Search result for sequence:
TACGAAGGGGGCTAGCGTTGCTCGGAATCACTGGGCGTAAAGGGTGCGTAGGCGGGTCTTTAAGTCAGGGGTGAAATCCTGGAGCTCAACTCCAGAACTGCCTTTGATACTGAAGATCTTGAGTTCGGGAGAGGTGAGTGGAACTGCGAG
common ontology terms
term enrichment score
TermScore
soil0.486214
rhizosphere0.279374
china0.273854
united states of america0.233924
root0.177893
cultivated environment0.163719
water0.128876
farm0.113130
skin0.102486
brazil0.100935
citrus0.097959
germany0.092000
depth 0-20cm0.090759
river0.079277
state of florida0.078836
depth 0-10cm0.078448
leaf0.076579
ph 7-80.075789
wheat0.075314
drinking water0.074844
fresh water0.072471
triticum aestivum0.071541
topsoil0.071159
research facility0.069794
canada0.069025
mexico0.068479
homo sapiens0.067730
desert0.066212
ph 60.059238
forest ecosystem0.058431
oryza sativa0.055290
agricultural feature0.055163
state of rhode island0.054167
minas gerais state0.054167
campos rupestres0.054167
state of california0.053794
tree0.053443
new york0.050847
paddy field soil0.050847
agave0.050209
woodland area0.049793
foodon product type0.049587
state of tennessee0.049587
intestine0.049587
canis lupus familiaris0.047809
saccharum0.046759
sugarcane0.046759
state of idaho0.046218
root endosphere0.042796
glycine max0.042796
guanajuato0.042194
southern united states0.042194
snake0.041322
orchard0.038136
kingdom of spain0.037847
plant0.037657
united kingdom0.037422
adult0.037383
winter0.036072
feces0.035477
heilongjiang province0.034335
populus0.034043
campinas0.034043
agricultural field0.034043
greenhouse0.033473
ph 70.033473
zhejiang province0.033473
sediment0.033012
dog0.032922
wild0.032787
kingdom of denmark0.031373
control0.030648
mountain0.030140
biochar0.030140
pasture0.030140
soybean0.030140
frog0.030027
coarse-loamy soil0.029915
cannabis sativa0.029915
depth 0-5cm0.029046
nasopharynx0.028630
mississippi river0.025974
hunan province0.025918
elevation 2000-3000m0.025751
day 820.025751
barbacenia macrantha0.025751
myrtillocactus geometrizans0.025751
opuntia robusta0.025751
nasal wash0.025751
north china plain0.025751
air0.025685
nasal cavity0.025668
LOWER IN rhizosphere0.025641
cactus0.025424
semi-arid0.025424
switzerland0.024490
digestive system0.023529
depth 5cm0.021727
rice0.021708
leaf surface0.021708
Fraction of dbbact annotations with this term covered by the query
TermScore
canada1.666667
pond1.000000
cultivated environment0.875000
root0.866667
ph 7-80.857143
rhizosphere0.843750
soil0.806452
triticum aestivum0.800000
oryza sativa0.800000
depth 5cm0.800000
ph 60.750000
root endosphere0.750000
glycine max0.750000
wheat0.750000
river0.750000
agricultural feature0.750000
rice0.750000
leaf surface0.750000
greenhouse soil0.750000
mississippi river0.750000
topsoil0.714286
depth 0-20cm0.714286
new york0.666667
mountain0.666667
ph 4-60.666667
biochar0.666667
pasture0.666667
saccharum0.666667
sugarcane0.666667
citrus0.666667
soybean0.666667
drinking water0.666667
state of illinois0.666667
building0.666667
stream0.666667
kingdom of the netherlands0.666667
heilongjiang province0.666667
zea mays0.666667
stem endosphere0.666667
venezuela0.666667
amerindian0.666667
filtered 2.7um0.666667
paddy field soil0.666667
hunan province0.666667
jiangxi province0.666667
LOWER IN stem0.666667
fen0.666667
subtropical0.666667
particle0.666667
hordeum vulgare0.666667
bulk soil0.666667
npk fertilizer0.666667
depth 0-10cm0.625000
LOWER IN research facility0.600000
frog0.571429
forest ecosystem0.555556
merlot0.500000
grapevine0.500000
elevation 2000-3000m0.500000
siliceous parent material0.500000
rhone river valley0.500000
ph 4.5-70.500000
canton of graubunden0.500000
calcareous parent material0.500000
state of rhode island0.500000
radish0.500000
ph 5.40.500000
coarse-loamy soil0.500000
day 820.500000
stover ammendment 0.500000
montane forest0.500000
minas gerais state0.500000
campos rupestres0.500000
barbacenia macrantha0.500000
tomato0.500000
slit loam soil0.500000
depth 30-75cm0.500000
silt clay loam0.500000
populus0.500000
new zealand0.500000
campinas0.500000
ph 6.70.500000
pierce, fl0.500000
quincy, fl0.500000
state of idaho0.500000
ph 6.50.500000
agricultural field0.500000
immokalee, fl0.500000
gainesville, fl0.500000
myrtillocactus geometrizans0.500000
opuntia robusta0.500000
ph>6, ph<6.50.500000
root zone soil0.500000
high biochar0.500000
low biochar0.500000
peromyscus maniculatus0.500000
deer mice0.500000
province of ontario0.500000
algonquin provincial park0.500000
straw0.500000
Fraction of annotations for the query sequences containing the term
TermScore
soil0.348018
united states of america0.279736
china0.220264
rhizosphere0.167401
root0.099119
cultivated environment0.090308
water0.083700
farm0.066079
brazil0.059471
homo sapiens0.059471
skin0.059471
citrus0.052863
research facility0.050661
germany0.050661
depth 0-20cm0.048458
state of florida0.046256
depth 0-10cm0.041850
river0.041850
leaf0.041850
ph 7-80.039648
wheat0.039648
drinking water0.039648
fresh water0.039648
topsoil0.037445
triticum aestivum0.037445
mexico0.037445
desert0.037445
feces0.035242
canada0.035242
forest ecosystem0.030837
ph 60.030837
state of california0.030837
state of rhode island0.028634
minas gerais state0.028634
campos rupestres0.028634
tree0.028634
agricultural feature0.028634
oryza sativa0.028634
new york0.026432
foodon product type0.026432
woodland area0.026432
canis lupus familiaris0.026432
state of tennessee0.026432
intestine0.026432
agave0.026432
adult0.026432
paddy field soil0.026432
saccharum0.024229
sugarcane0.024229
state of idaho0.024229
root endosphere0.022026
glycine max0.022026
guanajuato0.022026
control0.022026
snake0.022026
southern united states0.022026
plant0.019824
kingdom of spain0.019824
united kingdom0.019824
winter0.019824
orchard0.019824
dog0.017621
populus0.017621
campinas0.017621
greenhouse0.017621
agricultural field0.017621
kingdom of denmark0.017621
ph 70.017621
wild0.017621
sediment0.017621
heilongjiang province0.017621
zhejiang province0.017621
mountain0.015419
biochar0.015419
depth 0-5cm0.015419
coarse-loamy soil0.015419
pasture0.015419
soybean0.015419
nasopharynx0.015419
frog0.015419
cannabis sativa0.015419
switzerland0.013216
elevation 2000-3000m0.013216
day 820.013216
barbacenia macrantha0.013216
mus musculus0.013216
mouse0.013216
myrtillocactus geometrizans0.013216
opuntia robusta0.013216
cactus0.013216
semi-arid0.013216
digestive system0.013216
nasal cavity0.013216
nasal wash0.013216
air0.013216
LOWER IN rhizosphere0.013216
hunan province0.013216
mississippi river0.013216
north china plain0.013216
merlot0.011013
Exp. ID User ID Description Date Region Flag Sequences
101amnondominant merlot, vitis vinifera, grapevine, new york, united states of america, root2017-04-03v4No1 / 1
583amnondominant soil, mountain, switzerland, ph 4-6, depth 0-10cm, elevation 2000-3000m, siliceous parent material, rhone river valley2020-01-27v3No1 / 2
583amnondominant soil, mountain, switzerland, depth 0-10cm, elevation 2000-3000m, siliceous parent material, ph 4.5-7, canton of graubunden2020-01-28v3No1 / 2
583amnondominant soil, mountain, switzerland, depth 0-10cm, elevation 2000-3000m, canton of graubunden, calcareous parent material, ph 7-82020-01-28v3No1 / 2
311amnondominant united states of america, state of rhode island, radish, foodon product type2018-04-09v4No1 / 3
356amnonhigh freq. in deciduous broad leaved forest top soil in japan (dominant soil, depth 0-10cm, hokkaido, topsoil, ph 5.4, japan, forest ecosystem)2018-08-15v4No1 / 3
600sheryoDominant in biochar ammended soil after 82 days (dominant soil, biochar, depth 0-5cm, united states of america, new york, coarse-loamy soil, ph 6, day 82)2020-03-27v4No1 / 3
600sheryoDominant in stover ammended soil after 82 days (dominant soil, depth 0-5cm, united states of america, new york, coarse-loamy soil, ph 6, day 82, stover ammendment )2020-03-27v4No1 / 4
357amnondominant soil, topsoil, depth 0-10cm, montane forest, forest ecosystem, woodland area2018-08-19v4No1 / 5
548amnondominant minas gerais state, campos rupestres, brazil, barbacenia macrantha, rhizosphere2019-08-17v4No1 / 5
146amnondominant united states of america, solanum lycopersicum, tomato, soil, slit loam soil, ph 62017-04-20v4No1 / 6
231amnonhigh freq. in dog urine (dominant dog, canis lupus familiaris, united states of america, urine)2017-11-02v4No1 / 6
462amnondominant united states of america, state of tennessee, depth 30-75cm, silt clay loam, rhizosphere, populus, tree, cultivated environment2019-01-13v4No1 / 6
480amnondominant soil, pasture, farm, new zealand2019-02-05v4No1 / 6
548amnondominant minas gerais state, campos rupestres, brazil, barbacenia macrantha, root endosphere, root2019-08-17v4No1 / 6
615amnondominant endosphere, root, saccharum, sugarcane, campinas, brazil, greenhouse2020-04-27v4No1 / 6
