Search result for sequence:
TACGAAGGGGGCTAGCGTTGCTCGGAATCACTGGGCGTAAAGGGTGCGTAGGCGGGTCTTTAAGTCAGGGGTGAAATCCTGGAGCTCAACTCCAGAACTGCCTTTGATACTGAAGATCTTGAGTTCGGGAGAGGTGAGTGGAACTGCGAG
common ontology terms
term enrichment score
TermScore
soil0.614176
china0.313364
rhizosphere0.250796
united states of america0.234392
agricultural field0.132726
root0.118277
cultivated environment0.108486
germany0.102079
triticum aestivum0.093645
water0.091549
depth 0-10cm0.090281
skin0.089957
depth 0-20cm0.082630
silt loam0.080537
farm0.078933
zea mays0.072483
brazil0.066535
citrus0.064430
glycine max0.062062
topsoil0.061870
homo sapiens0.059414
state of california0.057428
pot expreiment0.056988
loess plateau0.054127
state of florida0.053316
fresh water0.052933
ph 60.051927
river0.051748
shaanxi province0.050870
leaf0.050584
ph 7-80.049344
bulk soil0.049315
research facility0.049239
wheat0.049113
drinking water0.048322
kalamazoo loam0.048322
mesic type hapludalf0.048322
kellogg biological station0.048322
oryza sativa0.046650
mexico0.044242
desert0.043758
state of michigan0.041332
state of illinois0.040872
grazing exclusion0.040595
haplic calcisol0.040595
calci-orthic aridisol0.040595
ningxia province0.040595
yunwushan national natural grassland protection zone0.040595
state of new york0.040188
united kingdom0.039788
kingdom of denmark0.039012
canada0.038860
adult0.038473
forest ecosystem0.038137
ultisol0.037992
alabama0.037992
united states0.037992
des moines0.037992
nicollet soil series0.037992
reforestation0.037992
robinia pseudoacacia0.037992
auburn0.037284
iowa0.037284
agricultural feature0.035796
orchard0.035690
state of rhode island0.035374
minas gerais state0.035374
campos rupestres0.035374
dekalb county0.035374
illinois0.035374
lettuce0.035374
tree0.035064
paddy field soil0.033012
ph 70.032922
agave0.032742
woodland area0.032564
foodon product type0.032476
state of tennessee0.032476
intestine0.032215
sediment0.032021
canis lupus familiaris0.030496
ph 7.60.030462
depth 0-30cm0.030401
saccharum0.030324
sugarcane0.030324
ph 6-70.030209
greenhouse0.030096
thyrow0.030096
jiangsu province0.030096
state of idaho0.029650
switzerland0.029216
israel0.029110
biochar0.027688
root endosphere0.027688
sandy loam soil0.027624
haplic luvisol0.027624
clay loam0.027624
guanajuato0.027435
southern united states0.027435
songnen plain0.027435
Fraction of dbbact annotations with this term covered by the query
TermScore
triticum aestivum0.909091
ph 7-80.875000
cultivated environment0.875000
root0.866667
agricultural field0.857143
bulk soil0.857143
oryza sativa0.857143
soil0.849462
ph 60.833333
silt loam0.833333
ph 7.60.833333
rhizosphere0.818182
depth 5cm0.800000
depth 0-10cm0.769231
biochar0.750000
root endosphere0.750000
depth 0-20cm0.750000
depth 0-30cm0.750000
wheat0.750000
maize field0.750000
pot expreiment0.750000
zea mays0.750000
river0.750000
agricultural feature0.750000
rice0.750000
leaf surface0.750000
depth (soil) 20-30cm0.750000
greenhouse soil0.750000
conventional tillage0.750000
mississippi river0.750000
npk fertilizer0.750000
glycine max0.714286
hunan province0.714286
forested area0.666667
root nodule0.666667
mountain0.666667
ph 4-60.666667
topsoil0.666667
depth 10-20cm0.666667
pasture0.666667
saccharum0.666667
sugarcane0.666667
ph 6.70.666667
park0.666667
citrus0.666667
sandy loam soil0.666667
soybean0.666667
mollisol0.666667
depth 10-25cm0.666667
orchard0.666667
plant litter0.666667
yunnan province0.666667
npk fertilization0.666667
manure fertilization0.666667
skin of cheek0.666667
hen0.666667
building0.666667
stream0.666667
ice0.666667
heilongjiang province0.666667
black soil0.666667
stem endosphere0.666667
venezuela0.666667
amerindian0.666667
loam soil0.666667
ph 7.850.666667
paddy field soil0.666667
haplic luvisol0.666667
fusarium oxysporum0.666667
LOWER IN depth 20-40cm0.666667
clay loam0.666667
LOWER IN stem0.666667
fen0.666667
heavy metal0.666667
loess plateau0.666667
subtropical0.666667
ph 7.70.666667
