facility2022-09-18v3No1 / 73
948amnoncommon egg chorion, black soldier fly, hermetia illucens, research facility, tours, french republic2022-12-05v3No1 / 80
789amnoncommon in traditionally harvested cocoa pulp before fementation (common cocoa strain forasterio, state of tabasco, mexico, cocoa mass, theobroma cacao)2021-06-01v3No1 / 82
279amnoncommon grassland, leaf, stem, steppe, mongolia, china2018-01-24v4No1 / 83
565amnoncommon skin, canada, canis lupus familiaris, dog2019-11-21v3No1 / 83
565amnoncommon skin, canada, eidolon helvum, fruit bat, zoological garden, toronto zoo, captive2019-11-21v3No1 / 83
997amnon high in iron deficiency anemia compared to no iron deficiency anemia in dental caries dental caries shandong province 6-year-old human stage 2-5 year-old child stage saliva china child 2022-12-30v3No1 / 89
899amnoncommon in snail intestine from heavy metal contaminated greenhouse (common greenhouse, heavy metal contaminated soil, land snail, bradybaena ravida, china, sedum alfredii, heavy metal, zhejiang province, intestine)2022-04-25v3No1 / 90
565amnoncommon skin, canada, captive, zoological garden, rangifer tarandus, reindeer, african lion safari2019-11-21v3No1 / 96
565amnoncommon skin, canada, sciurus carolinensis, eastern gray squirrel2019-11-21v3No1 / 104
587amnoncommon israel, food product type, alfalfa sprouts, medicago sativa, producer c12020-02-10v3No1 / 106
565amnoncommon skin, canada, pteropus giganteus, indian flying fox, zoological garden, captive, african lion safari2019-11-21v3No1 / 109
899amnoncommon in snail intestine from phytoremedation field (common phytoremedation field, field, heavy metal contaminated soil, land snail, bradybaena ravida, china, sedum alfredii, heavy metal, zhejiang province, intestine)2022-04-25v3No1 / 110
565amnoncommon skin, canada, zoological garden, captive, toronto zoo, equus przewalskii, wild horse2019-11-21v3No1 / 112
565amnoncommon skin, canada, zoological garden, captive, toronto zoo, arctic wolf, canis lupus arctos2019-11-21v3No1 / 114
758amnoncommon in cigar tobacco (common cheyenne menthol box cigar, tobacco, nicotiana tabacum, cigar)2021-03-28v3No1 / 115
789amnonhigh in unfemented compared to fermented cocoa mass ( high in time 0 compared to fermented cocoa mass time 5 days in state of tabasco mexico cocoa mass theobroma cacao )2021-06-01v3No1 / 121
565amnoncommon skin, canada, captive, zoological garden, african lion safari, camelus bactrianus, bactrian camel2019-11-21v3No1 / 122
565amnoncommon skin, canada, zoological garden, captive, african lion safari, ceratotherium simum, white rhinoceros2019-11-21v3No1 / 122
565amnoncommon skin, acinonyx jubatus, cheetah, canada, zoological garden, captive, african lion safari2019-11-21v3No1 / 123
758amnoncommon in cigar tobacco (common swisher sweets original cigar, tobacco, nicotiana tabacum, cigar)2021-03-28v3No1 / 127
934amnoncommon jejunal mucosa, age 7 weeks, wuhan, china, chicken, gallus gallus, jejunum, research facility2022-09-18v3No1 / 127
758amnoncommon in cigar tobacco (common cheyenne full flavor cigar, tobacco, nicotiana tabacum, cigar)2021-03-28v3No1 / 128
827sheryoHigher in soil depth of 275cm compared to soil depth of 60cm in clayey till loam soil, Lund Denmark ( high in depth 200-350cm compared to depth 20-120cm in lund kingdom of denmark agricultural field clayey till late weichselian glaciation loam soil )2021-09-13v3No1 / 129
585amnoncommon china, pomacea canaliculata, golden apple snail, nanheng river, qingpu district, buccal mass2020-02-02v3No1 / 136
514amnoncommon united states of america, state of utah, sandstone, grand staircase-escalante national park, desert, depth (soil) 0-1cm2019-03-25v4No1 / 139