616amnondominant in topsoil of non-fertilized sugarcane field (dominant ph 6.7, sugarcane, saccharum, soil, topsoil, depth 0-20cm, china, guangzhou city prefecture, non-fertilized soil)2020-04-27v3No1 / 6
98amnondominant citrus, rhizosphere, pierce, fl, state of florida, root2017-04-01v4No1 / 7
98amnondominant citrus, rhizosphere, quincy, fl, state of florida, root2017-04-01v4No1 / 8
266amnonhigh freq. in soil from MIL garden (dominant soil, united states of america, state of idaho, ph 6.5)2017-12-18v4No1 / 8
266amnonhigh freq. in soil from SIL garden (dominant soil, united states of america, state of idaho, ph 6)2017-12-18v4No1 / 8
399amnonhigher in ampicillin treated mice compared to controls ( high in ampicillin antibiotic compared to control in feces united states of america research facility mus musculus mouse )2018-11-18v4No1 / 8
474amnondominant farm, soil, soybean, glycine max, ph 4-6, brazil, cultivated environment2019-01-16v4No1 / 8
480amnondominant soil, pasture, farm, ireland2019-02-05v4No1 / 8
610sheryoDominant in agricultural field soil (dominant soil, agricultural field, kingdom of denmark, wheat, ph 7, triticum aestivum)2020-04-21v3No1 / 8
98amnondominant citrus, rhizosphere, immokalee, fl, state of florida, root2017-04-01v4No1 / 9
98amnondominant citrus, rhizosphere, gainesville, fl, state of florida, root2017-04-01v4No1 / 9
129amnondominant mexico, myrtillocactus geometrizans, opuntia robusta, cactus, semi-arid, soil, ph>6, ph<6.5, root zone soil2017-04-15v4No1 / 9
245amnondominant homo sapiens, breast milk, china2017-11-21v4No1 / 9
271amnondominant depth 0-20cm, rhizosphere, glycine max, soybean, china2018-01-09v4No1 / 9
462amnondominant united states of america, state of tennessee, populus, tree, root, cultivated environment2019-01-13v4No1 / 9
610sheryoDominant in agricultural field soil amended with low biochar (dominant soil, agricultural field, kingdom of denmark, wheat, ph 7, high biochar, triticum aestivum, low biochar)2020-04-21v3No1 / 9
152amnonhigh in blanks compares to dust/nose samples (contamination)2017-05-04v4No1 / 10
537amnonhigh freq. in feces of wild caught deer mice feces (dominant feces, canada, peromyscus maniculatus, deer mice, age 3-5 weeks, province of ontario, algonquin provincial park, wild)2019-07-28v3No1 / 10
610sheryoDominant in agricultural field soil amended with high biochar (dominant soil, agricultural field, kingdom of denmark, wheat, ph 7, high biochar, triticum aestivum)2020-04-21v3No1 / 10
610sheryoDominant in agricultural field soil amended with straw (dominant soil, agricultural field, kingdom of denmark, wheat, ph 7, high biochar, triticum aestivum, straw)2020-04-21v3No1 / 10
279amnondominant grassland, steppe, mongolia, soil, china2018-01-24v4No1 / 11
311amnondominant united states of america, state of rhode island, fish sauce, foodon product type2018-04-09v4No1 / 11
548amnonhigh freq. in endopytic roots of Vellozia epidendroides (dominant minas gerais state, campos rupestres, brazil, vellozia epidendroides, plant, root)2019-08-15v4No1 / 11
134amnondominant rhizosphere, tree, taxus, northeast china, temperate, taxus mairei, china2017-04-16v4No1 / 12
231amnonhigh freq. in dog genitalia (dominant dog, canis lupus familiaris, united states of america, reproductive system, reproductive organ, genitalia)2017-11-02v4No1 / 12
266amnonhigh freq. in roots in JAM garden (dominant brassicaceae, boechera stricta, plant, united states of america, state of idaho, root)2017-12-19v4No1 / 12
397amnondominant panama, digestive system, intestine, fungus growing ant, cyphomyrmex longiscapus2018-11-14v4No1 / 12
98amnondominant citrus, rhizosphere, vero beach, fl, state of florida, root2017-04-01v4No1 / 13
245amnoncommon homo sapiens, breast milk, kingdom of spain2017-11-21v4No1 / 13
360amnondominant agave, desert, root endosphere, agave salmiana, mexico, guanajuato, root2018-08-21v4No1 / 13
311amnondominant united states of america, state of rhode island, scallion, foodon product type2018-04-09v4No1 / 14
69amnondominant canis lupus familiaris, beagle dog, united states of america, research facility, bronchoalveolar lavage2017-02-21v4No1 / 15
245amnoncommon homo sapiens, breast milk, china2017-11-21v4No1 / 15
291amnondominant canis lupus familiaris, dog, pair of nares, nasal cavity, germany2018-02-01v4No1 / 15
341amnonlower in fresh drinking water compared to week old water ( high in stagnant water compared to fresh water in water drinking water united states of america tap water state of illinois )2018-05-28v4No1 / 15
397amnoncommon panama, digestive system, intestine, fungus growing ant, cyphomyrmex longiscapus2018-11-14v4No1 / 15
526amnonhigh freq. in bile of healthy controls (dominant control, kingdom of spain, adult, bile, gallbladder, homo sapiens)2019-07-14v3No1 / 16
607amnondominant germany, homo sapiens, nasopharynx, nasal wash, parkinson's disease2020-04-19v4No1 / 16
621amnondominant tick, ixodes antechini, body proper, whole body, australia2020-05-07v1No1 / 16
68amnonfound in some aphid samples (prevalence <=0.1) (other cinara)2017-02-20v4No1 / 17
109amnondominant usa, water, drinking water, site a2017-04-08v4No1 / 17
360amnondominant agave, desert, root endosphere, mexico, guanajuato, agave tequiliana, cultivated environment, root2018-08-21v4No1 / 17
526amnon high in control compared to cholelithiasis in homo sapiens gallbladder bile adult kingdom of spain 2019-07-14v3No1 / 17
607amnoncommon germany, homo sapiens, nasopharynx, nasal wash, control2020-04-19v4No1 / 17
607amnondominant germany, homo sapiens, nasopharynx, nasal wash, control2020-04-19v4No1 / 17
196amnondominant water, drinking water, united states of america2017-09-12v4No1 / 18
245amnoncommon homo sapiens, breast milk, finland2017-11-21v4No1 / 18
607amnondominant germany, homo sapiens, nasopharynx, nasal wash, rem sleep behavior disorder2020-04-19v4No1 / 18
115amnoncommon coreius guichenoti, largemouth bronze gudgeon, fish, freshwater river biome, yangtze river, intestine, china2017-04-10v4No1 / 19
245amnoncommon homo sapiens, breast milk, south africa2017-11-21v4No1 / 19
285amnoncommon in effluent from middle ear (common homo sapiens, child, obsolete_juvenile stage, middle ear, acute transudative otitis media, united states of america, state of washington)2018-01-27v4No1 / 19
607amnoncommon germany, homo sapiens, nasopharynx, nasal wash, parkinson's disease2020-04-19v4No1 / 19
271amnoncommon depth 0-20cm, glycine max, soybean, root structure, root, root nodule, china2018-01-09v4No1 / 20
539amnondominant ethiopia, ensete ventricosum, ethiopian banana, early timepoint, aerobic fermentation, days 1-15, food (fermented)2019-07-31v4No1 / 20
109amnondominant water, drinking water, united states of america, site e2017-04-08v4No1 / 21
311amnoncommon united states of america, state of rhode island, miso food product, food (fermented)2018-04-09v4No1 / 22
109amnondominant water, drinking water, united states of america, site b2017-04-08v4No1 / 23
348amnonsuspected contaminant (found in H2O samples) (contamination)2018-07-16v4No1 / 25
607amnoncommon germany, homo sapiens, nasopharynx, nasal wash, rem sleep behavior disorder2020-04-19v4No1 / 25
311amnoncommon united states of america, state of rhode island, allium cepa, onion, foodon product type2018-04-09v4No1 / 26
536amnoncommon snake, skin, united states of america, southern united states, diadophis punctatus, ringneck snake, fossorial snake2019-07-28v4No1 / 26
129amnonfound INSIDE roots of cactus (common mexico, myrtillocactus geometrizans, opuntia robusta, cactus, semi-arid, root interior, root)2017-04-15v4No1 / 29
109amnon high in water treatment plant compared to distribution system in water drinking water united states of america site b 2017-04-08v4No1 / 30
109amnoncommon water, drinking water, united states of america, site b2017-04-08v4No1 / 31
311amnoncommon united states of america, state of rhode island, garlic, foodon product type2018-04-09v4No1 / 34
536amnoncommon snake, skin, united states of america, southern united states, carphophis amoenus, worm snake, fossorial snake2019-07-28v4No1 / 35
539amnoncommon ethiopia, ensete ventricosum, ethiopian banana, early timepoint, aerobic fermentation, days 1-15, food (fermented)2019-07-31v4No1 / 35
311amnoncommon united states of america, state of rhode island, radish, foodon product type2018-04-09v4No1 / 36
367amnoncommon air, namibia, coast2018-09-02v4No1 / 36
93amnon high in shell gland compared to egg jelly shelled egg in hawaii bobtail squid euprymna scolopes 2017-03-12v4No1 / 38
526amnoncommon in bile of healthy controls (common homo sapiens, gallbladder, bile, adult, kingdom of spain, control)2019-07-14v3No1 / 39