depth 15-30cm0.666667
ph 5.60.666667
ph 6.90.666667
depth 25-50cm0.666667
ph 7.90.666667
bio-organic fertilizer0.666667
trichoderma guizhouense njau 47420.666667
ph 7.50.666667
depth (soil) 30-60cm0.666667
cambisol0.666667
depth 0-15cm0.666667
particles0.666667
hordeum vulgare0.666667
ph 5.5-60.666667
ph 5.90.666667
unamended soil0.666667
state of illinois0.600000
ph 6.50.600000
ph 70.600000
ph 50.600000
ph 5-60.600000
mongolia0.600000
depth 10 cm0.600000
Fraction of annotations for the query sequences containing the term
TermScore
soil0.480959
united states of america0.270804
china0.270804
rhizosphere0.148096
agricultural field0.071932
root0.063470
cultivated environment0.057828
germany0.057828
water0.055007
homo sapiens0.052186
skin0.050776
triticum aestivum0.049365
depth 0-10cm0.047955
farm0.045134
depth 0-20cm0.043724
silt loam0.042313
brazil0.038082
zea mays0.038082
citrus0.033850
research facility0.033850
glycine max0.032440
topsoil0.032440
state of california0.032440
state of florida0.029619
pot expreiment0.029619
adult0.029619
fresh water0.028209
loess plateau0.028209
ph 60.026798
river0.026798
leaf0.026798
shaanxi province0.026798
ph 7-80.025388
wheat0.025388
bulk soil0.025388
drinking water0.025388
state of michigan0.025388
kalamazoo loam0.025388
mesic type hapludalf0.025388
kellogg biological station0.025388
mexico0.023977
desert0.023977
oryza sativa0.023977
state of new york0.021157
grazing exclusion0.021157
haplic calcisol0.021157
calci-orthic aridisol0.021157
ningxia province0.021157
yunwushan national natural grassland protection zone0.021157
united kingdom0.021157
state of illinois0.021157
kingdom of denmark0.021157
canada0.021157
forest ecosystem0.019746
ultisol0.019746
auburn0.019746
alabama0.019746
iowa0.019746
united states0.019746
des moines0.019746
nicollet soil series0.019746
reforestation0.019746
robinia pseudoacacia0.019746
state of rhode island0.018336
minas gerais state0.018336
campos rupestres0.018336
tree0.018336
dekalb county0.018336
illinois0.018336
orchard0.018336
lettuce0.018336
agricultural feature0.018336
foodon product type0.016925
woodland area0.016925
canis lupus familiaris0.016925
state of tennessee0.016925
control0.016925
ph 70.016925
intestine0.016925
agave0.016925
female0.016925
sediment0.016925
paddy field soil0.016925
switzerland0.015515
greenhouse0.015515
saccharum0.015515
sugarcane0.015515
ph 6-70.015515
depth 0-30cm0.015515
state of idaho0.015515
feces0.015515
thyrow0.015515
israel0.015515
jiangsu province0.015515
ph 7.60.015515
biochar0.014104
root endosphere0.014104
sandy loam soil0.014104
guanajuato0.014104
snake0.014104
Exp. ID User ID Description Date Region Flag Sequences
101amnondominant united states of america, vitis vinifera, state of new york, merlot, grapevine, root2017-04-03v4No1 / 1
813amnondominant united states of america, soil, state of washington, forested area, olympic national park, temperate rainforest2021-06-22v4No1 / 1
747amnonanti-correlated in soy bean root nodules (other united states of america, farm, glycine max, root nodule, state of missouri, soy bean)2021-03-10v4No1 / 2
824sheryoDominant in soil after 27-35 years of grazing exclusion at 0-10cm depth, Ningxia china (dominant soil, depth 0-10cm, china, grazing exclusion, 27-35 years of grazing exclusion, haplic calcisol, calci-orthic aridisol, ningxia province, yunwushan national natural grassland protection zone)2021-08-08v4No1 / 2
583amnondominant mountain, soil, switzerland, depth 0-10cm, ph 4-6, elevation 2000-3000m, siliceous parent material, rhone river valley2020-01-27v3No1 / 2
583amnondominant mountain, soil, switzerland, depth 0-10cm, canton of graubunden, elevation 2000-3000m, siliceous parent material, ph 4.5-72020-01-28v3No1 / 2
583amnondominant mountain, soil, switzerland, depth 0-10cm, ph 7-8, canton of graubunden, elevation 2000-3000m, calcareous parent material2020-01-28v3No1 / 2
311amnondominant united states of america, state of rhode island, radish, foodon product type2018-04-09v4No1 / 3
