Search result for sequence:
TACGAAGGGGGCTAGCGTTGCTCGGAATCACTGGGCGTAAAGGGCGCGTAGGCGGCGTTTTAAGTCGGGGGTGAAAGCCTGTGGCTCAACCACAGAATGGCCTTCGATACTGGGACGCTTGAGTATGGTAGAGGTTGGTGGAACTGCGAG
common ontology terms
term enrichment score
TermScore
soil0.220782
skin0.219231
united states of america0.215322
china0.172227
leaf0.159130
rhizosphere0.131488
canada0.105528
water0.102346
cultivated environment0.093023
brazil0.087409
fresh water0.080000
stem0.078844
air0.070141
homo sapiens0.068873
mucus0.064927
citrus0.062663
river0.062570
costa rica0.062016
southern united states0.062016
plant0.060606
triticum aestivum0.060606
snake0.060150
ocean0.059165
mexico0.056711
coral0.056711
state of tennessee0.055191
state of florida0.052395
drinking water0.050980
root0.050795
desert0.050129
research facility0.049519
larval stage0.049103
ant0.047809
tree0.047359
populus0.047244
whole body0.046422
zhejiang province0.046154
farm0.046086
zea mays0.045802
intestine0.045405
kingdom of spain0.045217
captive0.042254
agricultural field0.041667
zoological garden0.040816
wild0.040650
digestive system0.039735
minas gerais state0.039683
campos rupestres0.039683
pair of nares0.039422
wheat0.039293
adult0.039280
feces0.037655
depth (soil) 0-20cm0.036866
leaf surface0.036345
state of california0.036265
frog0.036116
ph 60.035857
greenhouse0.035225
summer0.034143
state of new york0.033180
agricultural feature0.032907
cactus0.032258
pyrenees0.032000
orchard0.032000
silt loam0.031496
city0.031169
depth (soil) 0-10cm0.030848
austria0.030769
winter0.028571
paddy field soil0.028311
jejunum0.028212
agave0.028112
shaanxi province0.028112
oryza sativa0.027981
glycine max0.027981
state of idaho0.027723
loess plateau0.027723
monkey0.027438
pond0.027158
stomach0.026735
LOWER IN soil0.026692
state of north carolina0.026616
new york city0.026266
australia0.025594
vitis vinifera0.024341
heilongjiang province0.024341
land snail0.024341
myrtillocactus geometrizans0.024194
opuntia robusta0.024194
north china plain0.024194
tadpole0.024194
guanajuato0.024194
forest ecosystem0.024121
semi-arid0.023904
beetle0.023904
duodenum0.023833
belgium0.023622
bird0.022814
united kingdom0.022556
depth (water) 10cm0.020243
Fraction of dbbact annotations with this term covered by the query
TermScore
uganda1.000000
sarapiqui canton1.000000
cane toad1.000000
bufo marinus1.000000
turrialba canton1.000000
rhinella marina1.000000
municipality of bayamon1.000000
cuticle1.000000
chitin-based cuticle1.000000
atlantic rainforest1.000000
parque estadual serra do mar-nĂșcleo picinguaba1.000000
odontomachus hastatus1.000000
sao paulo state1.000000
LOWER IN reserva biológica de mogi-guaçu1.000000
odontomachus chelifer1.000000
9-month-old human stage1.000000
edo state1.000000
LOWER IN 9-month-old human stage1.000000
meconium1.000000
15-month-old human stage1.000000
marmosets1.000000
callithrix <genus>1.000000
isla coronado norte1.000000
bristlemouths1.000000
gonostomatidae <vertebrata>1.000000
lanternfish1.000000
myctophidae1.000000
qiao nature reserve1.000000
sonneratia apetala1.000000
riwoqe county1.000000
jejunal mucosa1.000000
age 7 weeks1.000000
wuhan1.000000
fully formed stage1.000000
cicada1.000000
magicicada1.000000
banana1.000000
musa acuminata1.000000
sugar kelp1.000000
saccharina latissima1.000000
sediment depth 20-50cm1.000000
aldabra atoll1.000000
seychelles1.000000
department of peten1.000000
ear1.000000
ngamba island1.000000
LOWER IN wild diet1.000000
feed supplement diet1.000000
porphyrio hochstetteri1.000000
takahe1.000000
river water1.000000
fuzhou city prefecture1.000000
xiyuan river1.000000
fall1.000000
stem0.857143
leaf surface0.800000
leaf0.761905
root endosphere0.750000
cultivated environment0.750000
whole plant0.666667
seed0.666667
nicotiana tabacum0.666667
arm0.666667
venezuela0.666667
amerindian0.666667
uropygial gland0.666667
rana catesbeiana0.666667
bullfrog0.666667
vitis vinifera0.666667
grape0.666667
particles0.666667
site e0.666667
cactus0.666667
dust0.666667
soybean0.666667
corn0.666667
floor0.666667
osteopilus septentrionalis0.666667
state of connecticut0.666667
toad0.666667
ant0.666667
heilongjiang province0.666667
paddy field soil0.666667
ixodes ricinus0.666667
land snail0.666667
frog0.625000
air0.615385
state of tennessee0.600000
citrus0.600000
river0.583333
jejunum0.571429
skin0.558824
LOWER IN sebum0.500000
achatinella mustelina0.500000
environmental system determined by an organism0.500000
maryland county0.500000
field soil0.500000
human0.500000
skin under eye0.500000
contact lens0.500000
Fraction of annotations for the query sequences containing the term
TermScore
united states of america0.283058
china0.171488
soil0.169421
skin0.136364
leaf0.088843
rhizosphere0.078512
homo sapiens0.072314
canada0.068182
water0.064050
cultivated environment0.049587
brazil0.049587
fresh water0.045455
plant0.045455
stem0.041322
research facility0.037190
air0.037190
mucus0.035124
feces0.035124
ocean0.035124
citrus0.033058
river0.033058
adult0.033058
triticum aestivum0.033058
costa rica0.033058
snake0.033058
southern united states0.033058
mexico0.030992
coral0.030992
state of tennessee0.028926
state of florida0.028926
root0.026860
drinking water0.026860
larval stage0.026860
farm0.026860
desert0.026860
tree0.026860
kingdom of spain0.026860
intestine0.024793
ant0.024793
zea mays0.024793
zhejiang province0.024793
populus0.024793
whole body0.024793
captive0.024793
digestive system0.022727
depth (soil) 0-20cm0.022727
wild0.022727
zoological garden0.022727
agricultural field0.022727
pair of nares0.020661
wheat0.020661
state of california0.020661
minas gerais state0.020661
campos rupestres0.020661
state of new york0.018595
ph 60.018595
summer0.018595
agricultural feature0.018595
frog0.018595
leaf surface0.018595
greenhouse0.018595
city0.016529
cactus0.016529
LOWER IN soil0.016529
winter0.016529
depth (soil) 0-10cm0.016529
austria0.016529
pyrenees0.016529
orchard0.016529
silt loam0.016529
new york city0.014463
oryza sativa0.014463
australia0.014463
jejunum0.014463
state of idaho0.014463
glycine max0.014463
stomach0.014463
pond0.014463
monkey0.014463
agave0.014463
paddy field soil0.014463
state of north carolina0.014463
loess plateau0.014463
shaanxi province0.014463
forest ecosystem0.012397
vitis vinifera0.012397
LOWER IN control0.012397
belgium0.012397
myrtillocactus geometrizans0.012397
opuntia robusta0.012397
semi-arid0.012397
bird0.012397
united kingdom0.012397
duodenum0.012397
north china plain0.012397
tadpole0.012397
LOWER IN feces0.012397
guanajuato0.012397
heilongjiang province0.012397
beetle0.012397
Exp. ID User ID Description Date Region Flag Sequences
894amnon high in diaporthe citri plant disease compared to control in citrus unshiu china endosphere citrus zhejiang province leaf orchard 2022-04-11v4No1 / 3
418amnoncommon coral, favites abdita, mucus, ocean2018-12-02v4No1 / 5
418amnondominant coral, favites abdita, mucus, ocean2018-12-02v4No1 / 6
408amnoncommon ant, costa rica, united states of america, pseudomyrmex gracilis, larval stage2018-11-22v4No1 / 7
418amnoncommon coral, ocean, porites lobata, mucus2018-12-02v4No1 / 7
727amnoncommon brown dog tick, rhipicephalus sanguineus, body proper, whole body, la rioja province, kingdom of spain, tick2021-01-03v3No1 / 7
148amnonhigher in sample blanks compared to other samples (contamination)2017-04-20v4No1 / 8
235amnoncommon in ocean water above eelgrass from various northern hemisphere sites (common water, sea water)2017-11-07v4No1 / 8
418amnondominant coral, ocean, porites lobata, mucus2018-12-02v4No1 / 8
727amnoncommon red sheep tick, haemaphysalis punctata, body proper, whole body, la rioja province, kingdom of spain, tick2021-01-03v3No1 / 8
58amnondominant homo sapiens, new york city, conjunctiva2017-02-02v4No1 / 10
418amnoncommon coral, ocean, acropora hyacinthus, mucus2018-12-02v4No1 / 10
727amnoncommon ornate sheep tick, dermacentor marginatus, body proper, whole body, la rioja province, kingdom of spain, tick2021-01-03v3No1 / 10
403amnondominant spring, air, kingdom of spain, pyrenees2018-11-18v4No1 / 11
418amnondominant coral, ocean, pocillopora damicornis, mucus2018-12-02v4No1 / 11
499amnondominant brazil, pond, digestive system, intestine, dendropsophus minutus, frog, tadpole2019-03-05v4No1 / 11
981amnondominant alouatta pigra, monkey, wild, guatemala, department of peten, howler monkey, ear, external acoustic meatus2022-12-25v3No1 / 11
118amnoncommon butterfly, heliconius erato, panama, tropical and subtropical moist broadleaf forest biome, feces, larval stage, caterpillar, frass, forest ecosystem2017-04-11v4No1 / 12
129amnondominant mexico, myrtillocactus geometrizans, opuntia robusta, cactus, semi-arid, leaf2017-04-15v4No1 / 12
367amnondominant air, namibia, coast2018-09-02v4No1 / 12
462amnondominant united states of america, state of tennessee, populus, tree, populus trichocarpa x deltoides, stem, cultivated environment2019-01-13v4No1 / 12
536amnondominant snake, skin, united states of america, southern united states, agkistrodon contortrix, copperhead snake2019-07-28v4No1 / 12
418amnondominant coral, ocean, stylophora pistillata, mucus2018-12-02v4No1 / 13
58amnon high in skin skin under eye compared to conjunctiva in human new york city 2017-02-02v4No1 / 14