614amnondecreases in picher plant fluid grown in lab ( high in wild early time points days 0-3 compared to research facility late time points days 57-60 in harvard forest plant fluid pitcher fluid united states of america commonwealth of massachusetts pitcher plant sarracenia purpurea )2020-04-26v4No1 / 42
231amnoncommon in dog genitalia (common dog, canis lupus familiaris, united states of america, reproductive system, reproductive organ, genitalia)2017-11-02v4No1 / 43
69amnoncommon canis lupus familiaris, beagle dog, united states of america, research facility, bronchoalveolar lavage2017-02-21v4No1 / 44
113amnoncommon danio rerio, zebra fish, research facility, united states of america, intestine, larval stage2017-04-10v4No1 / 45
258amnonhigher lungs of hiv pneumonia patients not treated with ceftriaxone ( high in no ceftriaxone compared to ceftriaxone in homo sapiens hiv infection uganda bronchoalveolar lavage bronchial epithelium lung pneumonia )2017-11-27v4No1 / 47
287amnoncommon snow field, mountain, depth 6-7m, japan2018-01-29v4No1 / 47
109amnon high in water treatment plant compared to distribution system in usa water drinking water site a 2017-04-08v4No1 / 48
256amnonlower in intestinal contents compared to mucosal scraping in pig caecum ( high in mucosa compared to intestinal contents in sus scrofa pig caecum united kingdom )2017-11-26v4No1 / 50
462amnoncommon united states of america, state of tennessee, populus, tree, root, cultivated environment2019-01-13v4No1 / 51
360amnoncommon agave, desert, root endosphere, agave deserti, state of california, root2018-08-21v4No1 / 52
109amnoncommon usa, water, drinking water, site a2017-04-08v4No1 / 54
437amnoncommon fish, zebra fish, danio rerio, juvenile organism, age 21 days, intestine, research facility, united states of america, state of oregon2018-12-26v4No1 / 54
354amnon high in bronchus bronchial epithelium bronchial brush compared to sputum induced sputum in homo sapiens united states of america adult 2018-07-30v4No1 / 55
492amnoncommon skin, adult, chile, eupsophus vertebralis, frog2019-02-27v4No1 / 55
431amnoncommon in midgut of hibernating bumble bees (common research facility, midgut, belgium, bombus terrestris, bumble bee, queen, hibernation)2018-12-16v4No1 / 57
281amnoncommon shinisaurus crocodilurus, crocodile lizard, cloaca, china2018-01-25v4No1 / 59
523amnonhigher in houses with dogs ( high in dog canis lupus familiaris compared to no dog in air building bedroom united states of america chicago state of illinois )2019-07-03v4No1 / 59
149amnoncommon salamandra salamandra, fire salamander, germany, larval stage, amphibian larval stage, intestine, stream2017-04-24v4No1 / 60
522amnonlower in western diet compared to control high sugar diet ( high in high sugar diet compared to western diet very high sugar diet high fat diet in mouse mus musculus feces germany research facility female c57bl/6j janvier labs age 18 weeks )2019-07-03v3No1 / 60
374amnoncommon skin, costa rica, amphibia, oophaga pumilio, strawberry poison frog, frog2018-09-09v4No1 / 61
196amnonhigher in biofilms in water at 60C compared to 40C ( high in temp 60c high temperature environment compared to control temp 40c in drinking water united states of america water biofilm )2017-09-12v4No1 / 62
360amnoncommon agave, desert, root endosphere, mexico, guanajuato, agave tequiliana, cultivated environment, root2018-08-21v4No1 / 62
549amnoncommon acropora cervicornis, coral, puerto rico, isla palominos2019-08-17v4No1 / 62
311amnoncommon united states of america, state of rhode island, red pepper, foodon product type2018-04-09v4No1 / 63
536amnoncommon snake, skin, united states of america, southern united states, coluber constrictor, eastern racer snake2019-07-28v4No1 / 64
558amnon high in duodenum compared to caecum in bird centrocercus urophasianus greater sage-grouse united states of america state of wyoming 2019-09-20v4No1 / 64
109amnoncommon water, drinking water, united states of america, site d2017-04-08v4No1 / 67
311amnoncommon united states of america, state of rhode island, fish sauce, foodon product type2018-04-09v4No1 / 68
231amnoncommon in dog urine (common dog, canis lupus familiaris, united states of america, urine)2017-11-02v4No1 / 69
417amnoncommon anser cygnoides, swan goose, bird, feces, winter, china2018-12-01v4No1 / 70
69amnoncommon canis lupus familiaris, beagle dog, united states of america, research facility, nasal cavity, mucus2017-02-21v4No1 / 77
431amnonhigher in midgut of hibernating bumble bees compared to non-hibernating ( high in hibernation compared to non hibernating in bombus terrestris bumble bee midgut research facility queen belgium )2018-12-16v4No1 / 77
109amnoncommon water, drinking water, united states of america, site e2017-04-08v4No1 / 80
534amnoncommon river, water, fresh water, depth 10 cm, koshi river, tributary, nepal, free floating, filtered 0.2um2019-07-22v4No1 / 80
109amnon high in distribution system compared to water treatment plant in usa water drinking water site c 2017-04-08v4No1 / 81
426amnoncommon soil, tundra, permafrost, russia, nenets autonomous okrug2018-12-08v4No1 / 81
522amnon high in high sugar diet age 18 weeks compared to age 6 weeks mouse chow in mouse mus musculus feces germany research facility female c57bl/6j janvier labs 2019-07-03v3No1 / 81
231amnoncommon in dog rectum (common dog, canis lupus familiaris, united states of america, rectum, feces)2017-11-02v4No1 / 84
227amnonhiger in first 24hrs compared to later timepoints in baby nasopharynx ( high in age age <=24 hours compared to age >= 7 days in homo sapiens nasopharynx nasal cavity infant kingdom of the netherlands )2017-10-30v4No1 / 85
311amnoncommon in salted cabbage (common cabbage, united states of america, state of rhode island, foodon product type)2018-04-09v4No1 / 85
109amnoncommon usa, water, drinking water, site c2017-04-08v4No1 / 86
360amnoncommon agave, desert, root endosphere, agave salmiana, mexico, guanajuato, root2018-08-21v4No1 / 87
402amnoncommon sediment, soil, mine tailing, alkaline mine tailing, guangxi zhuang autonomous region, zone 1, china2018-11-18v4No1 / 87
199amnonhigher in bathroom shower compared to kitchen sink ( high in bathroom shower tile building wall compared to kitchen sink in building urban biome united states of america )2017-10-01v4No1 / 91
354amnon high in bronchus bronchial brush bronchial epithelium compared to saliva oral wash in homo sapiens united states of america adult 2018-07-30v4No1 / 94
360amnoncommon desert, soil, rhizosphere, agave, mexico, guanajuato, agave tequiliana, cultivated environment2018-08-21v4No1 / 98
99amnoncommon commonwealth of virginia, united states of america, skin, mucus, rana catesbeiana, bullfrog2017-04-02v4No1 / 99
548amnon high in plant root compared to rhizosphere in minas gerais state campos rupestres brazil vellozia epidendroides 2019-08-15v4No1 / 100
536amnoncommon crotalus horridus, snake, skin, united states of america, southern united states, timber rattlesnake2019-07-28v4No1 / 101
536amnoncommon snake, skin, united states of america, southern united states, fossorial snake, storeria dekayi, ground snake2019-07-28v4No1 / 101
499amnoncommon brazil, pond, digestive system, intestine, dendropsophus minutus, frog, tadpole2019-03-05v4No1 / 102
149amnon high in stream compared to pond in salamandra salamandra fire salamander germany larval stage amphibian larval stage intestine 2017-04-24v4No1 / 107
271amnon high in root structure root compared to soil rhizosphere in depth 0-20cm glycine max soybean china 2018-01-09v4No1 / 110
536amnoncommon snake, skin, united states of america, southern united states, thamnophis sirtalis, common garter snake2019-07-28v4No1 / 110
539amnon high in early timepoint days 1-15 aerobic fermentation compared to late timepoint days 30-60 anaerobic fermentation in ethiopia ensete ventricosum ethiopian banana food (fermented) 2019-07-31v4No1 / 110
536amnoncommon snake, skin, united states of america, southern united states, aquatic snake, nerodia sipedon, northern water snake2019-07-28v4No1 / 111
269amnoncommon in fresh yao meat food (common china, foodon product type)2018-01-09v4No1 / 113
98amnoncommon citrus, leaf, vero beach, fl, state of florida2017-04-01v4No1 / 115
536amnoncommon snake, skin, united states of america, southern united states, agkistrodon piscivorus, aquatic snake2019-07-28v4No1 / 115
343amnoncommon in apple flowers (common apple, malus x domestica, flower structure, flower, united states of america, state of connecticut)2018-05-28v4No1 / 118
410amnonlower in feces compared to rectal biopsies in children with treatment naive uc ( high in rectum biopsy biopsy site compared to feces in homo sapiens child united states of america ulcerative colitis )2018-11-22v4No1 / 118