356amnonhigh freq. in deciduous broad leaved forest top soil in japan (dominant soil, topsoil, hokkaido, depth 0-10cm, ph 5.4, forest ecosystem, japan)2018-08-15v4No1 / 3
600sheryoDominant in biochar ammended soil after 82 days (dominant united states of america, soil, state of new york, depth 0-5cm, ph 6, biochar, coarse-loamy soil, day 82)2020-03-27v4No1 / 3
824sheryoDomionant in soil after 0-9 years of grazing exclusion at 0-10cm depth, Ningxia china (dominant soil, depth 0-10cm, china, grazing exclusion, haplic calcisol, calci-orthic aridisol, ningxia province, yunwushan national natural grassland protection zone, 0-9 years of grazing exclusion)2021-08-08v4No1 / 3
600sheryoDominant in stover ammended soil after 82 days (dominant united states of america, soil, state of new york, depth 0-5cm, ph 6, coarse-loamy soil, day 82, stover ammendment )2020-03-27v4No1 / 4
747amnondominant in soy bean root nodules (dominant united states of america, farm, glycine max, root nodule, state of missouri, soy bean)2021-03-10v4No1 / 4
824sheryoDominant in soil after 27-35 years of grazing exclusion at 10-20cm depth, Ningxia china (dominant soil, china, grazing exclusion, 27-35 years of grazing exclusion, haplic calcisol, calci-orthic aridisol, ningxia province, yunwushan national natural grassland protection zone, depth 10-20cm)2021-08-08v4No1 / 4
357amnondominant soil, topsoil, depth 0-10cm, montane forest, woodland area, forest ecosystem2018-08-19v4No1 / 5
548amnondominant rhizosphere, brazil, minas gerais state, campos rupestres, barbacenia macrantha2019-08-17v4No1 / 5
824sheryoDominant in soil after 0-9 years of grazing exclusion at 10-20cm depth, Ningxia china (dominant soil, china, grazing exclusion, haplic calcisol, calci-orthic aridisol, ningxia province, yunwushan national natural grassland protection zone, 0-9 years of grazing exclusion, depth 10-20cm)2021-08-08v4No1 / 5
146amnondominant united states of america, soil, solanum lycopersicum, tomato, slit loam soil, ph 62017-04-20v4No1 / 6
231amnonhigh freq. in dog urine (dominant united states of america, urine, canis lupus familiaris, dog)2017-11-02v4No1 / 6
462amnondominant united states of america, state of tennessee, rhizosphere, populus, tree, silt clay loam, depth 30-75cm, cultivated environment2019-01-13v4No1 / 6
480amnondominant farm, pasture, soil, new zealand2019-02-05v4No1 / 6
548amnondominant brazil, minas gerais state, root endosphere, campos rupestres, barbacenia macrantha, root2019-08-17v4No1 / 6
615amnondominant brazil, endosphere, greenhouse, root, campinas, saccharum, sugarcane2020-04-27v4No1 / 6
788amnondominant united states of america, soil, state of georgia, mesocosm2021-05-31v4No1 / 6
616amnondominant in topsoil of non-fertilized sugarcane field (dominant china, soil, topsoil, guangzhou city prefecture, non-fertilized soil, depth 0-20cm, saccharum, sugarcane, ph 6.7)2020-04-27v3No1 / 6
698amnondominant control, park, rhizosphere, ph 6-7, depth 0-30cm, united kingdom, quercus, oak2028-04-01v3No1 / 6
98amnondominant rhizosphere, state of florida, citrus, pierce, fl, root2017-04-01v4No1 / 7
747amnoncommon in soy bean root nodules (common united states of america, farm, glycine max, root nodule, state of missouri, soy bean)2021-03-10v4No1 / 7
824sheryoDominant in soil after 27-35 years of grazing exclusion at 20-40cm depth, Ningxia china (dominant soil, china, grazing exclusion, 27-35 years of grazing exclusion, haplic calcisol, calci-orthic aridisol, ningxia province, yunwushan national natural grassland protection zone, depth 20-40cm)2021-08-08v4No1 / 7
829sheryoDominant in soil depth of 0-12m in Alfisol soil, Dekalb, Illinois, united states of america (dominant united states of america, soil, state of illinois, sandy loam soil, dekalb county, illinois, depth 0-12cm, alfisol, hapludalf, sandy loam)2021-08-26v3No1 / 7
98amnondominant rhizosphere, state of florida, citrus, quincy, fl, root2017-04-01v4No1 / 8