58amnondominant homo sapiens, new york city, skin of face, skin under eyes2017-02-02v4No1 / 14
232amnoncommon in foot ulcer of diabetic patients (common homo sapiens, skin, australia, foot, wound, ulcer, diabetes mellitus)2017-11-05v4No1 / 14
237amnondominant bird, oceanodroma leucorhoa, seabird, canada, bon portage island, brood patch2017-11-07v4No1 / 14
360amnondominant agave, desert, leaf, leaf surface, agave salmiana, mexico, guanajuato2018-08-21v4No1 / 14
403amnondominant air, kingdom of spain, pyrenees, winter2018-11-18v4No1 / 14
408amnon high in larval stage compared to stomach in ant cephalotes costa rica united states of america 2018-11-22v4No1 / 14
418amnondominant coral, ocean, diploastrea heliopora, mucus2018-12-02v4No1 / 14
960amnondominant homo sapiens, nigeria, edo state, feces, infant, newborn human stage, meconium2022-12-20v4No1 / 14
981amnoncommon howler monkey, department of peten, guatemala, wild, nasal cavity, monkey, alouatta pigra2022-12-25v3No1 / 14
58amnondominant homo sapiens, new york city, contact lens2017-02-02v4No1 / 15
408amnoncommon ant, costa rica, united states of america, pseudomyrmex flavicornis, larval stage2018-11-22v4No1 / 15
418amnondominant coral, ocean, seriatopora caliendrum, mucus2018-12-02v4No1 / 15
432amnondominant united states of america, plant, state of north carolina, stem, tsuga dumosa, himalayan hemlock2018-12-19v4No1 / 15
536amnondominant snake, skin, united states of america, southern united states, fossorial snake, storeria dekayi, ground snake2019-07-28v4No1 / 15
397amnondominant panama, digestive system, intestine, fungus growing ant, atta sexdens2018-11-14v4No1 / 16
408amnoncommon ant, cephalotes, costa rica, united states of america, larval stage2018-11-22v4No1 / 16
536amnondominant crotalus horridus, snake, skin, united states of america, southern united states, timber rattlesnake2019-07-28v4No1 / 16
696amnondominant helicarionidae, kaliella, kaliella scandens, state of sabah, malaysia, gastrointestinal system, stomach, land snail2028-03-27v3No1 / 16
68amnonfound in some aphid samples (prevalence <=0.1) (other cinara)2017-02-20v4No1 / 17
237amnondominant bird, oceanodroma leucorhoa, seabird, canada, bon portage island, uropygial gland2017-11-07v4No1 / 17
418amnondominant coral, ocean, acropora hyacinthus, skeleton2018-12-02v4No1 / 17
418amnondominant coral, ocean, acropora hyacinthus, tissue2018-12-02v4No1 / 17
432amnondominant united states of america, plant, state of north carolina, stem, tsuga chinensis, chinese hemlock2018-12-19v4No1 / 17
235amnoncommon in eelgrass leaf (common ocean, eelgrass, zostera marina, leaf)2017-11-07v4No1 / 18
403amnondominant air, kingdom of spain, pyrenees, autumn2018-11-18v4No1 / 18
408amnoncommon ant, costa rica, united states of america, pseudomyrmex nigropilosus, larval stage2018-11-22v4No1 / 18
515amnoncommon poland, whole body, beetle, plant, nida basin, herbivorous beetle, eusomus ovulum2019-04-18v4No1 / 18
536amnondominant snake, skin, united states of america, southern united states, thamnophis sirtalis, common garter snake2019-07-28v4No1 / 18
894amnondominant citrus unshiu, china, leaf surface, citrus, zhejiang province, leaf, orchard2022-04-11v4No1 / 18
101amnoncommon state of new york, united states of america, vitis vinifera, merlot, grapevine, grape, botanical fruit food product2017-04-03v4No1 / 19
146amnondominant united states of america, solanum lycopersicum, tomato, botanical fruit food product2017-04-20v4No1 / 19
408amnoncommon ant, costa rica, united states of america, crematogaster, larval stage2018-11-22v4No1 / 19
418amnoncommon coral, ocean, seriatopora caliendrum, skeleton2018-12-02v4No1 / 20
536amnondominant snake, skin, united states of america, southern united states, coluber constrictor, eastern racer snake2019-07-28v4No1 / 20
981amnoncommon external acoustic meatus, ear, ngamba island, uganda, chimpanzee, pan troglodytes schweinfurthii, wild, monkey2022-12-25v3No1 / 20
58amnoncommon homo sapiens, new york city, skin of face, skin under eyes2017-02-02v4No1 / 21
536amnondominant snake, skin, united states of america, southern united states, diadophis punctatus, ringneck snake, fossorial snake2019-07-28v4No1 / 21
782amnondominant skin, dicentrarchus labrax, seabass, open water pond, ria formosa, portuguese republic, fish farm2021-05-07v4No1 / 21
782amnondominant gill, dicentrarchus labrax, seabass, open water pond, ria formosa, portuguese republic, fish farm2021-05-07v4No1 / 21
981amnoncommon external acoustic meatus, ear, howler monkey, department of peten, guatemala, wild, monkey, alouatta pigra2022-12-25v3No1 / 21
399amnoncommon feces, united states of america, zoological garden, state of tennessee, ailurus fulgens, red panda2018-11-16v4No1 / 22
403amnondominant air, kingdom of spain, pyrenees, summer2018-11-18v4No1 / 22
408amnoncommon ant, costa rica, united states of america, pseudomyrmex spinicola, larval stage2018-11-22v4No1 / 22
58amnoncommon homo sapiens, new york city, contact lens2017-02-02v4No1 / 23
109amnondominant water, drinking water, united states of america, site b2017-04-08v4No1 / 23
408amnoncommon ant, costa rica, united states of america, larval stage, pseudomyrmex simplex2018-11-22v4No1 / 23
418amnondominant coral, ocean, acropora hyacinthus, mucus2018-12-02v4No1 / 23
432amnondominant united states of america, plant, state of north carolina, stem, tsuga canadensis, eastern hemlock2018-12-19v4No1 / 23
544amnoncommon flower, vaccinium macrocarpon, american cranberry, united states of america, commonwealth of massachusetts2019-08-04v4No1 / 25
29amnoncommon in various plant seeds ( high in compared to in french republic seed )2016-12-05v4No1 / 26
536amnoncommon snake, skin, united states of america, southern united states, diadophis punctatus, ringneck snake, fossorial snake2019-07-28v4No1 / 26
565amnoncommon skin, canada, felis catus, cat2019-11-21v3No1 / 26
975amnoncommon isla coronado norte, depth (water) 500-1000m, bristlemouths, gonostomatidae <vertebrata>, intestine, hindgut, gut content, pacific ocean, fish2022-12-24v4No1 / 27
58amnoncommon homo sapiens, new york city, conjunctiva2017-02-02v4No1 / 28
462amnoncommon united states of america, state of tennessee, populus, tree, leaf, cultivated environment2019-01-13v4No1 / 28
129amnonfound INSIDE roots of cactus (common mexico, myrtillocactus geometrizans, opuntia robusta, cactus, semi-arid, root interior, root)2017-04-15v4No1 / 29
462amnoncommon united states of america, state of tennessee, populus, tree, stem, populus deltoides, cultivated environment2019-01-13v4No1 / 29
109amnon high in water treatment plant compared to distribution system in water drinking water united states of america site b 2017-04-08v4No1 / 30
109amnoncommon water, drinking water, united states of america, site b2017-04-08v4No1 / 31
189amnonhigherin stems of grape vines with pierce disease compared to control ( high in xylella fastidiosa temecula1 pierce disease compared to control in united states of america state of california grape vitis vinifera stem endosphere )2017-08-30v4No1 / 31
101amnoncommon state of new york, united states of america, leaf, vitis vinifera, merlot, grapevine2017-04-03v4No1 / 32
403amnoncommon spring, air, kingdom of spain, pyrenees2018-11-18v4No1 / 32
37amnoncommon maryland county, leaf, solanum lycopersicum2016-12-09v4No1 / 33
418amnoncommon coral, ocean, pavona varians, mucus2018-12-02v4No1 / 34
146amnoncommon united states of america, solanum lycopersicum, tomato, botanical fruit food product2017-04-20v4No1 / 35
536amnoncommon snake, skin, united states of america, southern united states, carphophis amoenus, worm snake, fossorial snake2019-07-28v4No1 / 35
180amnoncommon dermanyssus gallinae, red poulty mite, czech republic, poulty farm, adult2017-08-14v4No1 / 36
311amnoncommon united states of america, state of rhode island, radish, foodon product type2018-04-09v4No1 / 36
367amnoncommon air, namibia, coast2018-09-02v4No1 / 36
403amnoncommon air, kingdom of spain, pyrenees, autumn2018-11-18v4No1 / 36
749amnoncommon third decade human stage, seoul, female, south korea, adult, skin of cheek, skin, homo sapiens2021-03-10v4No1 / 36
749amnoncommon third decade human stage, skin of forehead, seoul, female, south korea, adult, skin, homo sapiens2021-03-10v4No1 / 36
960amnoncommon oral cavity, 15-month-old human stage, infant, edo state, nigeria, homo sapiens2022-12-20v4No1 / 36
232amnoncommon in foot of diabetic patients (common homo sapiens, skin, australia, foot, diabetes mellitus)2017-11-05v4No1 / 37
403amnoncommon air, kingdom of spain, pyrenees, summer2018-11-18v4No1 / 39
986amnon high in feed supplement diet compared to wild diet in feces new zealand bird porphyrio hochstetteri takahe 2022-12-26v3No1 / 40
28amnoncommon in various trees in hawaii (common hawaii, organic material, forest biome, whole plant, leaf, forest ecosystem)2016-12-05v4No1 / 41
117amnoncommon zebra fish, danio rerio, research facility, larval stage, united states of america, intestine2017-04-10v4No1 / 41
403amnoncommon air, kingdom of spain, pyrenees, winter2018-11-18v4No1 / 42
595amnoncommon ixodes ricinus, castor bean tick, whole body, switzerland2020-03-16v4No1 / 42