414amnon high in manured soil compared to non-manured soil in soil heilongjiang province agricultural feature triticum aestivum glycine max zea mays black soil mollisol china 2018-11-26v4No1 / 118
196amnoncommon in biofilm in tap water (common water, drinking water, united states of america, biofilm)2017-09-12v4No1 / 121
311amnoncommon united states of america, state of rhode island, scallion, foodon product type2018-04-09v4No1 / 121
374amnoncommon skin, costa rica, amphibia, rhaebo haematiticus, truando toad, toad2018-09-09v4No1 / 121
537amnoncommon in feces of captive grown deer mice feces (common feces, canada, peromyscus maniculatus, deer mice, age 3-5 weeks, province of ontario, algonquin provincial park, research facility, captive)2019-07-28v3No1 / 121
548amnoncommon minas gerais state, campos rupestres, brazil, barbacenia macrantha, stem, stem endosphere2019-08-17v4No1 / 123
98amnoncommon citrus, leaf, ft. pierce, fl, state of florida2017-04-01v4No1 / 126
522amnoncommon mouse, mus musculus, feces, germany, research facility, female, c57bl/6j, janvier labs, age 18 weeks, high sugar diet2019-07-03v3No1 / 126
522amnoncommon mouse, mus musculus, feces, germany, research facility, female, c57bl/6j, janvier labs, age 6 weeks, mouse chow2019-07-03v3No1 / 130
417amnon high in winter china compared to mongolia summer in anser cygnoides swan goose bird feces 2018-12-01v4No1 / 132
263amnonlower in soils irrigated with artificial wastewater compared to other methods ( high in tapwater irrigation fertilized water irrigation treated wastewater irrigation compared to artificial wastewater irrigation in soil israel sandy loam soil negev desert ph 7-8 irrigated research facility )2017-12-11v4No1 / 134
374amnoncommon skin, costa rica, amphibia, craugastor fitzingeri, common rain frog, frog2018-09-09v4No1 / 136
585amnoncommon china, pomacea canaliculata, golden apple snail, nanheng river, qingpu district, buccal mass2020-02-02v3No1 / 136
617amnoncommon alpine pasture, alpine, farm, italy, cow milk (raw), cow milk (fluid), milk2020-05-03v3No1 / 137
582amnoncommon urocyon littoralis catalinae, santa catalina island fox, santa catalina island, united states of america, wild, urocyon littoralis, axilla2020-01-22v4No1 / 140
291amnoncommon canis lupus familiaris, dog, pair of nares, nasal cavity, germany2018-02-01v4No1 / 144
475amnoncommon in air next to subway stations in hong kong (common air, hong kong, city)2019-01-20v4No1 / 147
615amnon high in stem endosphere upper stem stem compared to leaf endosphere leaf in endosphere saccharum sugarcane campinas brazil greenhouse 2020-04-27v4No1 / 153
171amnoncommon united states of america, state of california, oryza sativa, rice, root2017-07-25v4No1 / 156
108amnon high in colon compared to caecum in research facility texas united states of america coturnix coturnix common quail 2017-04-07v4No1 / 157
515amnoncommon poland, whole body, beetle, plant, nida basin, herbivorous beetle, crioceris duodecimpunctata2019-04-18v4No1 / 157
402amnoncommon sediment, soil, mine tailing, alkaline mine tailing, guangxi zhuang autonomous region, zone 2,3, china2018-11-18v4No1 / 159
98amnoncommon citrus, leaf, immokalee, fl, state of florida2017-04-01v4No1 / 160
475amnoncommon in air in subway train in hong kong (common air, hong kong, city, subway)2019-01-20v4No1 / 161
537amnoncommon in feces of wild caught deer mice feces (common feces, canada, peromyscus maniculatus, deer mice, age 3-5 weeks, province of ontario, algonquin provincial park, wild)2019-07-28v3No1 / 163
232amnoncoomon in foot of healthy controls (common homo sapiens, skin, australia, foot)2017-11-05v4No1 / 166
357amnoncommon in moist tropical forest topsoil around the world (common soil, topsoil, depth 0-10cm, moist tropical forest, woodland area, forest ecosystem)2018-08-18v4No1 / 171
374amnoncommon skin, costa rica, amphibia, craugastor bransfordii, bransford’s litter frog, frog2018-09-09v4No1 / 171
534amnoncommon river, water, fresh water, depth 10 cm, koshi river, nepal, free floating, filtered 0.2um2019-07-22v4No1 / 172
384amnoncommon equus caballus, horse, canada, farm, nasal cavity, pair of nares, pasture2018-10-22v4No1 / 175
99amnoncommon commonwealth of virginia, united states of america, skin, mucus, anaxyrus americanus, american toad2017-04-02v4No1 / 176
499amnoncommon brazil, pond, digestive system, intestine, scinax fuscovarius, frog, tadpole2019-03-05v4No1 / 176
196amnoncommon water, drinking water, united states of america2017-09-12v4No1 / 178
311amnoncommon ginger, united states of america, state of rhode island, foodon product type2018-04-09v4No1 / 180
179amnoncommon mus musculus, mouse, oral cavity, research facility, united states of america, balb/c, mouth2017-08-13v4No1 / 183
536amnoncommon snake, skin, united states of america, southern united states, pantherophis obsoletus, black rat snake, arboreal snake2019-07-28v4No1 / 184
98amnoncommon citrus, leaf, quincy, fl, state of florida2017-04-01v4No1 / 188
75amnoncommon homo sapiens, skin, arm, venezuela, amerindian, hunter gatherer2017-02-27v4No1 / 191
534amnoncommon river, water, fresh water, depth 10 cm, koshi river, tributary, nepal, particle bound, filtered 2.7um2019-07-22v4No1 / 193
585amnoncommon china, pomacea canaliculata, golden apple snail, nanheng river, qingpu district, stomach2020-02-02v3No1 / 194
371amnoncommon homo sapiens, skin, amerindian, hunter gatherer, venezuela2018-09-06v4No1 / 195
316amnoncommon united states of america, soil, topsoil, state of ohio, depth 0-10cm, ph 5, forest ecosystem2018-04-10v4No1 / 199
375amnonlower in oil contaminated soil planted with plants compared to control oil contaminated soil ( high in control compared to rhizosphere planted soil in soil kuwait desert oil contaminated soil )2018-09-09v4No1 / 200
6amnoncommon urine, female, homo sapiens, pregnancy, state of tennessee2016-10-13v4No1 / 201
618amnoncommon early flowering stage, canada, farm, root, root endosphere, cannabis sativa2020-05-04v4No1 / 205
360amnoncommon agave, desert, leaf, leaf surface, mexico, guanajuato, agave tequiliana, cultivated environment2018-08-21v4No1 / 210
421amnonlower in paddy field soil incubated with copper compared to controls ( high in control compared to copper in soil research facility zhejiang province paddy field soil china )2018-12-02v4No1 / 212
98amnoncommon citrus, leaf, gainesville, fl, state of florida2017-04-01v4No1 / 215
196amnonhigher in water compared to biofilm ( high in water compared to biofilm in drinking water united states of america )2017-09-12v4No1 / 223
583amnoncommon soil, mountain, switzerland, ph 4-6, depth 0-10cm, elevation 2000-3000m, siliceous parent material, rhone river valley2020-01-27v3No1 / 234
279amnoncommon grassland, steppe, mongolia, soil, china2018-01-24v4No1 / 235
536amnoncommon snake, skin, united states of america, southern united states, agkistrodon contortrix, copperhead snake2019-07-28v4No1 / 236
585amnoncommon china, pomacea canaliculata, golden apple snail, nanheng river, qingpu district, intestine2020-02-02v3No1 / 240
69amnoncommon canis lupus familiaris, beagle dog, united states of america, research facility, oropharynx2017-02-21v4No1 / 241
384amnon high in pasture compared to barn hay in equus caballus horse canada farm saliva mouth 2018-10-22v4No1 / 245
279amnoncommon grassland, soil, alpine soil, tibetan plateau, china2018-01-24v4No1 / 253
617amnoncommon lowland pasture, lowland farm, farm, italy, cow milk (raw), cow milk (fluid), milk2020-05-03v3No1 / 257
253amnoncommon in clouds in puy de dome mountain in france (common cloud, french republic, air, autumn)2017-11-22v4No1 / 267
499amnoncommon brazil, pond, digestive system, intestine, astyanax paranae, fish, astyanax2019-03-05v4No1 / 273
315amnoncommon in frog pond water (common hunan province, jiangxi province, water, fresh water, pond, china)2018-04-10v4No1 / 274
423amnoncommon bank vole, myodes glareolus, ukraine, skin2018-12-05v4No1 / 291
156amnoncommon brassica, brassica oleracea, leaf, phyllosphere, china2017-07-27v4No1 / 292
37amnoncommon in plastic leaf plants (in field next to tomato plants) (common maryland county, leaf)2016-12-09v4No1 / 298
462amnon high in populus trichocarpa x deltoides compared to populus deltoides in united states of america state of tennessee populus tree root cultivated environment 2019-01-13v4No1 / 300
577amnoncommon lake, romania, ursu lake, water, lake water, depth 4-9m, high salinity, hypersaline water, monimolimnion2020-01-09v3No1 / 303
384amnon high in pasture compared to barn hay in equus caballus horse canada farm nasal cavity pair of nares 2018-10-22v4No1 / 304