266amnonhigh freq. in soil from MIL garden (dominant united states of america, soil, state of idaho, ph 6.5)2017-12-18v4No1 / 8
266amnonhigh freq. in soil from SIL garden (dominant united states of america, soil, state of idaho, ph 6)2017-12-18v4No1 / 8
399amnonhigher in ampicillin treated mice compared to controls ( high in antibiotic ampicillin compared to control in feces united states of america research facility mus musculus mouse )2018-11-18v4No1 / 8
474amnondominant farm, soil, glycine max, brazil, soybean, ph 4-6, cultivated environment2019-01-16v4No1 / 8
480amnondominant farm, pasture, soil, ireland2019-02-05v4No1 / 8
667amnondominant soil, topsoil, jiangxi province, ph 4.5, depth 0-20cm, forested area, china, lushan mountain, elevation 800-900m2020-09-25v4No1 / 8
610sheryoDominant in agricultural field soil (dominant soil, triticum aestivum, kingdom of denmark, wheat, ph 7, agricultural field)2020-04-21v3No1 / 8
761sheryoDominant in bulk sandy soil maize field in Germany (dominant bulk soil, germany, ph 5, maize field, lower saxony, sandy soil)2021-04-06v3No1 / 8
829sheryoDominanmt in soil depth of 108-140cm in Alfisol soil, Dekalb, Illinois, united states of america (dominant united states of america, soil, state of illinois, sandy loam soil, dekalb county, illinois, alfisol, hapludalf, sandy loam, depth 108-140cm)2021-08-26v3No1 / 8
98amnondominant rhizosphere, state of florida, citrus, immokalee, fl, root2017-04-01v4No1 / 9
98amnondominant rhizosphere, state of florida, citrus, gainesville, fl, root2017-04-01v4No1 / 9
129amnondominant soil, mexico, myrtillocactus geometrizans, opuntia robusta, cactus, semi-arid, root zone soil, ph 6-6.52017-04-15v4No1 / 9
245amnondominant homo sapiens, breast milk, china2017-11-21v4No1 / 9
271amnondominant rhizosphere, glycine max, soybean, depth 0-20cm, china2018-01-09v4No1 / 9
462amnondominant united states of america, state of tennessee, populus, tree, cultivated environment, root2019-01-13v4No1 / 9
610sheryoDominant in agricultural field soil amended with low biochar (dominant soil, triticum aestivum, kingdom of denmark, wheat, ph 7, agricultural field, high biochar, low biochar)2020-04-21v3No1 / 9
698amnondominant park, rhizosphere, disease, ph 5-6, depth 0-30cm, united kingdom, quercus, oak, acute oak decline, plant disease2028-04-01v3No1 / 9
823sheryoDominant at 0-10cm depth in ultisol soil in auburn, alabama (dominant soil, depth 0-10cm, agricultural field, ultisol, upland soil, auburn, alabama)2021-08-07v3No1 / 9
152amnonhigh in blanks compares to dust/nose samples (contamination)2017-05-04v4No1 / 10
610sheryoDominant in agricultural field soil amended with high biochar (dominant soil, triticum aestivum, kingdom of denmark, wheat, ph 7, agricultural field, high biochar)2020-04-21v3No1 / 10
610sheryoDominant in agricultural field soil amended with straw (dominant soil, triticum aestivum, kingdom of denmark, wheat, ph 7, agricultural field, straw, high biochar)2020-04-21v3No1 / 10
829sheryoDominant in soil depth of 0-27cm in Mollisol soil, Dekalb, Illinois, united states of america (dominant united states of america, soil, state of illinois, mollisol, silt loam, dekalb county, illinois, depth 0-27cm)2021-08-26v3No1 / 10
829sheryoDominant in soil depth of 116-140cm in Mollisol soil, Dekalb, Illinois, united states of america (dominant united states of america, soil, state of illinois, mollisol, silt loam, dekalb county, illinois, depth 116-140cm)2021-08-26v3No1 / 10
279amnondominant grassland, steppe, soil, mongolia, china2018-01-24v4No1 / 11
311amnondominant united states of america, state of rhode island, fish sauce, foodon product type2018-04-09v4No1 / 11
548amnonhigh freq. in endopytic roots of Vellozia epidendroides (dominant brazil, minas gerais state, plant, campos rupestres, vellozia epidendroides, root)2019-08-15v4No1 / 11
823sheryoDominant at 10-25cm depth in ultisol soil in auburn, alabama (dominant soil, agricultural field, ultisol, upland soil, auburn, alabama, depth 10-25cm)2021-08-07v3No1 / 11