763amnon high in depth 20-100cm subsurface compared to depth 0-20cm surface in filtered 0.2um ice glacier sweden 2021-04-10v3No1 / 42
89amnoncommon junco hyemalis, uropygial gland, commonwealth of virginia, songbird2017-03-08v4No1 / 43
189amnoncommon united states of america, state of california, grape, vitis vinifera, stem, endosphere2017-08-30v4No1 / 43
231amnoncommon in dog genitalia (common dog, canis lupus familiaris, united states of america, reproductive system, reproductive organ, genitalia)2017-11-02v4No1 / 43
547amnon high in high salt concentration compared to low salt concentration in red pepper sauce capsicum annuum sichuan province china food (fermented) 2019-08-15v4No1 / 43
696amnoncommon helicarionidae, kaliella, kaliella scandens, state of sabah, malaysia, gastrointestinal system, stomach, land snail2028-03-27v3No1 / 43
110amnoncommon water, drinking water, scotland, site e2017-04-08v4No1 / 44
244amnoncommon drosophila melanogaster, fruit fly, research facility, digestive system, united kingdom2017-11-15v4No1 / 45
306amnondecreases after 2-30 days of fermentation of insiled whole plant corn ( high in fresh corn day 0 compared to fermented corn in zea mays subsp. mays corn whole plant israel )2018-03-19v4No1 / 45
818amnoncommon ileum, intestinal contents, digesta, female organism, research facility, china, age 60 weeks, hen, gallus gallus, chicken2021-07-10v3No1 / 45
638amnoncommon fermented beverage, stuttgart, germany, wine food product2020-08-21v4No1 / 46
258amnonhigher lungs of hiv pneumonia patients not treated with ceftriaxone ( high in no ceftriaxone compared to ceftriaxone in homo sapiens hiv infection uganda bronchoalveolar lavage bronchial epithelium lung pneumonia )2017-11-27v4No1 / 47
408amnon high in larval stage compared to stomach in ant costa rica united states of america pseudomyrmex flavicornis 2018-11-22v4No1 / 47
894amnoncommon orchard, zhejiang province, china, citrus unshiu, citrus, leaf, endosphere2022-04-11v4No1 / 47
89amnoncommon junco hyemalis, commonwealth of virginia, songbird, cloaca2017-03-08v4No1 / 48
109amnon high in water treatment plant compared to distribution system in united states of america water drinking water site a 2017-04-08v4No1 / 48
462amnoncommon united states of america, state of tennessee, populus, tree, populus trichocarpa x deltoides, stem, cultivated environment2019-01-13v4No1 / 48
258amnoncommon in lungs of hiv patients with pneumonia (common homo sapiens, hiv infection, uganda, bronchoalveolar lavage, bronchial epithelium, lung, pneumonia)2017-11-27v4No1 / 49
932amnon high in atlantic rainforest parque estadual serra do mar-nĂșcleo picinguaba compared to savanna reserva biolĂłgica de mogi-guaçu in stomach gaster odontomachus chelifer sao paulo state ant brazil tropical moist broadleaf forest biome 2022-08-30v4No1 / 51
321amnonhigher in mice treated with ampicillin compared to untreated mice ( high in ampicillin antibiotic compared to control in mus musculus mouse c57bl/6j feces united states of america research facility )2018-04-22v4No1 / 52
360amnoncommon agave, desert, root endosphere, agave deserti, state of california, root2018-08-21v4No1 / 52
279amnon high in small intestine stomach compared to caecum colon in pika ochotonidae china 2018-01-24v4No1 / 53
938amnoncommon fully formed stage, columbia, state of maryland, united states of america, digestive system, intestine, cicada, magicicada, insect2022-10-14v3No1 / 53
109amnoncommon united states of america, water, drinking water, site a2017-04-08v4No1 / 54
515amnoncommon poland, whole body, beetle, aphthona venustula, plant, nida basin, herbivorous beetle2019-04-18v4No1 / 54
975amnoncommon lanternfish, myctophidae, isla coronado norte, depth (water) 500-1000m, intestine, hindgut, gut content, pacific ocean, fish2022-12-24v4No1 / 54
63amnoncommon in skin in american gut (common homo sapiens, skin)2017-02-15v4No1 / 56
237amnoncommon canada, bon portage island, bird, oceanodroma leucorhoa, seabird, brood patch2017-11-07v4No1 / 57
308amnoncommon in neonatal intensive care unit floor (common united states of america, state of california, hospital, floor, dust)2018-03-31v4No1 / 57
237amnoncommon bird, oceanodroma leucorhoa, seabird, canada, bon portage island, uropygial gland2017-11-07v4No1 / 58
523amnoncommon air, building, bedroom, united states of america, chicago, state of illinois2019-07-03v4No1 / 58
565amnoncommon skin, canada, equus caballus, horse, farm2019-11-21v3No1 / 58
717amnoncommon plantar part of pes, bottom of foot, adult, province of ontario, canada, epidermis, skin, homo sapiens2028-05-22v3No1 / 58
67amnoncommon in wet processing of coffee beans (common coffea arabica, ecuador, wet processing)2017-02-19v4No1 / 59
374amnoncommon skin, costa rica, amphibia, oophaga pumilio, strawberry poison frog, frog2018-09-09v4No1 / 61
549amnoncommon acropora cervicornis, coral, puerto rico, isla palominos2019-08-17v4No1 / 62
536amnoncommon snake, skin, united states of america, southern united states, coluber constrictor, eastern racer snake2019-07-28v4No1 / 64
341amnoncommon water, drinking water, united states of america, tap water, state of illinois, fresh water2018-05-28v4No1 / 66
109amnoncommon water, drinking water, united states of america, site d2017-04-08v4No1 / 67
682amnoncommon city, madrid, kingdom of spain, air2028-03-04v3No1 / 67
921amnoncommon sarapiqui canton, costa rica, cane toad, bufo marinus, skin epidermis, skin2022-07-24v4No1 / 68
231amnoncommon in dog urine (common dog, canis lupus familiaris, united states of america, urine)2017-11-02v4No1 / 69
727amnoncommon ixodes ricinus, body proper, whole body, la rioja province, kingdom of spain, tick2021-01-03v3No1 / 69
763amnonhigher in blank compared to samples (contamination)2021-04-10v3No1 / 70
28amnoncommon hawaii, feces, terrestrial biome, achatinella mustelina, environmental system determined by an organism2016-12-05v4No1 / 71
653amnon high in tongue dermal layer of tongue compared to saliva in third decade human stage homo sapiens adult canada toronto 2020-09-13v3No1 / 72
462amnon high in populus trichocarpa x deltoides compared to populus deltoides in united states of america state of tennessee populus tree leaf cultivated environment 2019-01-13v4No1 / 76
361amnoncommon leaf, austria, greenhouse, plant, musa paradisiaca2018-08-21v4No1 / 77
974amnoncommon in feces of marmosets reintroduced to the wild (common anal swab, captive, brazil, feces, marmosets, callithrix <genus>, monkey)2022-12-24v4No1 / 78
407amnon high in wet season compared to dry season in costa rica feces monkey cebus capucinus white-faced capuchin wild 2018-11-21v4No1 / 79
26amnoncommon united states of america, felis catus, mucus, pair of nares2016-12-05v4No1 / 80
108amnon high in caecum compared to colon in state of texas research facility united states of america oreochromis niloticus nile tilapia 2017-04-07v4No1 / 80
109amnoncommon water, drinking water, united states of america, site e2017-04-08v4No1 / 80
534amnoncommon river, water, fresh water, depth (water) 10cm, koshi river, tributary, nepal, free floating, filtered 0.2um2019-07-22v4No1 / 80
279amnoncommon grassland, leaf, stem, steppe, mongolia, china2018-01-24v4No1 / 83
565amnoncommon skin, canada, canis lupus familiaris, dog2019-11-21v3No1 / 83
515amnoncommon poland, whole body, beetle, plant, nida basin, herbivorous beetle, centricnemus leucogrammus2019-04-18v4No1 / 84
311amnoncommon in salted cabbage (common cabbage, united states of america, state of rhode island, foodon product type)2018-04-09v4No1 / 85
26amnon high in pair of nares mucus compared to saliva mouth in united states of america felis catus 2016-12-05v4No1 / 86
109amnoncommon united states of america, water, drinking water, site c2017-04-08v4No1 / 86
199amnoncommon on shower wall tile (common bathroom, shower, building, tile, urban biome, united states of america, building wall)2017-10-01v4No1 / 90
79amnoncommon skin, united states of america, balaenoptera borealis, sei whale2017-03-03v4No1 / 90
26amnon high in pair of nares mucus compared to inguinal region axilla sebum in united states of america homo sapiens 2016-12-05v4No1 / 92
582amnoncommon urocyon littoralis catalinae, santa catalina island fox, santa catalina island, united states of america, wild, urocyon littoralis, external naris, pair of nares2020-01-22v4No1 / 92
306amnoncommon at whole plant corn at time 0 (common zea mays subsp. mays, corn, whole plant, israel)2018-03-19v4No1 / 96
99amnoncommon commonwealth of virginia, united states of america, skin, mucus, rana catesbeiana, bullfrog2017-04-02v4No1 / 99
462amnon high in populus trichocarpa x deltoides compared to populus deltoides in united states of america state of tennessee populus tree stem cultivated environment 2019-01-13v4No2 / 249
361amnoncommon leaf, austria, greenhouse, plant, dracaena fragrans2018-08-21v4No1 / 100
536amnoncommon crotalus horridus, snake, skin, united states of america, southern united states, timber rattlesnake2019-07-28v4No1 / 101
536amnoncommon snake, skin, united states of america, southern united states, fossorial snake, storeria dekayi, ground snake2019-07-28v4No1 / 101
499amnoncommon brazil, pond, digestive system, intestine, dendropsophus minutus, frog, tadpole2019-03-05v4No1 / 102