515amnoncommon carnivorous beetle, river, poland, raba river, whole body, beetle, bembidion punctulatum2019-04-18v4No1 / 305
534amnoncommon river, water, fresh water, depth 10 cm, koshi river, nepal, particle bound, filtered 2.7um2019-07-22v4No1 / 315
309amnon high in other plants compared to meadow pea-vine lathyrus pratensis in rhizosphere germany 2018-04-05v4No1 / 316
618amnoncommon pre-vegetative stage, canada, farm, root, root endosphere, cannabis sativa2020-05-04v4No1 / 318
322amnon high in tadpole compared to adult in frog osteopilus septentrionalis united states of america state of florida research facility digestive system 2018-04-23v4No1 / 320
615amnon high in leaf surface leaf compared to stem surface upper stem stem in exosphere saccharum sugarcane campinas brazil greenhouse 2020-04-27v4No1 / 321
311amnoncommon in floor of kimchi production facility (common united states of america, state of rhode island, floor, food processing factory)2018-04-09v4No1 / 324
512amnoncommon fen, peatland, peat soil, soil, hani peatland, baekdudaegan, ph 5-6, china2019-03-22v4No1 / 329
565amnoncommon skin, canada, equus asinus africanus, donkey, farm2019-11-21v3No1 / 335
175amnonhigher in winter compared to summer in heavy metal contaminated soils in china ( high in winter compared to summer in soil heavy metal china )2017-07-29v4No1 / 337
129amnoncommon mexico, myrtillocactus geometrizans, opuntia robusta, cactus, rhizosphere, semi-arid2017-04-15v4No1 / 338
618amnoncommon late flowering stage, canada, farm, root, root endosphere, cannabis sativa2020-05-04v4No1 / 352
537amnonlower in feces of deer mice grown in captivity compared to wild caught ( high in wild compared to captive research facility in feces canada peromyscus maniculatus deer mice age 3-5 weeks province of ontario algonquin provincial park )2019-07-28v3No1 / 358
583amnoncommon soil, mountain, switzerland, depth 0-10cm, elevation 2000-3000m, siliceous parent material, ph 4.5-7, canton of graubunden2020-01-27v3No1 / 359
512amnon high in hani peatland baekdudaegan ph 5-6 compared to riganqiao peatland tibetan plateau ph 5.5-6.5 in fen peatland peat soil soil china 2019-03-22v4No1 / 363
252amnonhigh on sand biofilm compared to rock biofilm in river ( high in epipsammic sand compared to epilithic rock in kingdom of spain biofilm river sediment )2017-11-22v4No1 / 374
582amnon high in ear canal external acoustic meatus compared to perianal skin rectum in wild united states of america santa catalina island urocyon littoralis santa catalina island fox urocyon littoralis catalinae 2020-01-22v4No1 / 374
256amnoncommon sus scrofa, pig, duodenum, jejunum, ileum, united kingdom2017-11-26v4No1 / 380
256amnonhigher in small intestine compared to colon in pigs ( high in duodenum jejunum ileum compared to caecum right colon left colon in sus scrofa pig united kingdom )2017-11-26v4No1 / 387
170amnonhigher in low turbidity river water ( high in low turbidity turbidity compared to high turbidity in river water fresh water depth 10 cm united states of america stream )2017-07-24v4No1 / 395
347amnoncommon kingdom of norway, svalbard archipelago, permafrost, soil, depth 0-20cm, permafrost active layer2018-07-15v4No1 / 405
558amnon high in gizzard compared to crop in bird centrocercus urophasianus greater sage-grouse united states of america state of wyoming 2019-09-20v4No1 / 408
353amnoncommon in wild Lissotriton vulgaris newts skin (common newt, adult, skin, lissotriton vulgaris, cambridgeshire, united kingdom)2018-07-30v4No1 / 418
309amnon high in onobrychis viciifolia common sainfoin compared to other plants in rhizosphere germany 2018-04-05v4No1 / 420
612amnoncommon state of florida, united states of america, spring water, water, fresh water, location 32020-04-22v4No1 / 420
360amnoncommon desert, soil, rhizosphere, agave, agave deserti, state of california2018-08-21v4No1 / 432
360amnoncommon desert, soil, mexico, guanajuato2018-08-21v4No1 / 437
99amnoncommon commonwealth of virginia, united states of america, skin, mucus, pseudacris crucifer, peeper2017-04-02v4No1 / 438
577amnon high in hypersaline water high salinity depth 4-9m monimolimnion compared to depth 0-3m mixolimnion low salinity in lake romania ursu lake water lake water 2020-01-09v3No1 / 439
353amnoncommon in wild Triturus cristatus newts skin (common newt, adult, skin, cambridgeshire, triturus cristatus, united kingdom)2018-07-30v4No1 / 456
415amnonhigher in citrus from humid subtropical compared to mediterranean and semi-arid climate ( high in subtropical compared to mediterranean semi-arid in rhizosphere soil citrus orchard cultivated environment )2018-11-27v4No1 / 458
128amnoncommon belgium, ivy, hedera ibernica, leaf, city, dense settlement biome2017-04-14v4No1 / 461
357amnoncommon soil, topsoil, depth 0-10cm, woodland area, forest ecosystem2018-08-19v4No1 / 474
347amnon high in depth 0-20cm permafrost transition layer compared to depth 20-30cm in kingdom of norway svalbard archipelago permafrost soil 2018-07-15v4No1 / 477
236amnoncommon state of california, bodega bay, ocean, zostera marina, marine eelgrass, root2017-11-07v4No1 / 483
360amnoncommon desert, soil, rhizosphere, agave, agave salmiana, mexico, guanajuato2018-08-21v4No1 / 484
438amnon high in age 30-50 age 60-79 adult compared to age 3-6 age 8-12 child in homo sapiens feces china 2018-12-30v4No1 / 486
375amnoncommon in oil contaminated desert soil (common soil, kuwait, desert, oil contaminated soil)2018-09-09v4No1 / 490
360amnoncommon agave, desert, leaf, leaf surface, agave salmiana, mexico, guanajuato2018-08-21v4No1 / 492
415amnoncommon rhizosphere, soil, citrus, orchard, united states of america, cultivated environment2018-11-27v4No1 / 494
357amnoncommon soil, topsoil, depth 0-10cm, southern temperate forest, temperate broadleaf and mixed forest biome, woodland area, forest ecosystem2018-08-19v4No1 / 499
360amnoncommon desert, soil, mexico, guanajuato, cultivated environment2018-08-21v4No1 / 500
373amnoncommon soil, rhizosphere, oryza sativa, rice, hunan province, rice field, china2018-09-08v4No1 / 501
616amnon high in ph 6.7 non-fertilized soil compared to ph 5.5-6 fertilized soil in sugarcane saccharum soil topsoil depth 0-20cm china guangzhou city prefecture 2020-04-27v3No1 / 504
315amnonhigher in frog pond water compared to frog gut ( high in water fresh water compared to digestive system colon frog quasipaa spinosa giant spiny frog in jiangxi province hunan province china )2018-04-10v4No1 / 505
612amnoncommon state of florida, united states of america, spring water, water, fresh water, location 12020-04-22v4No1 / 518
578amnonhigher in gay (msm) individuals compared to heterosexual (msw) ( high in homosexual msm gay compared to msw heterosexual in homo sapiens feces hiv infection kingdom of spain sweden adult male )2020-01-14v3No1 / 519
615amnon high in endosphere root compared to rhizosphere in saccharum sugarcane campinas brazil greenhouse 2020-04-27v4No1 / 529
618amnoncommon pre-vegetative stage, rhizosphere, canada, farm, cannabis sativa2020-05-04v4No1 / 530
178amnonlower in drinking water compared to loose deposits in water pipes ( high in deposits compared to drinking water in kingdom of the netherlands water )2017-08-10v4No1 / 538
603amnoncommon in baijiu fermentation pit mud in first 2 batches (common mud, fermentation pit mud, baijiu, china, hefei city prefecture, days 0-90)2020-04-05v3No1 / 542
98amnoncommon citrus, rhizosphere, immokalee, fl, root, state of florida2017-04-01v4No1 / 543
98amnoncommon citrus, rhizosphere, vero beach, fl, root, state of florida2017-04-01v4No1 / 544
548amnoncommon on leaf surface (common minas gerais state, campos rupestres, brazil, vellozia epidendroides, leaf)2019-08-17v4No1 / 548
309amnon high in other plants compared to woundwort prunella vulgaris in rhizosphere germany 2018-04-05v4No1 / 550
548amnoncommon in leaf surface of barbacenia macrantha (common minas gerais state, campos rupestres, brazil, barbacenia macrantha, leaf, leaf surface)2019-08-17v4No1 / 550
129amnoncommon mexico, myrtillocactus geometrizans, opuntia robusta, cactus, semi-arid, leaf2017-04-15v4No1 / 562
357amnoncommon soil, topsoil, depth 0-10cm, mediterranean forest biome, forest ecosystem, woodland area2018-08-19v4No1 / 564
254amnon high in summer wet season autumn compared to winter dry season in river water fresh water depth 0.5m jiulong river fujian province china 2017-11-23v4No1 / 571
548amnoncommon minas gerais state, campos rupestres, brazil, barbacenia macrantha, root endosphere, root2019-08-17v4No1 / 575
254amnon high in summer wet season compared to winter dry season autumn in river water fresh water depth 0.5m jiulong river fujian province china 2017-11-23v4No1 / 581