134amnondominant rhizosphere, temperate, tree, taxus, taxus mairei, northeast china, china2017-04-16v4No1 / 12
231amnonhigh freq. in dog genitalia (dominant united states of america, reproductive system, reproductive organ, canis lupus familiaris, dog, genitalia)2017-11-02v4No1 / 12
266amnonhigh freq. in roots in JAM garden (dominant united states of america, state of idaho, plant, brassicaceae, boechera stricta, root)2017-12-19v4No1 / 12
397amnondominant digestive system, intestine, panama, fungus growing ant, cyphomyrmex longiscapus2018-11-14v4No1 / 12
798amnondominant orchard, hay, italy, depth 10 cm, plant litter, apennine mountains, prunus armeniaca, apricot, litter bag2021-06-13v3No1 / 12
98amnondominant rhizosphere, state of florida, citrus, vero beach, fl, root2017-04-01v4No1 / 13
245amnoncommon homo sapiens, breast milk, kingdom of spain2017-11-21v4No1 / 13
360amnondominant desert, mexico, guanajuato, agave, root endosphere, agave salmiana, root2018-08-21v4No1 / 13
788amnondominant feces, united states of america, state of georgia, mesocosm, cherokia georgiana georgiana, millipede2021-05-31v4No1 / 13
752sheryoDominant in soil planted with Panax notoginseng (dominant soil, yunnan province, ph 6, china, panax notoginseng, pot expreiment, xundian county, sanqi plants)2021-03-11v3No1 / 13
761sheryoDominant in maize rhizosphere sandy soil maize field in Germany (dominant rhizosphere, zea mays, germany, ph 5, maize field, lower saxony, sandy soil)2021-04-06v3No1 / 13
311amnondominant united states of america, state of rhode island, scallion, foodon product type2018-04-09v4No1 / 14
654amnoncommon fermented beverage, turkey, adana province, kombucha2020-09-13v3No1 / 14
69amnondominant united states of america, research facility, bronchoalveolar lavage, canis lupus familiaris, beagle dog2017-02-21v4No1 / 15
245amnoncommon homo sapiens, breast milk, china2017-11-21v4No1 / 15
291amnondominant nasal cavity, pair of nares, canis lupus familiaris, germany, dog2018-02-01v4No1 / 15
341amnonlower in fresh drinking water compared to week old water ( high in stagnant water compared to fresh water in united states of america water drinking water tap water state of illinois )2018-05-28v4No1 / 15
397amnoncommon digestive system, intestine, panama, fungus growing ant, cyphomyrmex longiscapus2018-11-14v4No1 / 15
762sheryoDominant in bulk soil of a pot experiment with lettuce planted in npk fertilized albic luvisol from Germany (dominant soil, bulk soil, germany, thyrow, pot expreiment, npk fertilization, albic luvisol, ph 6.4, lettuce, mineral fertilization)2021-04-07v3No1 / 15
762sheryoDominant in bulk soil of a pot experiment with lettuce planted in organic fertilized albic luvisol from Germany (dominant soil, manured soil, bulk soil, germany, thyrow, pot expreiment, manure fertilization, albic luvisol, ph 6.4, lettuce, organic fertilization)2021-04-07v3No1 / 15
607amnondominant homo sapiens, nasopharynx, germany, parkinson's disease, nasal wash2020-04-19v4No1 / 16
526amnonhigh freq. in bile of healthy controls (dominant homo sapiens, control, bile, gallbladder, adult, kingdom of spain)2019-07-14v3No1 / 16
621amnondominant body proper, australia, whole body, tick, ixodes antechini2020-05-07v1No1 / 16
68amnonfound in some aphid samples (prevalence <=0.1) (other cinara)2017-02-20v4No1 / 17
109amnondominant united states of america, water, drinking water, site a2017-04-08v4No1 / 17
360amnondominant desert, mexico, guanajuato, agave, agave tequiliana, root endosphere, cultivated environment, root2018-08-21v4No1 / 17
607amnoncommon homo sapiens, control, nasopharynx, germany, nasal wash2020-04-19v4No1 / 17
607amnondominant homo sapiens, control, nasopharynx, germany, nasal wash2020-04-19v4No1 / 17
526amnon high in control compared to cholelithiasis in homo sapiens bile gallbladder adult kingdom of spain 2019-07-14v3No1 / 17