855sheryoCommon in soil depth of 800cm in fertilized soil in china (common depth 800cm, luancheng county, china, agricultural field, fertilized soil, soil)2021-12-27v3No1 / 142
666amnoncommon zoological garden, hippopotamus amphibius, italy, feces2020-09-25v3No1 / 146
565amnoncommon skin, canada, captive, panthera leo, lion, zoological garden, toronto zoo2019-11-21v3No1 / 150
758amnoncommon in cigar tobacco (common swisher sweets sweet cherry cigar, tobacco, nicotiana tabacum, cigar)2021-03-28v3No1 / 154
408amnon high in larval stage compared to stomach in ant costa rica united states of america pseudomyrmex spinicola 2018-11-22v4No1 / 165
855sheryoCommon in soil depth of 175cm in fertilized soil in china (common depth 175cm, luancheng county, china, agricultural field, fertilized soil, soil)2021-12-27v3No1 / 173
565amnoncommon skin, canada, zoological garden, captive, toronto zoo, pongo abelii, sumatran orangutan2019-11-21v3No1 / 174
585amnoncommon china, pomacea canaliculata, golden apple snail, nanheng river, qingpu district, stomach2020-02-02v3No1 / 194
905amnoncommon duodenum, western australia, sheep, age 1 year, australia, ovis aries, research facility2022-05-18v3No1 / 200
878amnoncommon pm10, respirable suspended particulate matter, city, municipality of beijing, china, air2022-03-11v3No1 / 203
298amnonlower in wetted soil 18hrs compared to dried soil ( high in dry compared to irrigated in soil desert united states of america state of utah depth 1cm soil crust )2018-02-20v4No1 / 205
565amnoncommon skin, canada, ammotragus lervia, barbary sheep, zoological garden, captive, african lion safari2019-11-21v3No1 / 205
360amnoncommon agave, desert, leaf, leaf surface, mexico, guanajuato, agave tequiliana, cultivated environment2018-08-21v4No1 / 210
587amnoncommon israel, food product type, alfalfa sprouts, medicago sativa, producer c22020-02-10v3No1 / 215
466amnoncommon in cow feces left in field for 30-60 days (common feces, bos taurus, cow, farm, united states of america, state of georgia, late timepoints, 30-60 days)2019-01-14v4No1 / 221
585amnoncommon china, pomacea canaliculata, golden apple snail, nanheng river, qingpu district, intestine2020-02-02v3No1 / 240
855sheryoCommon in soil depth of 350cm in fertilized soil in china (common depth 350cm, luancheng county, china, agricultural field, fertilized soil, soil)2021-12-27v3No1 / 242
617amnoncommon lowland pasture, lowland farm, farm, italy, cow milk (raw), cow milk (fluid), milk2020-05-03v3No1 / 257
951amnoncommon mirs bay, depth (water) 20-100cm, coast, china, surface water, sea water2022-12-08v3No1 / 263
931amnoncommon jejunum, duodenum, riwoqe county, china, yak, tibet autonomous region, bos grunniens2022-08-25v3No1 / 270
948amnon high in fully formed stage compared to larva larval stage in black soldier fly hermetia illucens research facility tours french republic 2022-12-05v3No1 / 272
752sheryoHigher in treatments without biochar compared to treatments with biochar in soil planted with Panax notoginseng amended with 2% biochar ( high in without biochar compared to biochar in panax notoginseng sanqi plants ph 6 xundian county yunnan province china pot expreiment soil )2021-03-11v3No1 / 273
128amnonhigher in ivy leaves from city compared to moor and forest ( high in city dense settlement biome compared to moor forest ecosystem in hedera hibernica belgium ivy leaf )2017-04-14v4No1 / 287
653amnon high in tongue dermal layer of tongue compared to dentition supragingival plaque supragingival dental plaque in third decade human stage toronto canada adult homo sapiens 2020-09-13v3No1 / 306
565amnoncommon skin, canada, zoological garden, captive, african lion safari, giraffa camelopardalis, giraffe2019-11-21v3No1 / 310
565amnoncommon skin, canada, farm, bos taurus, cow2019-11-21v3No1 / 318