357amnoncommon soil, topsoil, depth 0-10cm, montane forest, woodland area, forest ecosystem2018-08-19v4No1 / 592
360amnon high in rhizosphere agave compared to soil in desert mexico state of california 2018-08-21v4No1 / 593
612amnoncommon state of florida, united states of america, spring water, water, fresh water, location 22020-04-22v4No1 / 596
415amnoncommon rhizosphere, soil, citrus, orchard, south africa, cultivated environment2018-11-27v4No1 / 600
357amnoncommon soil, topsoil, depth 0-10cm, savanna, forest ecosystem, woodland area2018-08-19v4No1 / 614
438amnonlower in students and soldiers age 19-24 compared to older adults ( high in age 30-50 age 60-79 age >94 compared to age 19-24 soldiers in homo sapiens feces china )2018-12-30v4No1 / 617
128amnoncommon belgium, ivy, hedera ibernica, leaf, moor, scrubland2017-04-14v4No1 / 623
609sheryoCommon in soil with tobacco plants and difenoconazole fungicide amended with biochar (common soil, depth 0-20cm, limestone, tobacco field, china, ph 7-8, fungicide, difenoconazole, tobacco plant present, biochar)2020-04-21v4No1 / 634
360amnoncommon desert, soil, state of california2018-08-21v4No1 / 637
360amnoncommon agave, desert, state of california, agave deserti, leaf, leaf surface2018-08-21v4No1 / 649
548amnoncommon minas gerais state, campos rupestres, brazil, barbacenia macrantha, rhizosphere2019-08-17v4No1 / 651
200amnoncommon in river downstream of wastewater treatment plant (common river, fresh water, water, united states of america, wastewater treatment plant, effluent)2017-10-01v4No1 / 655
612amnoncommon state of florida, united states of america, spring water, water, fresh water, location 42020-04-22v4No1 / 655
178amnoncommon in drinking water pipe loose deposits (common kingdom of the netherlands, water, deposits, drinking water)2017-08-10v4No1 / 656
609sheryocommon in soil with tobacco plants and difenoconazole fungicide unamended with biochar (common soil, depth 0-20cm, limestone, tobacco field, china, ph 7-8, fungicide, difenoconazole, tobacco plant present)2020-04-21v4No1 / 671
236amnon high in root compared to sediment marine sediment in state of california bodega bay ocean zostera marina marine eelgrass 2017-11-07v4No1 / 674
357amnoncommon in temperate deciduous forests around the world (common soil, topsoil, depth 0-10cm, temperate woodland biome, temperate deciduos forest, woodland area, forest ecosystem)2018-08-18v4No1 / 681
521amnonlower in pre-weaned pigs compared to weaned older timepoints ( high in weaned age 4-7 weeks corn and soybean diet compared to preweaned suckling age 2-4 weeks in pig sus scrofa feces farm jiangxi province china )2019-07-02v3No1 / 681
422amnoncommon soil, paddy field soil, oryza sativa, heilongjiang province, ph 6-7, cultivated environment, china2018-12-04v4No1 / 682
100amnoncommon soil, urban biome, park, new york city, central park2017-04-03v4No1 / 685
128amnoncommon belgium, ivy, hedera ibernica, leaf, forest ecosystem2017-04-14v4No1 / 693
134amnon high in taxus mairei southeast china subtropical compared to taxus media taxus cuspidata northeast china temperate in rhizosphere tree taxus china 2017-04-16v4No1 / 694
347amnoncommon kingdom of norway, svalbard archipelago, permafrost, soil, depth 20-30cm2018-07-15v4No1 / 698
357amnon high in ph>3 compared to ph<3 in soil topsoil depth 0-10cm subpolar coniferous forest biome boreal forest woodland area forest ecosystem 2018-08-19v4No1 / 719
415amnoncommon rhizosphere, soil, citrus, orchard, reunion island, cultivated environment2018-11-27v4No1 / 721
422amnoncommon soil, paddy field soil, oryza sativa, heilongjiang province, ph 5-6, cultivated environment, china2018-12-04v4No1 / 726
462amnoncommon united states of america, state of tennessee, soil, depth 30-75cm, silt clay loam, cultivated environment2019-01-13v4No1 / 728
421amnoncommon in paddy field soil incubated with copper (common soil, research facility, zhejiang province, paddy field soil, copper, china)2018-12-02v4No1 / 740
415amnoncommon rhizosphere, soil, citrus, australia, orchard, cultivated environment2018-11-27v4No1 / 743
600sheryoDecreases after 12 days of stover ammendment in soil ( high in day 1 compared to day 12 in soil depth 0-5cm united states of america new york coarse-loamy soil ph 6 stover ammendment soil )2020-03-27v4No1 / 747
271amnon high in rhizosphere glycine max soybean compared to soil in depth 0-20cm china 2018-01-09v4No1 / 750
206amnoncommon in air from israel particles <10um size (common air, dust, israel, size < 10um, clear day)2017-10-04v4No1 / 765
171amnon high in drought environment compared to control in soil united states of america state of california rhizosphere oryza sativa rice 2017-07-25v4No1 / 770
171amnoncommon soil, united states of america, state of california, rhizosphere, oryza sativa, rice2017-07-25v4No1 / 772
615amnoncommon endosphere, root, saccharum, sugarcane, campinas, brazil, greenhouse2020-04-27v4No1 / 776
615amnoncommon in control soil with no sugarcane (common campinas, brazil, greenhouse, soil)2020-04-27v4No1 / 780
478amnoncommon farm, litopenaeus vannamei, pacific white shrimp, intestine, china2019-02-19v4No1 / 795
478amnoncommon farm, shrimp farm, water, saline water, china2019-02-19v4No1 / 799
548amnoncommon in endopytic roots of Vellozia epidendroides (common minas gerais state, campos rupestres, brazil, vellozia epidendroides, plant, root)2019-08-15v4No1 / 800
480amnoncommon soil, pasture, farm, ireland2019-02-05v4No1 / 816
618amnoncommon late flowering stage, rhizosphere, canada, farm, cannabis sativa2020-05-04v4No1 / 819
422amnoncommon soil, paddy field soil, oryza sativa, yunnan province, china, cultivated environment2018-12-02v4No1 / 821
412amnoncommon soil, hunan province, red soil, cambisol, zea mays, triticum aestivum, ph<5, china2018-11-26v4No1 / 823
421amnoncommon in paddy field soil incubated without copper (common research facility, soil, paddy field soil, zhejiang province, china)2018-12-02v4No1 / 824
415amnoncommon rhizosphere, soil, citrus, orchard, china, cultivated environment2018-11-27v4No1 / 830
583amnoncommon soil, mountain, switzerland, depth 0-10cm, elevation 2000-3000m, canton of graubunden, calcareous parent material, ph 7-82020-01-28v3No1 / 830
444amnoncommon rhizosphere, fragaria x ananassa, strawberry, greenhouse soil, farm, yellow brown soil, nanjing city prefecture, continuous cropping, age 5 years, age 10 years, china, cultivated environment2019-01-07v4No1 / 833
356amnoncommon in deciduous broad leaved forest top soil in japan (common soil, depth 0-10cm, hokkaido, topsoil, ph 5.4, japan, forest ecosystem)2018-08-15v4No1 / 834
266amnoncommon in roots in JAM garden (common brassicaceae, boechera stricta, plant, united states of america, state of idaho, root)2017-12-19v4No1 / 843
412amnoncommon soil, hunan province, red soil, cambisol, zea mays, triticum aestivum, ph>5, china2018-11-26v4No1 / 856
618amnoncommon early flowering stage, rhizosphere, canada, farm, cannabis sativa2020-05-04v4No1 / 873
129amnoncommon mexico, myrtillocactus geometrizans, opuntia robusta, cactus, semi-arid, soil, ph>6, ph<6.52017-04-15v4No1 / 884
171amnoncommon in soil with rice growth irrigation protocol (common soil, united states of america, state of california, depth 5cm)2017-07-25v4No1 / 890
462amnon high in leaf compared to stem in united states of america state of tennessee populus tree cultivated environment 2019-01-13v4No1 / 890
146amnoncommon united states of america, solanum lycopersicum, tomato, slit loam soil, ph 6, rhizosphere2017-04-20v4No1 / 894
479amnoncommon rhizosphere, united states of america, state of california, ph 6-7, ceanothus jepsonii2019-02-05v4No1 / 900
462amnoncommon united states of america, state of tennessee, depth 30-75cm, silt clay loam, rhizosphere, populus, tree, cultivated environment2019-01-13v4No1 / 908
103amnoncommon river, united states of america, mississippi river, fresh water, aquatic biome, particle2017-04-05v4No1 / 909
103amnoncommon river, united states of america, mississippi river, fresh water, aquatic biome, free floating2017-04-05v4No1 / 909
609sheryoCommon in soil without tobacco plants with difenoconazole fungicide amended and without biochar (common difenoconazole, fungicide, ph 7-8, china, tobacco field, limestone, depth 0-20cm, soil)2020-04-21v4No1 / 910
609sheryoDominant in soil without tobacco plants with difenoconazole fungicide amended and with biochar (common difenoconazole, fungicide, ph 7-8, china, tobacco field, limestone, depth 0-20cm, soil, biochar)2020-04-21v4No1 / 910
609sheryoCommon in soil without tobacco plants with difenoconazole fungicide amended and without biochar (common difenoconazole, fungicide, ph 7-8, china, tobacco field, limestone, depth 0-20cm, soil)2020-04-21v4No1 / 915