698amnondominant park, rhizosphere, depth 0-30cm, united kingdom, london, quercus, ph 4-4.5, oak2028-04-01v3No1 / 17
196amnondominant united states of america, water, drinking water2017-09-12v4No1 / 18
245amnoncommon homo sapiens, breast milk, finland2017-11-21v4No1 / 18
607amnondominant homo sapiens, nasopharynx, germany, rem sleep behavior disorder, nasal wash2020-04-19v4No1 / 18
115amnoncommon freshwater river biome, intestine, yangtze river, coreius guichenoti, largemouth bronze gudgeon, fish, china2017-04-10v4No1 / 19
245amnoncommon homo sapiens, breast milk, south africa2017-11-21v4No1 / 19
285amnoncommon in effluent from middle ear (common homo sapiens, united states of america, middle ear, acute transudative otitis media, child, state of washington, obsolete_juvenile stage)2018-01-27v4No1 / 19
607amnoncommon homo sapiens, nasopharynx, germany, parkinson's disease, nasal wash2020-04-19v4No1 / 19
271amnoncommon root structure, glycine max, soybean, depth 0-20cm, root, root nodule, china2018-01-09v4No1 / 20
539amnondominant ethiopia, early timepoint, ensete ventricosum, ethiopian banana, days 1-15, aerobic fermentation, food (fermented)2019-07-31v4No1 / 20
109amnondominant united states of america, water, drinking water, site e2017-04-08v4No1 / 21
762sheryoDominant in rhizosphere soil of a pot experiment with lettuce planted in organic fertilized albic luvisol Germany (dominant soil, manured soil, rhizosphere, germany, thyrow, pot expreiment, manure fertilization, npk fertilization, albic luvisol, lettuce, mineral fertilization, organic fertilization)2021-04-08v3No1 / 21
311amnoncommon united states of america, state of rhode island, food (fermented), miso food product2018-04-09v4No1 / 22
109amnondominant united states of america, water, drinking water, site b2017-04-08v4No1 / 23
348amnonsuspected contaminant (found in H2O samples) (contamination)2018-07-16v4No1 / 25
607amnoncommon homo sapiens, nasopharynx, germany, rem sleep behavior disorder, nasal wash2020-04-19v4No1 / 25
311amnoncommon united states of america, allium cepa, state of rhode island, onion, foodon product type2018-04-09v4No1 / 26
536amnoncommon united states of america, skin, snake, southern united states, diadophis punctatus, ringneck snake, fossorial snake2019-07-28v4No1 / 26
674amnoncommon female, body proper, whole body, panama, coquillettidia, mosquito, coquilettidia venezuelensis2020-09-28v4No1 / 26
674amnoncommon female, body proper, panama, whole body, lutzomyia gomezi, sand fly2020-09-28v4No1 / 27
129amnonfound INSIDE roots of cactus (common mexico, myrtillocactus geometrizans, opuntia robusta, cactus, semi-arid, root interior, root)2017-04-15v4No1 / 29
109amnon high in water treatment plant compared to distribution system in united states of america water drinking water site b 2017-04-08v4No1 / 30
109amnoncommon united states of america, water, drinking water, site b2017-04-08v4No1 / 31
674amnoncommon female, body proper, whole body, panama, culex coronator, mosquito2020-09-28v4No1 / 31
806amnon high in pair of nares external naris compared to oral cavity oral wash in homo sapiens united states of america adult state of new york 2021-06-19v3No1 / 32
311amnoncommon united states of america, state of rhode island, garlic, foodon product type2018-04-09v4No1 / 34
674amnoncommon female, body proper, panama, whole body, psychodopygus panamensis, sand fly2020-09-28v4No1 / 34
536amnoncommon united states of america, skin, snake, southern united states, fossorial snake, carphophis amoenus, worm snake2019-07-28v4No1 / 35
539amnoncommon ethiopia, early timepoint, ensete ventricosum, ethiopian banana, days 1-15, aerobic fermentation, food (fermented)2019-07-31v4No1 / 35
311amnoncommon united states of america, state of rhode island, radish, foodon product type2018-04-09v4No1 / 36
367amnoncommon coast, air, namibia2018-09-02v4No1 / 36
674amnoncommon female, body proper, whole body, panama, culex declarator, mosquito2020-09-28v4No1 / 36