515amnoncommon whole body, beetle, detritivorous beetle, feces, bulgaria, balkan mountains, onthophagus similis2019-04-18v4No1 / 104
565amnoncommon skin, canada, sciurus carolinensis, eastern gray squirrel2019-11-21v3No1 / 104
79amnoncommon skin, united states of america, balaenoptera physalus, fin whale2017-03-03v4No1 / 105
406amnoncommon feces, zoological garden, south africa, aardvark, orycteropus afer2018-11-21v4No1 / 107
536amnoncommon snake, skin, united states of america, southern united states, thamnophis sirtalis, common garter snake2019-07-28v4No1 / 110
539amnon high in early timepoint days 1-15 aerobic fermentation compared to late timepoint days 30-60 anaerobic fermentation in ethiopia ensete ventricosum ethiopian banana food (fermented) 2019-07-31v4No1 / 110
899amnoncommon in snail intestine from phytoremedation field (common phytoremedation field, field, heavy metal contaminated soil, land snail, bradybaena ravida, china, sedum alfredii, heavy metal, zhejiang province, intestine)2022-04-25v3No1 / 110
536amnoncommon snake, skin, united states of america, southern united states, aquatic snake, nerodia sipedon, northern water snake2019-07-28v4No1 / 111
565amnoncommon skin, canada, zoological garden, captive, toronto zoo, equus przewalskii, wild horse2019-11-21v3No1 / 112
567amnon high in control compared to chronic rhinosinusitis sinusitis in homo sapiens adult belgium nasopharynx 2019-12-05v4No1 / 114
565amnoncommon skin, canada, zoological garden, captive, toronto zoo, arctic wolf, canis lupus arctos2019-11-21v3No1 / 114
98amnoncommon citrus, leaf, vero beach, fl, state of florida2017-04-01v4No1 / 115
492amnoncommon skin, adult, germany, bufo bufo, toad, common toad2019-02-27v4No1 / 115
536amnoncommon snake, skin, united states of america, southern united states, agkistrodon piscivorus, aquatic snake2019-07-28v4No1 / 115
195amnoncommon in boston subway surfaces (common city, urban biome, train, boston)2017-09-07v4No1 / 116
361amnoncommon leaf, austria, greenhouse, plant, aechmea eurycorymbus2018-08-21v4No1 / 117
343amnoncommon in apple flowers (common apple, malus x domestica, flower structure, flower, united states of america, state of connecticut)2018-05-28v4No1 / 118
410amnonlower in feces compared to rectal biopsies in children with treatment naive uc ( high in rectum biopsy biopsy site compared to feces in homo sapiens child united states of america ulcerative colitis )2018-11-22v4No1 / 118
311amnoncommon united states of america, state of rhode island, scallion, foodon product type2018-04-09v4No1 / 121
374amnoncommon skin, costa rica, amphibia, rhaebo haematiticus, truando toad, toad2018-09-09v4No1 / 121
108amnondecreases during fasting in nile tilapia caecum ( high in early timepoints compared to fasting late timepoints in state of texas research facility united states of america caecum oreochromis niloticus nile tilapia )2017-04-07v4No1 / 122
565amnoncommon skin, canada, zoological garden, captive, african lion safari, ceratotherium simum, white rhinoceros2019-11-21v3No1 / 122
548amnoncommon minas gerais state, campos rupestres, brazil, barbacenia macrantha, stem, stem endosphere2019-08-17v4No1 / 123
565amnoncommon skin, acinonyx jubatus, cheetah, canada, zoological garden, captive, african lion safari2019-11-21v3No1 / 123
582amnoncommon urocyon littoralis catalinae, santa catalina island fox, santa catalina island, united states of america, wild, external ear, urocyon littoralis2020-01-22v4No1 / 124
67amnoncommon in dry processing of coffee beans (common coffea arabica, dry processing, ecuador)2017-02-19v4No1 / 126
98amnoncommon citrus, leaf, ft. pierce, fl, state of florida2017-04-01v4No1 / 126
934amnoncommon jejunal mucosa, age 7 weeks, wuhan, china, chicken, gallus gallus, jejunum, research facility2022-09-18v3No1 / 127
615amnoncommon stem surface, upper stem, stem, exosphere, saccharum, sugarcane, campinas, brazil, greenhouse2020-04-27v4No1 / 129
827sheryoHigher in soil depth of 275cm compared to soil depth of 60cm in clayey till loam soil, Lund Denmark ( high in depth 200-350cm compared to depth 20-120cm in lund kingdom of denmark agricultural field clayey till late weichselian glaciation loam soil )2021-09-13v3No1 / 129
199amnoncommon in kitchen sink (common building, urban biome, united states of america, kitchen, sink)2017-10-01v4No1 / 130
996amnon high in fall summer compared to winter in river water china upstream fuzhou city prefecture xiyuan river fresh water surface water river 2022-12-28v3No1 / 130
384amnoncommon equus caballus, horse, canada, farm, nasal cavity, pair of nares, barn, hay2018-10-22v4No1 / 131
288amnoncommon pelagic zone, cloaca, gulf of mexico, green turtle, chelonia mydas, summer2018-01-29v4No1 / 135
63amnon high in female compared to male in homo sapiens skin 2017-02-15v4No1 / 139
514amnoncommon united states of america, state of utah, sandstone, grand staircase-escalante national park, desert, depth (soil) 0-1cm2019-03-25v4No1 / 139
582amnoncommon urocyon littoralis catalinae, santa catalina island fox, santa catalina island, united states of america, wild, urocyon littoralis, axilla2020-01-22v4No1 / 140
109amnon high in distribution system compared to water treatment plant in water drinking water united states of america site e 2017-04-08v4No1 / 143
615amnoncommon exosphere, leaf surface, leaf, saccharum, sugarcane, campinas, brazil, greenhouse2020-04-27v4No1 / 143
615amnon high in stem surface upper stem stem compared to leaf surface leaf in exosphere saccharum sugarcane campinas brazil greenhouse 2020-04-27v4No1 / 143
788amnon high in plant litter compared to soil in mesocosm state of georgia united states of america 2021-05-31v4No1 / 143
291amnoncommon canis lupus familiaris, dog, pair of nares, nasal cavity, germany2018-02-01v4No1 / 144
29amnoncommon brassica oleracea, french republic, seed2016-12-05v4No1 / 146
475amnoncommon in air next to subway stations in hong kong (common air, hong kong, city)2019-01-20v4No1 / 147
782amnon high in sparus aurata seabream compared to seabass dicentrarchus labrax in skin open water pond ria formosa portuguese republic fish farm 2021-05-06v4No1 / 149
921amnoncommon turrialba canton, cane toad, rhinella marina, skin epidermis, costa rica, skin2022-07-24v4No1 / 153
361amnoncommon leaf, austria, greenhouse, plant, howea forsteriana2018-08-21v4No1 / 154
758amnoncommon in cigar tobacco (common swisher sweets sweet cherry cigar, tobacco, nicotiana tabacum, cigar)2021-03-28v3No1 / 154
361amnoncommon leaf, austria, greenhouse, plant, dracaena draco2018-08-21v4No1 / 155
266amnoncommon on perennial plant leaves (common brassicaceae, boechera stricta, plant, leaf, united states of america, state of idaho)2017-12-19v4No1 / 156
515amnoncommon poland, whole body, beetle, plant, nida basin, herbivorous beetle, crioceris duodecimpunctata2019-04-18v4No1 / 157
180amnoncommon dermanyssus gallinae, red poulty mite, czech republic, poulty farm, larval stage, shelled egg2017-08-14v4No1 / 158
98amnoncommon citrus, leaf, immokalee, fl, state of florida2017-04-01v4No1 / 160
192amnoncommon seed, seed structure, brassica napus2017-09-05v4No1 / 161
322amnoncommon frog, osteopilus septentrionalis, united states of america, state of florida, research facility, digestive system, tadpole2018-04-23v4No1 / 161
475amnoncommon in air in subway train in hong kong (common air, hong kong, city, subway)2019-01-20v4No1 / 161
965amnoncommon biofilm, saccharina latissima, sugar kelp, state of connecticut, united states of america, atlantic ocean, depth (water) 5-50m2022-12-21v3No1 / 161
121amnonhigh in diarrhea compared to recovery period ( high in diarrhea compared to control in homo sapiens feces bangladesh adult )2017-04-13v4No1 / 162
548amnoncommon minas gerais state, campos rupestres, brazil, barbacenia macrantha, leaf, leaf endosphere2019-08-17v4No1 / 164
408amnon high in larval stage compared to stomach in ant costa rica united states of america pseudomyrmex spinicola 2018-11-22v4No1 / 165
232amnoncoomon in foot of healthy controls (common homo sapiens, skin, australia, foot)2017-11-05v4No1 / 166
374amnoncommon skin, costa rica, amphibia, craugastor bransfordii, bransford’s litter frog, frog2018-09-09v4No1 / 171
534amnoncommon river, water, fresh water, depth (water) 10cm, koshi river, nepal, free floating, filtered 0.2um2019-07-22v4No1 / 172
894amnoncommon leaf surface, citrus unshiu, china, citrus, zhejiang province, leaf, orchard2022-04-11v4No1 / 172
782amnon high in sparus aurata seabream compared to dicentrarchus labrax seabass in gill open water pond ria formosa portuguese republic fish farm 2021-05-06v4No1 / 174
565amnoncommon skin, canada, zoological garden, captive, toronto zoo, pongo abelii, sumatran orangutan2019-11-21v3No1 / 174
851amnon high in colonic mucosa sigmoid colon brushing sigmoid colon compared to feces in milan italy adult homo sapiens 2021-12-16v3No1 / 174
384amnoncommon equus caballus, horse, canada, farm, nasal cavity, pair of nares, pasture2018-10-22v4No1 / 175
99amnoncommon commonwealth of virginia, united states of america, skin, mucus, anaxyrus americanus, american toad2017-04-02v4No1 / 176
499amnoncommon brazil, pond, digestive system, intestine, scinax fuscovarius, frog, tadpole2019-03-05v4No1 / 176