548amnoncommon minas gerais state, campos rupestres, brazil, rock2019-08-17v4No1 / 924
126amnoncommon rhizosphere, germany, hordeum vulgare, winter barley2017-04-14v4No1 / 925
359amnoncommon soil, topsoil, depth 0-10cm, guangdong province, subtropical broadleaf forest biome, china, forest ecosystem, woodland area2018-08-19v4No1 / 935
462amnoncommon united states of america, state of tennessee, soil, depth 0-30cm, silt loam, cultivated environment2019-01-13v4No1 / 938
444amnoncommon in uncultivated soil plot (common yellow brown soil, nanjing city prefecture, soil, china)2019-01-07v4No1 / 946
37amnonlower in tomato plant leaves compared to plastic control ( high in control compared to solanum lycopersicum in maryland county leaf )2016-12-09v4No1 / 950
98amnoncommon citrus, rhizosphere, quincy, fl, root, state of florida2017-04-01v4No1 / 950
422amnoncommon soil, paddy field soil, jiangsu province, oryza sativa, china, cultivated environment2018-12-02v4No1 / 957
624sheryoCommon in ryegrass rhizosphere soil after 30-40 days (common days 30-40, rhizosphere, ryegrass, ph 7-8, 10 cm depth, soil, jiangsu province, china)2020-05-11v4No1 / 966
129amnoncommon mexico, myrtillocactus geometrizans, opuntia robusta, cactus, semi-arid, soil, ph>6, ph<6.5, root zone soil2017-04-15v4No1 / 968
480amnoncommon soil, pasture, farm, new zealand2019-02-05v4No1 / 970
134amnoncommon rhizosphere, tree, taxus, northeast china, temperate, taxus mairei, china2017-04-16v4No1 / 973
474amnoncommon soil, farm, glycine max, soybean, ph 4-6, brazil, cultivated environment2019-01-16v4No1 / 974
615amnoncommon saccharum, sugarcane, rhizosphere, campinas, brazil, greenhouse2020-04-27v4No1 / 974
266amnoncommon in soil from MIL garden (common soil, united states of america, state of idaho, ph 6.5)2017-12-18v4No1 / 980
462amnoncommon united states of america, state of tennessee, rhizosphere, populus, tree, depth 0-30cm, silt loam, cultivated environment2019-01-13v4No1 / 997
610sheryoCommon in agricultural field soil amended with straw (common straw, triticum aestivum, ph 7, wheat, kingdom of denmark, agricultural field, soil)2020-04-21v3No1 / 998
479amnoncommon rhizosphere, united states of america, state of california, heteromeles arbutifolia, ph 6-72019-02-05v4No1 / 1006
610sheryoCommon in agricultural field soil amended with low biochar (common low biochar, triticum aestivum, ph 7, wheat, kingdom of denmark, agricultural field, soil)2020-04-21v3No1 / 1009
624sheryocommon in ryegrass rhizosphere soil amended with biochar after 30-40 days (common china, jiangsu province, soil, 10 cm depth, ph 7-8, ryegrass, rhizosphere, days 30-40, biochar)2020-05-11v4No1 / 1017
628sheryocommon in bulk soil with barley plants after 180 days in treatments amended with biochar (common biochar, bulk soil, china, zhejiang province, quzhou county, soil, depth 15cm, ph 4-5, hordeum vulgare, days 180, mature barley plants)2020-05-18v4No1 / 1023
266amnoncommon in soil from PAR garden (common soil, united states of america, state of idaho, ph 5.5)2017-12-18v4No1 / 1032
548amnoncommon minas gerais state, campos rupestres, brazil, rhizosphere, vellozia epidendroides2019-08-15v4No1 / 1040
422amnoncommon soil, paddy field soil, oryza sativa, heilongjiang province, china, cultivated environment2018-12-02v4No1 / 1049
610sheryoCommon in agricultural field soil (common triticum aestivum, ph 7, wheat, kingdom of denmark, agricultural field, soil)2020-04-21v3No1 / 1053
263amnoncommon in desert soil irrigated daily in lab (common soil, israel, sandy loam soil, negev desert, ph 7-8, irrigated, research facility)2017-12-11v4No1 / 1076
610sheryoCommon in agricultural field soil amended with high biochar (common soil, agricultural field, kingdom of denmark, wheat, ph 7, high biochar, triticum aestivum)2020-04-21v3No1 / 1079
347amnon high in depth 20-30cm compared to depth 100-150cm depth 150-200cm in kingdom of norway svalbard archipelago permafrost soil 2018-07-15v4No1 / 1080
252amnoncommon in river rock biofilm (common kingdom of spain, biofilm, river, rock, epilithic)2017-11-22v4No1 / 1081
478amnoncommon farm, shrimp farm, sediment, china2019-02-19v4No1 / 1085
415amnoncommon rhizosphere, soil, citrus, orchard, brazil, cultivated environment2018-11-27v4No1 / 1091
415amnoncommon rhizosphere, soil, citrus, orchard, kingdom of spain, cultivated environment2018-11-27v4No1 / 1099
84amnoncommon soil, peatland, peat soil, sphagnum bog, temperate grassland biome, depth 5cm, wetland area2017-03-06v4No1 / 1103
414amnoncommon soil, heilongjiang province, agricultural feature, triticum aestivum, glycine max, zea mays, black soil, mollisol, npk fertilizer, ph<6, china2018-11-26v4No1 / 1105
101amnoncommon merlot, vitis vinifera, grapevine, new york, united states of america, root2017-04-03v4No1 / 1106
266amnoncommon in roots in MAH garden (common brassicaceae, boechera stricta, plant, united states of america, state of idaho, root)2017-12-19v4No1 / 1110
515amnon high in carabidae compared to staphylinidae in whole body beetle carnivorous beetle river poland 2019-04-19v4No1 / 1130
146amnon high in soil compared to rhizosphere in united states of america solanum lycopersicum tomato slit loam ph 6 2017-04-20v4No1 / 1135
628sheryocommon in bulk soil with barley plants after 180 days in treatments unamended with biochar (common bulk soil, china, zhejiang province, quzhou county, soil, depth 15cm, ph 4-5, hordeum vulgare, days 180, mature barley plants)2020-05-18v4No1 / 1136
134amnoncommon rhizosphere, tree, taxus, northeast china, temperate, taxus cuspidata, china2017-04-16v4No1 / 1141
146amnoncommon united states of america, solanum lycopersicum, tomato, soil, slit loam soil, ph 62017-04-20v4No1 / 1144
93amnoncommon in marine sediment near the shore in hawaii (common hawaii, shore, marine sediment)2017-03-12v4No1 / 1151
236amnoncommon ocean, state of california, pacific ocean, bodega bay, water, sea water2017-11-07v4No1 / 1156
422amnoncommon soil, paddy field soil, oryza sativa, heilongjiang province, ph 7-8, cultivated environment, china2018-12-04v4No1 / 1169
252amnoncommon in river sand biofilm (common river, biofilm, kingdom of spain, sand)2017-11-22v4No1 / 1181
615amnon high in rhizosphere compared to soil in saccharum sugarcane campinas brazil greenhouse 2020-04-27v4No1 / 1181
628sheryocommon in rhizosphere of barley roots after 180 days in treatments amended with biochar (common mature barley plants, days 180, rhizosphere, hordeum vulgare, biochar, ph 4-5, depth 15cm, china, quzhou county, zhejiang province, soil)2020-05-18v4No1 / 1192
421amnoncommon soil, paddy field soil, zhejiang province, china2018-12-04v4No1 / 1194
628sheryocommon in rhizosphere of barley roots after 180 days in treatments unamended with biochar (common china, zhejiang province, quzhou county, soil, depth 15cm, ph 4-5, hordeum vulgare, rhizosphere, days 180, mature barley plants)2020-05-18v4No1 / 1209
531amnoncommon rhizosphere, greenhouse soil, farm, orthic anthrosol, cucumis sativus, cucumber, china2019-07-21v3No1 / 1223
420amnoncommon in soil of vegetables in organic field (common soil, ph>7, ph 7-8, agricultural feature, farm, shanghai proper, clay loam, organic farming, cultivated environment, china)2018-12-02v4No1 / 1240
134amnoncommon rhizosphere, tree, taxus, taxus media, northeast china, temperate, china2017-04-16v4No1 / 1251
616amnoncommon in topsoil of non-fertilized sugarcane field (common ph 6.7, sugarcane, saccharum, soil, topsoil, depth 0-20cm, china, guangzhou city prefecture, non-fertilized soil)2020-04-27v3No1 / 1277
415amnoncommon rhizosphere, soil, citrus, orchard, italy, cultivated environment2018-11-27v4No1 / 1279
414amnoncommon soil, heilongjiang province, agricultural feature, triticum aestivum, glycine max, zea mays, black soil, mollisol, ph>6, china2018-11-26v4No1 / 1282
420amnoncommon in soil of vegetables in organic plastic tunnel (common soil, ph>7, ph 7-8, agricultural feature, farm, shanghai proper, clay loam, organic farming, greenhouse soil, china, cultivated environment)2018-12-02v4No1 / 1294
266amnonCommon in soil from MAH garden (common soil, united states of america, state of idaho, ph 6)2017-12-18v4No1 / 1299
309amnoncommon rhizosphere, germany, onobrychis viciifolia, common sainfoin2018-04-05v4No1 / 1323
600sheryoCommon in biochar ammended soil after 82 days (common soil, biochar, depth 0-5cm, united states of america, new york, coarse-loamy soil, ph 6, day 82)2020-03-27v4No1 / 1326
600sheryoCommon in stover ammended soil after 82 days (common soil, depth 0-5cm, united states of america, new york, coarse-loamy soil, ph 6, day 82, stover ammendment )2020-03-27v4No1 / 1327