855sheryoHigher in soil depth of 175cm compared to soil depth of 75cm in fertilized soil in china ( high in depth 175cm compared to depth 75cm in luancheng county china agricultural field fertilized soil soil )2021-12-27v3No1 / 334
565amnoncommon skin, canada, equus asinus africanus, donkey, farm2019-11-21v3No1 / 335
129amnoncommon mexico, myrtillocactus geometrizans, opuntia robusta, cactus, rhizosphere, semi-arid2017-04-15v4No1 / 338
888amnoncommon milk collection tanker, cow milk (raw), cow milk (fluid), ireland, milk2022-03-30v3No1 / 353
565amnoncommon skin, canada, macropus rufus, red kangaroo, zoological garden, captive, african lion safari2019-11-21v3No1 / 360
565amnoncommon skin, canada, papio anubis, olive baboon, zoological garden, captive, toronto zoo2019-11-21v3No1 / 368
951amnoncommon in ocean water close to river outlet (common depth (water) 20-100cm, coast, deep bay, china, surface water, sea water)2022-12-08v3No1 / 372
582amnon high in ear canal external acoustic meatus compared to perianal skin rectum in wild united states of america santa catalina island urocyon littoralis santa catalina island fox urocyon littoralis catalinae 2020-01-22v4No1 / 374
888amnoncommon bulk tank milk, cow milk (raw), milk, ireland2022-03-30v3No1 / 388
662amnoncommon clay soil, irrigated, neve yaar, depth (soil) 0-10cm, soil, agricultural field, israel2020-09-21v3No1 / 402
206amnonhigher in dust storm compared to clear days in israel air ( high in dust storm compared to clear day in israel air size < 10um dust )2017-10-04v4No1 / 411
28amnon high in feces achatinella mustelina compared to whole plant leaf in hawaii 2016-12-05v4No1 / 413
360amnoncommon desert, soil, mexico, guanajuato2018-08-21v4No1 / 437
758amnon high in cheyenne menthol box cigar cheyenne full flavor cigar compared to swisher sweets sweet cherry cigar swisher sweets original cigar in tobacco nicotiana tabacum cigar 2021-03-28v3No1 / 452
128amnoncommon hedera hibernica, belgium, ivy, leaf, city, dense settlement biome2017-04-14v4No1 / 461
951amnon high in deep bay compared to mirs bay in sea water surface water china coast depth (water) 20-100cm 2022-12-08v3No1 / 479
639amnon high in oryctolagus cuniculus european rabbit compared to lepus europaeus european brown hare in nature reserve adult wild australia feces 2020-08-21v3No1 / 480
786sheryoCommon in flood plain soil near cosumnes river, california, at 400-700cm depth (common depth (soil) 400-700cm, flood plain, soil, united states of america, state of california, sacramento, cosumnes river preserve)2021-05-18v3No1 / 481
360amnoncommon desert, soil, rhizosphere, agave, agave salmiana, mexico, guanajuato2018-08-21v4No1 / 484
617amnonlower in cow milk of cows in alpine pasture compared to lowland farm ( high in lowland farm lowland pasture compared to alpine pasture alpine in farm italy cow milk (raw) cow milk (fluid) milk )2020-05-03v3No1 / 484
360amnoncommon agave, desert, leaf, leaf surface, agave salmiana, mexico, guanajuato2018-08-21v4No1 / 492
548amnoncommon in leaf surface of barbacenia macrantha (common minas gerais state, campos rupestres, brazil, barbacenia macrantha, leaf, leaf surface)2019-08-17v4No1 / 550
129amnoncommon mexico, myrtillocactus geometrizans, opuntia robusta, cactus, semi-arid, leaf2017-04-15v4No1 / 562
905amnon high in jejunum ileum compared to abomasum rumen in western australia sheep age 1 year australia ovis aries research facility 2022-05-18v3No1 / 563
548amnoncommon minas gerais state, campos rupestres, brazil, barbacenia macrantha, root endosphere, root2019-08-17v4No1 / 575
914amnoncommon tibet autonomous region, qinghai province, bos grunniens, yak, feces2022-06-26v3No1 / 575