921amnoncommon cane toad, municipality of bayamon, bufo marinus, epidermis, puerto rico, skin2022-07-24v4No1 / 177
432amnoncommon united states of america, plant, state of north carolina, stem, tsuga sieboldii, southern japanese hemlock2018-12-19v4No1 / 183
536amnoncommon snake, skin, united states of america, southern united states, pantherophis obsoletus, black rat snake, arboreal snake2019-07-28v4No1 / 184
98amnoncommon citrus, leaf, quincy, fl, state of florida2017-04-01v4No1 / 188
75amnoncommon homo sapiens, skin, arm, venezuela, amerindian, hunter gatherer2017-02-27v4No1 / 190
567amnon high in control compared to sinusitis chronic rhinosinusitis in homo sapiens adult belgium anterior naris pair of nares 2019-12-05v4No1 / 191
201amnoncommon in decaying Saguaro cactus (common mexico, desert, carnegiea gigantea, saguaro, cactus, decaying)2017-10-01v4No1 / 193
201amnoncommon in decaying Cardon cactus (common mexico, desert, cactus, decaying, pachycereus pringlei, cardon)2017-10-01v4No1 / 193
534amnoncommon river, water, fresh water, depth (water) 10cm, koshi river, tributary, nepal, particle bound, filtered 2.7um2019-07-22v4No1 / 193
371amnoncommon homo sapiens, skin, amerindian, hunter gatherer, venezuela2018-09-06v4No1 / 195
600sheryoIncearses after 12 days of stover ammendment in soil ( high in day 12 compared to day 1 in depth (soil) 0-5cm state of new york soil united states of america coarse-loamy soil ph 6 stover ammendment soil )2020-03-27v4No1 / 196
905amnoncommon duodenum, western australia, sheep, age 1 year, australia, ovis aries, research facility2022-05-18v3No1 / 200
6amnoncommon urine, female, homo sapiens, pregnancy, state of tennessee2016-10-13v4No1 / 201
878amnoncommon pm10, respirable suspended particulate matter, city, municipality of beijing, china, air2022-03-11v3No1 / 203
618amnoncommon early flowering stage, canada, farm, root, root endosphere, cannabis sativa2020-05-04v4No1 / 205
565amnoncommon skin, canada, ammotragus lervia, barbary sheep, zoological garden, captive, african lion safari2019-11-21v3No1 / 205
360amnoncommon agave, desert, leaf, leaf surface, mexico, guanajuato, agave tequiliana, cultivated environment2018-08-21v4No1 / 210
511amnoncommon snow, depth 0-5cm, lapland, finland, sweden, kingdom of norway2019-03-20v4No1 / 213
98amnoncommon citrus, leaf, gainesville, fl, state of florida2017-04-01v4No1 / 215
433amnoncommon sea water, ocean, depth (water) 4m, south china sea, coast2018-12-19v4No1 / 215
587amnoncommon israel, food product type, alfalfa sprouts, medicago sativa, producer c22020-02-10v3No1 / 215
196amnonhigher in water compared to biofilm ( high in water compared to biofilm biofilm in drinking water united states of america )2017-09-12v4No1 / 223
265amnoncommon in tree leaves (common canada, province of quebec, tree, leaf)2017-12-11v4No1 / 226
426amnon high in site 2 compared to site 1 in soil tundra permafrost russia nenets autonomous okrug 2018-12-08v4No1 / 228
499amnoncommon brazil, pond, water, pond water, fresh water2019-03-05v4No1 / 228
331amnon high in dry season compared to wet season in feces monkey theropithecus gelada ethiopia 2018-05-13v4No1 / 232
492amnoncommon skin, adult, rana catesbeiana, bullfrog, lithobates catesbeianus, frog, japan2019-02-27v4No1 / 236
536amnoncommon snake, skin, united states of america, southern united states, agkistrodon contortrix, copperhead snake2019-07-28v4No1 / 236
585amnoncommon china, pomacea canaliculata, golden apple snail, nanheng river, qingpu district, intestine2020-02-02v3No1 / 240
548amnoncommon minas gerais state, campos rupestres, brazil, vellozia epidendroides, leaf, leaf endosphere2019-08-17v4No1 / 243
960amnon high in 9-month-old human stage compared to 1-month-old human stage in homo sapiens nigeria edo state infant feces 2022-12-20v4No1 / 244
965amnon high in sugar kelp saccharina latissima biofilm compared to sea water in state of connecticut united states of america atlantic ocean depth (water) 5-50m 2022-12-21v3No1 / 248
101amnon high in soil compared to rhizosphere in state of new york vitis vinifera united states of america merlot grapevine 2017-04-03v4No1 / 249
432amnoncommon united states of america, plant, state of north carolina, stem, tsuga canadensis, eastern hemlock2018-12-19v4No1 / 251
996amnoncommon in river water without anthropogenic effect (common river water, china, upstream, fuzhou city prefecture, xiyuan river, fresh water, surface water, river)2022-12-28v3No1 / 254
432amnoncommon united states of america, plant, state of north carolina, stem, tsuga chinensis, chinese hemlock2018-12-19v4No1 / 260
205amnonlower in depth 15cm compared to 2.5cm in rock piles in duluth complex ( high in depth 2.5cm compared to depth (soil) 15cm depth in rock united states of america quarry duluth complex ph 4-5 state of minnesota sulfide )2017-10-03v4No1 / 265
253amnoncommon in clouds in puy de dome mountain in france (common cloud, french republic, air, autumn)2017-11-22v4No1 / 267
361amnoncommon leaf, austria, greenhouse, plant, chlorophytum comosum2018-08-21v4No1 / 270
931amnoncommon jejunum, duodenum, riwoqe county, china, yak, tibet autonomous region, bos grunniens2022-08-25v3No1 / 270
499amnoncommon brazil, pond, digestive system, intestine, astyanax paranae, fish, astyanax2019-03-05v4No1 / 273
315amnoncommon in frog pond water (common hunan province, jiangxi province, water, fresh water, pond, china)2018-04-10v4No1 / 274
128amnonhigher in ivy leaves from city compared to moor and forest ( high in city dense settlement biome compared to moor forest ecosystem in hedera hibernica belgium ivy leaf )2017-04-14v4No1 / 287
423amnoncommon bank vole, myodes glareolus, ukraine, skin2018-12-05v4No1 / 291
37amnoncommon in plastic leaf plants (in field next to tomato plants) (common maryland county, leaf)2016-12-09v4No1 / 298
237amnonlower in burrow soil compared to bird ( high in oceanodroma leucorhoa bird seabird compared to soil burrow in canada bon portage island )2017-11-07v4No1 / 298
653amnon high in tongue dermal layer of tongue compared to dentition supragingival plaque supragingival dental plaque in third decade human stage toronto canada adult homo sapiens 2020-09-13v3No1 / 306
499amnoncommon brazil, pond, poecilia reticulata, digestive system, intestine, fish, guppy2019-03-05v4No1 / 308
432amnoncommon united states of america, plant, state of north carolina, stem, tsuga dumosa, himalayan hemlock2018-12-19v4No1 / 309
565amnoncommon skin, canada, zoological garden, captive, african lion safari, giraffa camelopardalis, giraffe2019-11-21v3No1 / 310
534amnoncommon river, water, fresh water, depth (water) 10cm, koshi river, nepal, particle bound, filtered 2.7um2019-07-22v4No1 / 315
406amnonlower in captive bovidae compared to wild ( high in wild compared to zoological garden in feces bovidae )2018-11-21v4No1 / 319
322amnon high in tadpole compared to adult in frog osteopilus septentrionalis united states of america state of florida research facility digestive system 2018-04-23v4No1 / 320
879amnoncommon canis lupus, wolf, adult organism, chest, captive, austria, skin, research facility2022-03-12v4No1 / 320
311amnoncommon in floor of kimchi production facility (common united states of america, state of rhode island, floor, food processing factory)2018-04-09v4No1 / 324
782amnon high in skin compared to gill in sparus aurata seabream open water pond ria formosa portuguese republic fish farm 2021-05-06v4No1 / 325
433amnoncommon sea water, ocean, depth (water) 4m, indian ocean2018-12-19v4No1 / 333
932amnon high in cuticle chitin-based cuticle compared to stomach gaster in atlantic rainforest parque estadual serra do mar-nĂșcleo picinguaba odontomachus hastatus sao paulo state ant brazil tropical moist broadleaf forest biome 2022-08-30v4No1 / 334
565amnoncommon skin, canada, equus asinus africanus, donkey, farm2019-11-21v3No1 / 335
129amnoncommon mexico, myrtillocactus geometrizans, opuntia robusta, cactus, rhizosphere, semi-arid2017-04-15v4No1 / 338
254amnoncommon river, water, fresh water, depth (soil) 50cm, jiulong river, fujian province, china2017-11-23v4No1 / 347
618amnoncommon late flowering stage, canada, farm, root, root endosphere, cannabis sativa2020-05-04v4No1 / 352
209amnonhigher in whale blow condensate compared to ocean water ( high in whale blow exhaled air condensate respiratory airway megaptera novaeangliae humpback whale compared to sea water ocean depth (water) 25cm in north america )2017-10-15v4No1 / 359
565amnoncommon skin, canada, macropus rufus, red kangaroo, zoological garden, captive, african lion safari2019-11-21v3No1 / 360
512amnon high in hani peatland baekdudaegan ph 5-6 compared to riganqiao peatland tibetan plateau ph 5.5-6.5 in fen peatland peat soil soil china 2019-03-22v4No1 / 363
341amnonhigher in fresh drinking water compared to week old water ( high in fresh water compared to stagnant water in water drinking water united states of america tap water state of illinois )2018-05-28v4No1 / 365
29amnon high in seed compared to seedling in brassica oleracea french republic 2016-12-05v4No1 / 379