259amnoncommon in soil and rhizpsphere of peanut plants (common soil, rhizosphere, ph 5, arachis hypogaea, peanut, china)2017-12-02v4No1 / 1334
98amnoncommon citrus, rhizosphere, ft. pierce, fl, root, state of florida2017-04-01v4No1 / 1340
98amnoncommon citrus, rhizosphere, gainesville, fl, root, state of florida2017-04-01v4No1 / 1371
420amnoncommon in soil of vegetable open field (common soil, ph>7, ph 7-8, agricultural feature, farm, shanghai proper, clay loam, npk fertilizer, cultivated environment, china)2018-12-02v4No1 / 1376
309amnoncommon rhizosphere, germany, plantago lanceolata, ribwort plantain2018-04-05v4No1 / 1386
266amnoncommon in soil from SIL garden (common soil, united states of america, state of idaho, ph 6)2017-12-18v4No1 / 1389
600sheryoCommon in unammended soil after 82 days (common soil, depth 0-5cm, united states of america, new york, coarse-loamy soil, ph 6, day 82)2020-03-27v4No1 / 1395
420amnonhigh freq. in soil of vegetable in plastic tunnel (common soil, ph>7, ph 7-8, agricultural feature, farm, shanghai proper, clay loam, npk fertilizer, greenhouse soil, cultivated environment, china)2018-12-02v4No1 / 1396
266amnoncoomon in roots in SIL garden (common brassicaceae, boechera stricta, plant, united states of america, state of idaho, root)2017-12-19v4No1 / 1399
422amnoncommon soil, paddy field soil, oryza sativa, hunan province, hubei province, china, cultivated environment2018-12-02v4No1 / 1399
76amnoncommon in non-seleniferous soil (common soil, rhizosphere, united states of america, non-seleniferous, state of florida)2017-02-28v4No1 / 1414
443amnonhigher in lower mississippi river (downstream) compared to upper mississippi river ( high in lower mississippi river downstream compared to upper mississippi river upstream in mississippi river water river fresh water depth 1m united states of america particle filtered 2.7um )2019-01-07v4No1 / 1418
40amnoncommon soil, field soil, nicotiana tabacum, rhizosphere, china2016-12-09v4No1 / 1420
462amnon high in rhizosphere compared to soil in united states of america state of tennessee populus tree cultivated environment 2019-01-12v4No1 / 1428
309amnoncommon rhizosphere, germany, geranium pratense, meadow geranium2018-04-05v4No1 / 1434
76amnoncommon in seleniferous soil (common soil, rhizosphere, united states of america, selenium, seleniferous, woodland area)2017-02-28v4No1 / 1438
444amnoncommon rhizosphere, fragaria x ananassa, strawberry, greenhouse soil, farm, yellow brown soil, nanjing city prefecture, age 1 year, china, cultivated environment2019-01-07v4No1 / 1439
271amnoncommon rhizosphere, glycine max, depth 0-20cm, soybean, china2018-01-09v4No1 / 1459
548amnoncommon in phosphorus impoverished soil (common soil, minas gerais state, campos rupestres, brazil, ph 3.5)2019-08-15v4No1 / 1483
309amnoncommon rhizosphere, germany, festuca rubra, red fescue grass2018-04-05v4No1 / 1510
145amnoncommon soil, rhizosphere, oryza sativa, rice, united states of america, ph 5.62017-04-19v4No1 / 1515
600sheryolower in stover ammendment soil ( high in unamended soil compared to stover amended in soil depth 0-5cm united states of america new york coarse-loamy soil ph 6 day 82 )2020-03-27v4No1 / 1612
76amnonhigher in non-seleniferous soil compared to seleniferous soil ( high in non-seleniferous compared to selenium seleniferous in soil united states of america rhizosphere woodland area )2017-02-28v4No1 / 1621
608sheryoCommon in wheat field in China, amended and unamended biochar, unamended with nitrogen fertilizer (common triticum aestivum l. cv., xiaoyan no. 22, china, silty clay, soil)2020-04-20v4No1 / 1643
462amnon high in depth 0-30cm silt loam compared to detph 30-75cm silt clay loam in soil united states of america state of tennessee cultivated environment 2019-01-12v4No1 / 1648
154amnon high in control compared to uranium high uranium in soil australia kakadu national park sediment 2017-06-29v4No1 / 1663
507amnonhigher in mine tailing contaminated sediment compared to uncontaminated control ( high in contaminated sediment compared to control in lake sediment sediment canada quesnel lake province of british columbia )2019-03-17v4No1 / 1681
608sheryoCommon in wheat field in China, amended and unamended biochar, amended with nitrogen fertilizer (common triticum aestivum l. cv., xiaoyan no. 22, china, silty clay, soil, urea enriched soil)2020-04-20v4No1 / 1682
616amnoncommon in topsoil of PK/NP/NPK/NK fertilized sugarcane field (common fertilized soil, ph 5.5-6, sugarcane, saccharum, soil, topsoil, depth 0-20cm, china, guangzhou city prefecture)2020-04-27v3No1 / 1710
155amnonhigher in tightly bound root soil compared to loose soil and bulk soil ( high in root compared to bulk soil in triticum aestivum wheat soil china )2017-07-02v4No1 / 1714
309amnoncommon rhizosphere, germany, veronica chamaedrys, germander speedwell2018-04-05v4No1 / 1788
353amnonlower in captive compared to wild caught Lissotriton vulgaris newts skin ( high in wild compared to research facility in newt adult skin cambridgeshire triturus cristatus united kingdom )2018-07-30v4No1 / 1834
156amnoncommon soil, rhizosphere, brassica, brassica oleracea, china2017-07-27v4No1 / 1885
296amnoncommon soil, north china plain, agricultural feature, wheat, winter, depth 0-20cm, ph>4, ph<5, china2018-02-11v4No1 / 1886
263amnonlower in heat stressed soil (65C) compared to control ( high in control compared to heat stressed soil in soil israel sandy loam soil negev desert ph 7-8 irrigated research facility )2017-12-11v4No1 / 1893
155amnoncommon in soil tightly bound to wheat root (common triticum aestivum, wheat, soil, root, china)2017-07-02v4No1 / 1977
101amnoncommon vitis vinifera, united states of america, merlot, grapevine, new york, rhizosphere2017-04-03v4No1 / 1980
101amnon high in root compared to rhizosphere in vitis vinifera united states of america merlot grapevine new york 2017-04-03v4No1 / 2075
175amnoncommon in heavy metal contaminated soils in china (common soil, heavy metal, ph 7-9, china)2017-07-29v4No1 / 2133
296amnoncommon soil, north china plain, agricultural feature, wheat, winter, depth 0-20cm, ph>7, ph<8, china2018-02-11v4No1 / 2160
353amnonlower in captive compared to wild caught Lissotriton vulgaris newts skin ( high in wild compared to research facility in newt adult skin cambridgeshire lissotriton vulgaris united kingdom )2018-07-30v4No1 / 2162
296amnoncommon soil, north china plain, agricultural feature, wheat, winter, depth 0-20cm, ph>6, ph<7, china2018-02-11v4No1 / 2223
166amnoncommon in river sediment (5cm) with mussels (common united states of america, river, sediment, freshwater biome, mississippi river, depth 5cm, upper mississippi river, mussel, unionidae)2017-07-18v4No1 / 2254
296amnoncommon in wheat field soil (common soil, north china plain, depth 5cm, agricultural feature, wheat, winter, china)2018-02-11v4No1 / 2341
155amnoncommon in soil loosely bound to wheat root (common triticum aestivum, wheat, soil, rhizosphere, china)2017-07-02v4No1 / 2425
101amnoncommon vitis vinifera, united states of america, merlot, grapevine, new york, soil2017-04-03v4No1 / 2537
155amnoncommon in bulk soil in wheat field (common triticum aestivum, wheat, soil, bulk soil, china)2017-07-02v4No1 / 2594
296amnoncommon soil, north china plain, agricultural feature, wheat, winter, depth 0-20cm, ph>8, china2018-02-11v4No1 / 2646
271amnoncommon depth 0-20cm, soil, china2018-01-09v4No1 / 2856
84amnoncommon soil, temperate grassland biome, fen, peat soil, flooded grassland biome, depth 20 cm, united kingdom2017-03-06v4No1 / 2866
166amnoncommon in river sediment (5cm) without mussels (common freshwater biome, river, united states of america, sediment, mississippi river, depth 5cm, upper mississippi river)2017-07-18v4No1 / 2877
618amnon high in rhizosphere compared to root endosphere root in canada farm cannabis sativa 2020-05-04v4No1 / 3134
422amnon high in ph 7-8 compared to ph 5-6 in soil paddy field soil oryza sativa heilongjiang province cultivated environment china 2018-12-04v4No1 / 3267
84amnoncommon soil, temperate grassland biome, fen, peat soil, flooded grassland biome, depth 5 cm, united kingdom2017-03-07v4No1 / 3434
296amnoncommon soil, north china plain, agricultural feature, wheat, winter, depth 0-20cm, ph>5, ph<6, china2018-02-11v4No1 / 3508
103amnonhigher in particle bound fraction compared to free floating bacteria in mississippi river ( high in particles compared to free floating in river united states of america mississippi river fresh water aquatic biome )2017-04-05v4No1 / 3559
266amnon high in root compared to leaf in brassicaceae boechera stricta plant united states of america state of idaho 2017-12-19v4No1 / 5886

Problems / suggestions? Please email info AT dbbact DOT org