762sheryoHigh in bulk soil compared to rhizosphere of a pot experiment with lettuce planted in albic luvisol Germany ( high in bulk soil compared to rhizosphere in thyrow albic luvisol germany haplic luvisol pot expreiment lettuce soil )2021-04-08v3No1 / 578
931amnon high in jejunum duodenum compared to ruminal fluid rumen in riwoqe county china yak tibet autonomous region bos grunniens 2022-08-25v3No1 / 622
813amnoncommon severed branch, epiphytic material, united states of america, state of washington, olympic national park, canopy soil, soil2021-06-22v4No1 / 633
360amnoncommon desert, soil, state of california2018-08-21v4No1 / 637
827sheryoCommon in soil at 230cm depth in clayey till loam soil, Lund Denmark (common depth 200-260cm, loam soil, late weichselian glaciation, clayey till, agricultural field, kingdom of denmark, lund)2021-08-24v3No1 / 644
360amnoncommon agave, desert, state of california, agave deserti, leaf, leaf surface2018-08-21v4No1 / 649
548amnoncommon minas gerais state, campos rupestres, brazil, barbacenia macrantha, rhizosphere2019-08-17v4No1 / 651
466amnonhigher in cow feces left in field for 30-60 days compared to initial feces ( high in late timepoints 30-60 days compared to early timepoints 0-2 days in feces bos taurus cow farm united states of america state of georgia )2019-01-14v4No1 / 662
561amnoncommon bos grunniens, yak, china, tibetan plateau, alpine meadow, rumen, ruminal fluid2019-11-05v3No1 / 670
565amnoncommon skin, canada, zoological garden, captive, tragelaphus oryx, eland, toronto zoo2019-11-21v3No1 / 674
762sheryoCommon in bulk soil of a pot experiment with lettuce planted in organic fertilized albic luvisol from Germany (common manured soil, manure fertilization, germany, organic fertilization, soil, bulk soil, thyrow, albic luvisol, ph 6.4, lettuce, pot expreiment)2021-04-07v3No1 / 704
752sheryoCommon in soil planted with Panax notoginseng (common panax notoginseng, sanqi plants, ph 6, xundian county, yunnan province, china, pot expreiment, soil)2021-03-11v3No1 / 730
735amnoncommon restricted feed, research facility, nanjing city prefecture, china, pregnancy, digesta, rumen, female organism, female, sheep, ovis aries2021-01-22v3No1 / 744
735amnoncommon control, research facility, nanjing city prefecture, china, pregnancy, digesta, rumen, female organism, female, sheep, ovis aries2021-01-22v3No1 / 761
206amnoncommon in air from israel particles <10um size (common air, dust, israel, size < 10um, clear day)2017-10-04v4No1 / 765
813amnonlower in epiphytic materiall attached to intact branch compared to severed suspended branch ( high in severed branch compared to intact branch in epiphytic material united states of america state of washington olympic national park canopy soil soil )2021-06-22v4No1 / 768
752sheryoCommon in soil planted with Panax notoginseng amended with2% biochar (common biochar, panax notoginseng, sanqi plants, ph 6, xundian county, yunnan province, china, pot expreiment, soil)2021-03-11v3No1 / 783
827sheryoCommon in soil at 465cm depth in clayey till loam soil, Lund Denmark (common depth 450-480cm, lund, kingdom of denmark, agricultural field, clayey till, late weichselian glaciation, loam soil)2021-09-13v3No1 / 786
824sheryoHigher at 0-10cm depth compared to 10-20cm depth in soil after grazing exclusion at 0-10cm depth, Ningxia china ( high in depth (soil) 0-10cm compared to depth 10-20cm in yunwushan national natural grassland protection zone ningxia province calci-orthic aridisol haplic calcisol grazing exclusion china soil )2021-08-08v4No1 / 807
232amnonlower in diabetec foot ulcers compared to non-ulcer skin in diabetic patients ( high in control compared to wound ulcer in homo sapiens skin australia foot diabetes mellitus )2017-11-05v4No1 / 836