718amnon high in epilimnion compared to hypolimnion in "south sparkling bog" lake ph 4.5-5 dimictic lake freshwater lake bog lake united states of america state of wisconsin 2028-05-23v4No1 / 382
256amnonhigher in small intestine compared to colon in pigs ( high in duodenum jejunum ileum compared to caecum right colon left colon in sus scrofa pig united kingdom )2017-11-26v4No1 / 387
170amnonhigher in low turbidity river water ( high in low turbidity turbidity compared to high turbidity in river water fresh water depth (water) 10cm united states of america stream )2017-07-24v4No1 / 395
912amnon high in alive compared to dead in zebra mussel dreissena polymorpha fresh water aquarium mussel whole body body proper research facility 2022-05-27v4No1 / 398
879amnoncommon dog, canis lupus familiaris, adult organism, chest, captive, austria, skin, research facility2022-03-12v4No1 / 399
960amnon high in 18-month-old human stage compared to 9-month-old human stage in homo sapiens nigeria edo state infant feces 2022-12-20v4No1 / 407
353amnoncommon in wild Lissotriton vulgaris newts skin (common newt, adult, skin, lissotriton vulgaris, cambridgeshire, united kingdom)2018-07-30v4No1 / 418
612amnoncommon state of florida, united states of america, spring water, water, fresh water, location 32020-04-22v4No1 / 420
548amnoncommon minas gerais state, campos rupestres, brazil, vellozia epidendroides, stem2019-08-17v4No1 / 431
360amnoncommon desert, soil, mexico, guanajuato2018-08-21v4No1 / 437
412amnonlower in pig manured soil with wheat-maize rotation compared to non-manured soil ( high in non-manured soil compared to manured soil in soil hunan province red soil cambisol zea mays triticum aestivum china )2018-11-26v4No1 / 437
99amnoncommon commonwealth of virginia, united states of america, skin, mucus, pseudacris crucifer, peeper2017-04-02v4No1 / 438
577amnon high in hypersaline water high salinity depth (water) 4-9m monimolimnion compared to depth (water) 20-100cm depth (water) 1-5m depth (water) 0-3m mixolimnion low salinity in lake romania ursu lake water lake water 2020-01-09v3No1 / 439
353amnoncommon in wild Triturus cristatus newts skin (common newt, adult, skin, cambridgeshire, triturus cristatus, united kingdom)2018-07-30v4No1 / 456
415amnonhigher in citrus from humid subtropical compared to mediterranean and semi-arid climate ( high in subtropical compared to mediterranean semi-arid in rhizosphere soil citrus orchard cultivated environment )2018-11-27v4No1 / 458
128amnoncommon hedera hibernica, belgium, ivy, leaf, city, dense settlement biome2017-04-14v4No1 / 461
462amnon high in stem compared to leaf in united states of america state of tennessee populus tree cultivated environment 2019-01-13v4No1 / 477
360amnoncommon desert, soil, rhizosphere, agave, agave salmiana, mexico, guanajuato2018-08-21v4No1 / 484
360amnoncommon agave, desert, leaf, leaf surface, agave salmiana, mexico, guanajuato2018-08-21v4No1 / 492
315amnonhigher in frog pond water compared to frog gut ( high in water fresh water compared to digestive system colon frog quasipaa spinosa giant spiny frog in jiangxi province hunan province china )2018-04-10v4No1 / 505
942amnoncommon banana, rhizosphere, nanning city prefecture, china, musa acuminata2022-11-25v3No1 / 505
718amnon high in epilimnion compared to hypolimnion in "trout bog" lake ph 4.5-5 dimictic lake freshwater lake bog lake united states of america state of wisconsin 2028-05-23v4No1 / 509
98amnoncommon citrus, rhizosphere, vero beach, fl, root, state of florida2017-04-01v4No1 / 544
352amnon high in small intestine duodenum compared to feces in homo sapiens new delhi india 2018-07-30v4No1 / 545
548amnoncommon on leaf surface (common minas gerais state, campos rupestres, brazil, vellozia epidendroides, leaf)2019-08-17v4No1 / 548
548amnoncommon in leaf surface of barbacenia macrantha (common minas gerais state, campos rupestres, brazil, barbacenia macrantha, leaf, leaf surface)2019-08-17v4No1 / 550
129amnoncommon mexico, myrtillocactus geometrizans, opuntia robusta, cactus, semi-arid, leaf2017-04-15v4No1 / 562
905amnon high in jejunum ileum compared to abomasum rumen in western australia sheep age 1 year australia ovis aries research facility 2022-05-18v3No1 / 563
357amnoncommon soil, topsoil, depth (soil) 0-10cm, mediterranean forest biome, forest ecosystem, woodland area2018-08-19v4No1 / 564
600sheryohigher in stover ammendment soil ( high in stover amended soil compared to unamended soil in depth (soil) 0-5cm state of new york soil united states of america coarse-loamy soil ph 6 day 82 )2020-03-27v4No1 / 567
254amnon high in summer wet season autumn compared to winter dry season in river water fresh water depth (soil) 50cm jiulong river fujian province china 2017-11-23v4No1 / 571
548amnoncommon minas gerais state, campos rupestres, brazil, barbacenia macrantha, root endosphere, root2019-08-17v4No1 / 575
696amnon high in georissa georissa similis compared to plectostoma concinnum opisthostoma concinnum in land snail stomach gastrointestinal system malaysia state of sabah 2028-03-28v3No1 / 576
254amnon high in summer wet season compared to winter dry season autumn in river water fresh water depth (soil) 50cm jiulong river fujian province china 2017-11-23v4No1 / 581
788amnon high in cherokia georgiana georgiana millipede feces compared to soil in mesocosm state of georgia united states of america 2021-05-31v4No1 / 589
146amnon high in rhizosphere compared to soil in united states of america solanum lycopersicum tomato slit loam ph 6 2017-04-20v4No1 / 590
612amnoncommon state of florida, united states of america, spring water, water, fresh water, location 22020-04-22v4No1 / 596
357amnoncommon soil, topsoil, depth (soil) 0-10cm, savanna, forest ecosystem, woodland area2018-08-19v4No1 / 614
931amnon high in jejunum duodenum compared to ruminal fluid rumen in riwoqe county china yak tibet autonomous region bos grunniens 2022-08-25v3No1 / 622
128amnoncommon hedera hibernica, belgium, ivy, leaf, moor, scrubland2017-04-14v4No1 / 623
360amnoncommon desert, soil, state of california2018-08-21v4No1 / 637
827sheryoCommon in soil at 230cm depth in clayey till loam soil, Lund Denmark (common depth 200-260cm, loam soil, late weichselian glaciation, clayey till, agricultural field, kingdom of denmark, lund)2021-08-24v3No1 / 644
360amnonhigher in leaf surface compared to soil in agave plants ( high in leaf leaf surface compared to soil in desert state of california mexico guanajuato agave )2018-08-21v4No1 / 645
471amnon high in tadpole compared to adult in digestive system frog osteopilus septentrionalis research facility united states of america state of florida 2019-01-14v4No1 / 648
360amnoncommon agave, desert, state of california, agave deserti, leaf, leaf surface2018-08-21v4No1 / 649
548amnoncommon minas gerais state, campos rupestres, brazil, barbacenia macrantha, rhizosphere2019-08-17v4No1 / 651
103amnonlower in particle bound fraction compared to free floating bacteria in mississippi river ( high in free floating compared to particles in river united states of america mississippi river fresh water aquatic biome )2017-04-05v4No1 / 653
565amnoncommon skin, canada, zoological garden, captive, tragelaphus oryx, eland, toronto zoo2019-11-21v3No1 / 674
422amnoncommon soil, paddy field soil, oryza sativa, heilongjiang province, ph 6-7, cultivated environment, china2018-12-04v4No1 / 682
128amnoncommon hedera hibernica, belgium, ivy, leaf, forest ecosystem2017-04-14v4No1 / 693
412amnon high in ph<5 compared to ph>5 in soil hunan province red soil cambisol zea mays triticum aestivum china 2018-11-26v4No1 / 706
758amnon high in swisher sweets sweet cherry cigar swisher sweets original cigar compared to cheyenne full flavor cigar cheyenne menthol box cigar in tobacco nicotiana tabacum cigar 2021-03-28v3No1 / 710
422amnoncommon soil, paddy field soil, oryza sativa, heilongjiang province, ph 5-6, cultivated environment, china2018-12-04v4No1 / 726
752sheryoCommon in soil planted with Panax notoginseng (common panax notoginseng, sanqi plants, ph 6, xundian county, yunnan province, china, pot expreiment, soil)2021-03-11v3No1 / 730
421amnoncommon in paddy field soil incubated with copper (common soil, research facility, zhejiang province, paddy field soil, copper, china)2018-12-02v4No1 / 740
415amnoncommon rhizosphere, soil, citrus, australia, orchard, cultivated environment2018-11-27v4No1 / 743
271amnon high in rhizosphere glycine max soybean compared to soil in depth (soil) 0-20cm china 2018-01-09v4No1 / 750
206amnoncommon in air from israel particles <10um size (common air, dust, israel, size < 10um, clear day)2017-10-04v4No1 / 765
171amnon high in drought environment compared to control in soil united states of america state of california rhizosphere oryza sativa rice 2017-07-25v4No1 / 770
823sheryoCommon at 90-100cm depth in foot slope ultisol soil in auburn, alabama (common depth 90-100cm, foot slope , alabama, auburn, ultisol, agricultural field, soil)2021-08-08v3No1 / 782
752sheryoCommon in soil planted with Panax notoginseng amended with2% biochar (common biochar, panax notoginseng, sanqi plants, ph 6, xundian county, yunnan province, china, pot expreiment, soil)2021-03-11v3No1 / 783