749amnoncommon homo sapiens, female, skin, adult, seoul, skin of cheek, south korea, third decade human stage2021-03-10v4No1 / 36
749amnoncommon homo sapiens, female, skin, adult, seoul, skin of forehead, south korea, third decade human stage2021-03-10v4No1 / 36
93amnon high in shell gland compared to egg jelly shelled egg in hawaii bobtail squid euprymna scolopes 2017-03-12v4No1 / 38
526amnoncommon in bile of healthy controls (common homo sapiens, control, bile, gallbladder, adult, kingdom of spain)2019-07-14v3No1 / 39
782amnoncommon fish farm, gill, portuguese republic, sparus aurata, ria formosa, open water pond, seabream2021-05-07v4No1 / 40
614amnondecreases in picher plant fluid grown in lab ( high in early time points wild days 0-3 compared to research facility late time points days 57-60 in united states of america commonwealth of massachusetts plant fluid harvard forest sarracenia purpurea pitcher plant pitcher fluid )2020-04-26v4No1 / 42
231amnoncommon in dog genitalia (common united states of america, reproductive system, reproductive organ, canis lupus familiaris, dog, genitalia)2017-11-02v4No1 / 43
69amnoncommon united states of america, research facility, bronchoalveolar lavage, canis lupus familiaris, beagle dog2017-02-21v4No1 / 44
113amnoncommon united states of america, research facility, larval stage, intestine, danio rerio, zebra fish2017-04-10v4No1 / 45
818amnoncommon research facility, ileum, gallus gallus, digesta, chicken, intestinal contents, female organism, china, hen, age 60 weeks2021-07-10v3No1 / 45
258amnonhigher lungs of hiv pneumonia patients not treated with ceftriaxone ( high in no ceftriaxone compared to ceftriaxone in homo sapiens lung bronchoalveolar lavage hiv infection bronchial epithelium uganda pneumonia )2017-11-27v4No1 / 47
287amnoncommon mountain, snow field, depth 6-7m, japan2018-01-29v4No1 / 47
109amnon high in water treatment plant compared to distribution system in united states of america water drinking water site a 2017-04-08v4No1 / 48
256amnonlower in intestinal contents compared to mucosal scraping in pig caecum ( high in mucosa compared to intestinal contents in caecum sus scrofa pig united kingdom )2017-11-26v4No1 / 50
462amnoncommon united states of america, state of tennessee, populus, tree, cultivated environment, root2019-01-13v4No1 / 51
360amnoncommon desert, state of california, agave, agave deserti, root endosphere, root2018-08-21v4No1 / 52
782amnoncommon fish farm, skin, portuguese republic, sparus aurata, ria formosa, open water pond, seabream2021-05-07v4No1 / 52
109amnoncommon united states of america, water, drinking water, site a2017-04-08v4No1 / 54
437amnoncommon united states of america, research facility, intestine, juvenile organism, danio rerio, state of oregon, zebra fish, fish, age 21 days2018-12-26v4No1 / 54
354amnon high in bronchus bronchial epithelium bronchial brush compared to sputum induced sputum in homo sapiens united states of america adult 2018-07-30v4No1 / 55
492amnoncommon skin, adult, chile, frog, eupsophus vertebralis2019-02-27v4No1 / 55
431amnoncommon in midgut of hibernating bumble bees (common research facility, midgut, belgium, bombus terrestris, bumble bee, queen, hibernation)2018-12-16v4No1 / 57
281amnoncommon cloaca, shinisaurus crocodilurus, crocodile lizard, china2018-01-25v4No1 / 59
523amnonhigher in houses with dogs ( high in canis lupus familiaris dog compared to no dog in united states of america building air state of illinois chicago bedroom )2019-07-03v4No1 / 59
149amnoncommon stream, larval stage, intestine, amphibian larval stage, germany, salamandra salamandra, fire salamander2017-04-24v4No1 / 60
374amnoncommon skin, costa rica, frog, amphibia, oophaga pumilio, strawberry poison frog2018-09-09v4No1 / 61
819amnoncommon homo sapiens, female, skin, adult, skin of cheek, china, dalian city prefecture, age 25-45 years2021-07-12v1No1 / 61