827sheryoCommon in soil at 325cm depth in clayey till loam soil, Lund Denmark (common lund, kingdom of denmark, agricultural field, clayey till, late weichselian glaciation, loam soil, depth 300-350cm)2021-08-24v3No1 / 866
854sheryoCommon in soil depth of 75-100cm of colluvial soil, Czech rebuplic (common depth 75-100cm, calcic chernozem, colluvial soil, ph 8, south moravian region, czech republic, soil)2021-12-23v3No1 / 879
129amnoncommon ph 6-6.5, mexico, myrtillocactus geometrizans, opuntia robusta, cactus, semi-arid, soil2017-04-15v4No1 / 884
854sheryoCommon in soil depth of 200-250cm of colluvial soil, Czech rebuplic (common depth 200-250cm, calcic chernozem, colluvial soil, ph 8, south moravian region, czech republic, soil)2021-12-23v3No1 / 894
206amnoncommon in dust storm air from israel particles <10um size (common israel, air, size < 10um, dust, dust storm)2017-10-04v4No1 / 902
548amnoncommon minas gerais state, campos rupestres, brazil, rock2019-08-17v4No1 / 924
129amnoncommon ph 6-6.5, mexico, myrtillocactus geometrizans, opuntia robusta, cactus, semi-arid, soil, root zone soil2017-04-15v4No1 / 968
931amnon high in jejunum duodenum compared to ileum feces colon caecum in tibet autonomous region riwoqe county china yak bos grunniens 2022-08-25v3No1 / 970
979amnon high in sediment depth 20-50cm compared to sediment depth 0-5cm in aldabra atoll seychelles sediment 2022-12-24v3No1 / 970
266amnoncommon in soil from MIL garden (common soil, united states of america, state of idaho, ph 6.5)2017-12-18v4No1 / 980
360amnon high in soil compared to agave rhizosphere in desert mexico state of california 2018-08-21v4No1 / 992
905amnon high in ileum jejunum compared to feces colon caecum in western australia sheep age 1 year australia ovis aries research facility 2022-05-18v3No1 / 1092
298amnoncommon soil, desert, united states of america, state of utah, depth 1cm, soil crust2018-02-20v4No1 / 1265
783sheryocommon in desert soil in mongolia without water addition treatment (common no water addition, ambient precipitation, ph 7.85, luvic gypsisols, cambic arenosols, china, mongolia, dengkou county, ulan buh desert, bajada, sandy desert, soil)2021-05-11v4No1 / 1324
76amnoncommon in non-seleniferous soil (common soil, rhizosphere, united states of america, non-seleniferous, state of florida)2017-02-28v4No1 / 1414
783sheryocommon in desert soil in mongolia under water addition treatment (common 100% above ambient precipitation, water addition, ph 7.85, luvic gypsisols, cambic arenosols, china, mongolia, dengkou county, ulan buh desert, bajada, sandy desert, soil)2021-05-11v4No1 / 1442
76amnonhigher in non-seleniferous soil compared to seleniferous soil ( high in non-seleniferous compared to selenium seleniferous in soil united states of america rhizosphere woodland area )2017-02-28v4No1 / 1621
824sheryoCommon in soil after 27-35 years of grazing exclusion at 0-10cm depth, Ningxia china (common yunwushan national natural grassland protection zone, ningxia province, calci-orthic aridisol, haplic calcisol, 27-35 years of grazing exclusion, grazing exclusion, china, depth (soil) 0-10cm, soil)2021-08-08v4No1 / 1659
696amnon high in alycaeus jagori compared to opisthostoma concinnum plectostoma concinnum in land snail stomach gastrointestinal system malaysia state of sabah 2028-03-28v3No1 / 1672
696amnon high in alycaeus jagori compared to georissa similis georissa in land snail stomach gastrointestinal system malaysia state of sabah 2028-03-28v3No1 / 1698
155amnonhigher in tightly bound root soil compared to loose soil and bulk soil ( high in root compared to bulk soil in triticum aestivum wheat soil china )2017-07-02v4No1 / 1714
618amnon high in rhizosphere compared to root endosphere root in canada farm cannabis sativa 2020-05-04v4No1 / 3134

Problems / suggestions? Please email info AT dbbact DOT org