827sheryoCommon in soil at 465cm depth in clayey till loam soil, Lund Denmark (common depth 450-480cm, lund, kingdom of denmark, agricultural field, clayey till, late weichselian glaciation, loam soil)2021-09-13v3No1 / 786
384amnon high in pair of nares nasal cavity compared to oral cavity saliva mouth in equus caballus horse canada farm 2018-10-22v4No1 / 791
824sheryoHigher at 0-10cm depth compared to 10-20cm depth in soil after grazing exclusion at 0-10cm depth, Ningxia china ( high in depth (soil) 0-10cm compared to depth 10-20cm in yunwushan national natural grassland protection zone ningxia province calci-orthic aridisol haplic calcisol grazing exclusion china soil )2021-08-08v4No1 / 807
618amnoncommon late flowering stage, rhizosphere, canada, farm, cannabis sativa2020-05-04v4No1 / 819
412amnoncommon soil, hunan province, red soil, cambisol, zea mays, triticum aestivum, ph<5, china2018-11-26v4No1 / 823
421amnoncommon in paddy field soil incubated without copper (common research facility, soil, paddy field soil, zhejiang province, china)2018-12-02v4No1 / 824
415amnoncommon rhizosphere, soil, citrus, orchard, china, cultivated environment2018-11-27v4No1 / 830
996amnon high in fall summer compared to winter in river water china fuzhou city prefecture xiyuan river fresh water surface water river downstream anthropogenic environmental material city 2022-12-28v3No1 / 834
517amnon high in skin arm forearm compared to feces in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 836
265amnoncommon canada, province of quebec, soilwater, water2017-12-11v4No1 / 841
266amnoncommon in roots in JAM garden (common brassicaceae, boechera stricta, plant, united states of america, state of idaho, root)2017-12-19v4No1 / 843
827sheryoCommon in soil at 325cm depth in clayey till loam soil, Lund Denmark (common lund, kingdom of denmark, agricultural field, clayey till, late weichselian glaciation, loam soil, depth 300-350cm)2021-08-24v3No1 / 866
618amnoncommon early flowering stage, rhizosphere, canada, farm, cannabis sativa2020-05-04v4No1 / 873
129amnoncommon ph 6-6.5, mexico, myrtillocactus geometrizans, opuntia robusta, cactus, semi-arid, soil2017-04-15v4No1 / 884
146amnoncommon united states of america, solanum lycopersicum, tomato, slit loam soil, ph 6, rhizosphere2017-04-20v4No1 / 894
206amnoncommon in dust storm air from israel particles <10um size (common israel, air, size < 10um, dust, dust storm)2017-10-04v4No1 / 902
807amnoncommon tropical storm, summer, okinawa islands, japan, filtered 0.2um, near shore, sea water, surface water2021-06-20v3No1 / 905
103amnoncommon particles, river, united states of america, mississippi river, fresh water, aquatic biome2017-04-05v4No1 / 909
103amnoncommon river, united states of america, mississippi river, fresh water, aquatic biome, free floating2017-04-05v4No1 / 909
548amnoncommon minas gerais state, campos rupestres, brazil, rock2019-08-17v4No1 / 924
444amnoncommon in uncultivated soil plot (common yellow brown soil, nanjing city prefecture, soil, china)2019-01-07v4No1 / 946
37amnonlower in tomato plant leaves compared to plastic control ( high in control compared to solanum lycopersicum in maryland county leaf )2016-12-09v4No1 / 950
98amnoncommon citrus, rhizosphere, quincy, fl, root, state of florida2017-04-01v4No1 / 950
422amnoncommon soil, paddy field soil, jiangsu province, oryza sativa, china, cultivated environment2018-12-02v4No1 / 957
414amnon high in ph<6 npk fertilizer compared to ph>6 in soil heilongjiang province agricultural feature triticum aestivum glycine max zea mays black soil mollisol china 2018-11-26v4No1 / 963
129amnoncommon ph 6-6.5, mexico, myrtillocactus geometrizans, opuntia robusta, cactus, semi-arid, soil, root zone soil2017-04-15v4No1 / 968
931amnon high in jejunum duodenum compared to ileum feces colon caecum in tibet autonomous region riwoqe county china yak bos grunniens 2022-08-25v3No1 / 970
979amnon high in sediment depth 20-50cm compared to sediment depth 0-5cm in aldabra atoll seychelles sediment 2022-12-24v3No1 / 970
474amnoncommon soil, farm, glycine max, soybean, ph 4-6, brazil, cultivated environment2019-01-16v4No1 / 974
266amnoncommon in soil from MIL garden (common soil, united states of america, state of idaho, ph 6.5)2017-12-18v4No1 / 980
193amnonhigher in nares of people working in dairy farms ( high in bos taurus farm compared to control in homo sapiens united states of america pair of nares )2017-09-05v4No1 / 992
360amnon high in soil compared to agave rhizosphere in desert mexico state of california 2018-08-21v4No1 / 992
462amnoncommon depth (soil) 0-30 cm, depth (soil) 0-20cm, united states of america, state of tennessee, rhizosphere, populus, tree, silt loam, cultivated environment2019-01-13v4No1 / 997
517amnon high in skin arm forearm compared to mouth mucosa mouth in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 1014
628sheryocommon in bulk soil with barley plants after 180 days in treatments amended with biochar (common biochar, bulk soil, china, zhejiang province, quzhou county, soil, depth (soil) 15cm, ph 4-5, hordeum vulgare, days 180, mature barley plants)2020-05-18v4No1 / 1023
548amnoncommon minas gerais state, campos rupestres, brazil, rhizosphere, vellozia epidendroides2019-08-15v4No1 / 1040
422amnoncommon soil, paddy field soil, oryza sativa, heilongjiang province, china, cultivated environment2018-12-02v4No1 / 1049
265amnoncommon canada, province of quebec, soil2017-12-11v4No1 / 1090
415amnoncommon rhizosphere, soil, citrus, orchard, brazil, cultivated environment2018-11-27v4No1 / 1091
905amnon high in ileum jejunum compared to feces colon caecum in western australia sheep age 1 year australia ovis aries research facility 2022-05-18v3No1 / 1092
414amnoncommon soil, heilongjiang province, agricultural feature, triticum aestivum, glycine max, zea mays, black soil, mollisol, npk fertilizer, ph<6, china2018-11-26v4No1 / 1105
917amnoncommon qiao nature reserve, depth (soil) 0-20cm, sonneratia apetala, china, marsh, mangrove, ph 7-8, soil2022-07-08v3No1 / 1107
266amnoncommon in roots in MAH garden (common brassicaceae, boechera stricta, plant, united states of america, state of idaho, root)2017-12-19v4No1 / 1110
515amnon high in carabidae compared to staphylinidae in whole body beetle carnivorous beetle river poland 2019-04-19v4No1 / 1130
628sheryocommon in bulk soil with barley plants after 180 days in treatments unamended with biochar (common bulk soil, china, zhejiang province, quzhou county, soil, depth (soil) 15cm, ph 4-5, hordeum vulgare, days 180, mature barley plants)2020-05-18v4No1 / 1136
718amnon high in hypolimnion compared to epilimnion in meromictic lake "hells kitchen" lake freshwater lake bog lake united states of america state of wisconsin 2028-05-23v4No1 / 1165
266amnon high in leaf compared to root in brassicaceae boechera stricta plant united states of america state of idaho 2017-12-19v4No1 / 1175
807amnon high in tropical storm compared to normal weather in summer okinawa islands japan filtered 0.2um near shore sea water surface water 2021-06-20v3No1 / 1191
628sheryocommon in rhizosphere of barley roots after 180 days in treatments amended with biochar (common mature barley plants, days 180, rhizosphere, hordeum vulgare, biochar, ph 4-5, depth (soil) 15cm, china, quzhou county, zhejiang province, soil)2020-05-18v4No1 / 1192
421amnoncommon soil, paddy field soil, zhejiang province, china2018-12-04v4No1 / 1194
628sheryocommon in rhizosphere of barley roots after 180 days in treatments unamended with biochar (common china, zhejiang province, quzhou county, soil, depth (soil) 15cm, ph 4-5, hordeum vulgare, rhizosphere, days 180, mature barley plants)2020-05-18v4No1 / 1209
837sheryoCommon in agricultural field at depths 100-300cm, shaanxi, China (common depth 100-300cm, agricultural field, zea mays, triticum aestivum, silt loam, china, loess plateau, shaanxi province, soil)2021-09-26v4No1 / 1220
444amnonlower in continuously cropped strawberry soil ( high in age 1 year compared to age 5 years age 10 years continuous cropping in rhizosphere fragaria x ananassa strawberry greenhouse soil farm yellow brown soil nanjing city prefecture china cultivated environment )2019-01-07v4No1 / 1221
901amnoncommon taihu lake, depth (sediment) 0-20cm, depth (water) 20-100cm, taihu national park, china, lake sediment2022-04-25v4No1 / 1246
837sheryoCommon in agricultural field at depths 40-100cm, shaanxi, China (common depth 40-100cm, agricultural field, zea mays, triticum aestivum, silt loam, china, loess plateau, shaanxi province, soil)2021-09-26v4No1 / 1263
414amnoncommon soil, heilongjiang province, agricultural feature, triticum aestivum, glycine max, zea mays, black soil, mollisol, ph>6, china2018-11-26v4No1 / 1282
783sheryocommon in desert soil in mongolia without water addition treatment (common no water addition, ambient precipitation, ph 7.85, luvic gypsisols, cambic arenosols, china, mongolia, dengkou county, ulan buh desert, bajada, sandy desert, soil)2021-05-11v4No1 / 1324
600sheryoCommon in biochar ammended soil after 82 days (common depth (soil) 0-5cm, state of new york, soil, biochar, united states of america, coarse-loamy soil, ph 6, day 82)2020-03-27v4No1 / 1326
600sheryoCommon in stover ammended soil after 82 days (common depth (soil) 0-5cm, state of new york, soil, united states of america, coarse-loamy soil, ph 6, day 82, stover ammendment )2020-03-27v4No1 / 1327
259amnoncommon in soil and rhizpsphere of peanut plants (common soil, rhizosphere, ph 5, arachis hypogaea, peanut, china)2017-12-02v4No1 / 1334
98amnoncommon citrus, rhizosphere, ft. pierce, fl, root, state of florida2017-04-01v4No1 / 1340
901amnoncommon in macrophyte plant rhizosphere (common rhizosphere, depth (sediment) 0-20cm, taihu lake, taihu national park, china, depth (water) 20-100cm, lake sediment)2022-04-25v4No1 / 1378
821sheryoCommon in soil of continuous corn field at 0-10cm depth, Michigan USA (common united states of america, state of michigan, kellogg biological station, ph 5.9, mesic type hapludalf, kalamazoo loam, depth (soil) 0-10cm, continuous corn, corn, soil)2021-07-28v4No1 / 1380
821sheryoHigher at 0-10cm depth compared to 10-25cm depth in soil in Michigan USA ( high in depth (soil) 0-10cm compared to depth (soil) 10-25cm in restored prairie corn miscanthus panicum virgatum kellogg biological station mesic type hapludalf kalamazoo loam state of michigan soil united states of america )2021-08-05v4No1 / 1383
600sheryoCommon in unammended soil after 82 days (common depth (soil) 0-5cm, state of new york, soil, united states of america, coarse-loamy soil, ph 6, day 82)2020-03-27v4No1 / 1395
266amnoncoomon in roots in SIL garden (common brassicaceae, boechera stricta, plant, united states of america, state of idaho, root)2017-12-19v4No1 / 1399
76amnoncommon in non-seleniferous soil (common soil, rhizosphere, united states of america, non-seleniferous, state of florida)2017-02-28v4No1 / 1414
40amnoncommon soil, field soil, nicotiana tabacum, rhizosphere, china2016-12-09v4No1 / 1420
462amnon high in rhizosphere compared to soil in united states of america state of tennessee populus tree cultivated environment 2019-01-12v4No1 / 1428
76amnoncommon in seleniferous soil (common soil, rhizosphere, united states of america, selenium, seleniferous, woodland area)2017-02-28v4No1 / 1438
444amnoncommon rhizosphere, fragaria x ananassa, strawberry, greenhouse soil, farm, yellow brown soil, nanjing city prefecture, age 1 year, china, cultivated environment2019-01-07v4No1 / 1439
783sheryocommon in desert soil in mongolia under water addition treatment (common 100% above ambient precipitation, water addition, ph 7.85, luvic gypsisols, cambic arenosols, china, mongolia, dengkou county, ulan buh desert, bajada, sandy desert, soil)2021-05-11v4No1 / 1442
266amnoncommon in soil from JAM garden (common soil, united states of america, state of idaho, ph 5.5)2017-12-18v4No1 / 1456
271amnoncommon depth (soil) 0-20cm, rhizosphere, glycine max, soybean, china2018-01-09v4No1 / 1459
837sheryoCommon in agricultural field at depths 0-40cm, shaanxi, China (common depth 0-40cm, agricultural field, zea mays, triticum aestivum, silt loam, china, loess plateau, shaanxi province, soil)2021-09-26v4No1 / 1470
145amnoncommon soil, rhizosphere, oryza sativa, rice, united states of america, ph 5.62017-04-19v4No1 / 1515
901amnoncommon sediment surface, depth (sediment) 0cm, taihu lake, depth (water) 20-100cm, taihu national park, china, lake sediment2022-04-25v4No1 / 1550
76amnonhigher in non-seleniferous soil compared to seleniferous soil ( high in non-seleniferous compared to selenium seleniferous in soil united states of america rhizosphere woodland area )2017-02-28v4No1 / 1621
824sheryoCommon in soil after 27-35 years of grazing exclusion at 0-10cm depth, Ningxia china (common yunwushan national natural grassland protection zone, ningxia province, calci-orthic aridisol, haplic calcisol, 27-35 years of grazing exclusion, grazing exclusion, china, depth (soil) 0-10cm, soil)2021-08-08v4No1 / 1659
696amnon high in alycaeus jagori compared to opisthostoma concinnum plectostoma concinnum in land snail stomach gastrointestinal system malaysia state of sabah 2028-03-28v3No1 / 1672
696amnon high in alycaeus jagori compared to georissa similis georissa in land snail stomach gastrointestinal system malaysia state of sabah 2028-03-28v3No1 / 1698
155amnonhigher in tightly bound root soil compared to loose soil and bulk soil ( high in root compared to bulk soil in triticum aestivum wheat soil china )2017-07-02v4No1 / 1714
901amnon high in sediment surface depth (sediment) 0cm compared to depth (sediment) 0-20cm in taihu lake depth (water) 20-100cm taihu national park china lake sediment 2022-04-25v4No1 / 1819
353amnonlower in captive compared to wild caught Lissotriton vulgaris newts skin ( high in wild compared to research facility in newt adult skin cambridgeshire triturus cristatus united kingdom )2018-07-30v4No1 / 1834
931amnon high in ileum feces colon caecum compared to ruminal fluid rumen in riwoqe county china yak tibet autonomous region bos grunniens 2022-08-25v3No1 / 1870
296amnoncommon depth (soil) 0-20cm, soil, north china plain, agricultural feature, wheat, winter, ph>4, ph<5, china2018-02-11v4No1 / 1886
901amnon high in rhizosphere compared to bulk sediment in depth (sediment) 0-20cm taihu lake depth (water) 20-100cm taihu national park china lake sediment 2022-04-25v4No1 / 1892
824sheryoCommon in soil after 0-9 years of grazing exclusion at 0-10cm depth, Ningxia china (common depth (soil) 0-10cm, 0-9 years of grazing exclusion, yunwushan national natural grassland protection zone, ningxia province, calci-orthic aridisol, haplic calcisol, grazing exclusion, china, soil)2021-08-08v4No1 / 1903
155amnoncommon in soil tightly bound to wheat root (common triticum aestivum, wheat, soil, root, china)2017-07-02v4No1 / 1977
296amnoncommon depth (soil) 0-20cm, soil, north china plain, agricultural feature, wheat, winter, ph>7, ph<8, china2018-02-11v4No1 / 2160
353amnonlower in captive compared to wild caught Lissotriton vulgaris newts skin ( high in wild compared to research facility in newt adult skin cambridgeshire lissotriton vulgaris united kingdom )2018-07-30v4No1 / 2162
296amnoncommon depth (soil) 0-20cm, soil, north china plain, agricultural feature, wheat, winter, ph>6, ph<7, china2018-02-11v4No1 / 2223
443amnon high in particles filtered 2.7um compared to free floating filtered 0.2um in water river fresh water depth (water) 1m united states of america mississippi river 2019-01-07v4No1 / 2266
462amnon high in rhizosphere compared to root in united states of america state of tennessee populus tree cultivated environment 2019-01-13v4No2 / 4630
296amnoncommon in wheat field soil (common soil, north china plain, depth 5cm, agricultural feature, wheat, winter, china)2018-02-11v4No1 / 2341
155amnoncommon in soil loosely bound to wheat root (common triticum aestivum, wheat, soil, rhizosphere, china)2017-07-02v4No1 / 2425
101amnoncommon state of new york, vitis vinifera, united states of america, merlot, grapevine, soil2017-04-03v4No1 / 2537
155amnoncommon in bulk soil in wheat field (common triticum aestivum, wheat, soil, bulk soil, china)2017-07-02v4No1 / 2594
296amnoncommon depth (soil) 0-20cm, soil, north china plain, agricultural feature, wheat, winter, ph>8, china2018-02-11v4No1 / 2646
357amnon high in ph>4.5 compared to ph<4.5 in soil topsoil depth (soil) 0-10cm moist tropical forest woodland area forest ecosystem 2018-08-18v4No1 / 2773
271amnoncommon depth (soil) 0-20cm, soil, china2018-01-09v4No1 / 2856
837sheryoHigher in soil of agricultural feild compared to after 20 years reforestation with Black locust trees , shaanxi, China ( high in triticum aestivum zea mays agricultural field compared to 20 years robinia pseudoacacia reforestation in silt loam china loess plateau shaanxi province soil )2021-09-26v4No1 / 2892
837sheryoHigher in soil of agricultural feild compared to after 30 years reforestation with Black locust trees , shaanxi, China ( high in triticum aestivum zea mays agricultural field compared to robinia pseudoacacia 30 years reforestation in silt loam china loess plateau shaanxi province soil )2021-09-27v4No1 / 2927
837sheryoHigher in soil in agricultural feild compared after 10 years reforestation with Black locust trees, shaanxi, China ( high in triticum aestivum zea mays agricultural field compared to 10 years reforestation robinia pseudoacacia in silt loam china loess plateau shaanxi province soil )2021-09-26v4No1 / 2994
265amnon high in soilwater water compared to soil in canada province of quebec 2017-12-11v4No1 / 3277
296amnoncommon depth (soil) 0-20cm, soil, north china plain, agricultural feature, wheat, winter, ph>5, ph<6, china2018-02-11v4No1 / 3508
837sheryoHigher in soil after 30 years compared to 10 years of reforestation with Black locust trees, shaanxi, China ( high in 30 years compared to 10 years in robinia pseudoacacia reforestation silt loam china loess plateau shaanxi province soil )2021-09-27v4No1 / 5245
171amnonlower in roots compared to rhizosphere soil in rice ( high in rhizosphere soil compared to root in united states of america state of california oryza sativa rice )2017-07-25v4No1 / 7628
271amnon high in soil rhizosphere compared to root structure root in depth (soil) 0-20cm glycine max soybean china 2018-01-09v4No1 / 7954

Problems / suggestions? Please email info AT dbbact DOT org