196amnonhigher in biofilms in water at 60C compared to 40C ( high in temp 60c high temperature environment compared to control temp 40c in united states of america water biofilm drinking water )2017-09-12v4No1 / 62
360amnoncommon desert, mexico, guanajuato, agave, agave tequiliana, root endosphere, cultivated environment, root2018-08-21v4No1 / 62
549amnoncommon puerto rico, isla palominos, coral, acropora cervicornis2019-08-17v4No1 / 62
311amnoncommon united states of america, state of rhode island, red pepper, foodon product type2018-04-09v4No1 / 63
536amnoncommon united states of america, skin, snake, southern united states, coluber constrictor, eastern racer snake2019-07-28v4No1 / 64
558amnon high in duodenum compared to caecum in united states of america state of wyoming bird centrocercus urophasianus greater sage-grouse 2019-09-20v4No1 / 64
769sheryoHigh in no tillage compared to conventional tillage in wheat field in northern israel ( high in no tillage compared to conventional tillage in soil bulk soil triticum aestivum israel vertisol northen israel )2021-04-18v4No1 / 65
109amnoncommon united states of america, water, drinking water, site d2017-04-08v4No1 / 67
311amnoncommon united states of america, state of rhode island, fish sauce, foodon product type2018-04-09v4No1 / 68
231amnoncommon in dog urine (common united states of america, urine, canis lupus familiaris, dog)2017-11-02v4No1 / 69
417amnoncommon feces, anser cygnoides, winter, bird, swan goose, china2018-12-01v4No1 / 70
763amnonhigher in blank compared to samples (contamination)2021-04-10v3No1 / 70
653amnon high in tongue dermal layer of tongue compared to saliva in homo sapiens adult toronto canada third decade human stage 2020-09-13v3No1 / 72
69amnoncommon united states of america, research facility, mucus, nasal cavity, canis lupus familiaris, beagle dog2017-02-21v4No1 / 77
431amnonhigher in midgut of hibernating bumble bees compared to non-hibernating ( high in hibernation compared to non hibernating in research facility midgut belgium bombus terrestris bumble bee queen )2018-12-16v4No1 / 77
819amnoncommon homo sapiens, female, skin, adult, skin of cheek, china, baoding city prefecture, age 25-45 years2021-07-12v1No1 / 77
109amnoncommon united states of america, water, drinking water, site e2017-04-08v4No1 / 80
534amnoncommon river, tributary, water, fresh water, nepal, free floating, depth 10 cm, filtered 0.2um, koshi river2019-07-22v4No1 / 80
109amnon high in distribution system compared to water treatment plant in united states of america water drinking water site c 2017-04-08v4No1 / 81
426amnoncommon tundra, permafrost, soil, russia, nenets autonomous okrug2018-12-08v4No1 / 81
231amnoncommon in dog rectum (common feces, united states of america, rectum, canis lupus familiaris, dog)2017-11-02v4No1 / 84
227amnonhiger in first 24hrs compared to later timepoints in baby nasopharynx ( high in age age <=24 hours compared to age >= 7 days in homo sapiens nasal cavity nasopharynx infant kingdom of the netherlands )2017-10-30v4No1 / 85
311amnoncommon in salted cabbage (common united states of america, state of rhode island, cabbage, foodon product type)2018-04-09v4No1 / 85
804amnon high in iga negative fraction compared to iga positive fraction in feces homo sapiens child africa central african republic madagascar age 2-5 years 2021-06-18v4No1 / 85
109amnoncommon united states of america, water, drinking water, site c2017-04-08v4No1 / 86
360amnoncommon desert, mexico, guanajuato, agave, root endosphere, agave salmiana, root2018-08-21v4No1 / 87
402amnoncommon mine tailing, sediment, soil, guangxi zhuang autonomous region, alkaline mine tailing, zone 1, china2018-11-18v4No1 / 87
199amnonhigher in bathroom shower compared to kitchen sink ( high in bathroom shower tile building wall compared to kitchen sink in united states of america building urban biome )2017-10-01v4No1 / 91
354amnon high in bronchus bronchial epithelium bronchial brush compared to saliva oral wash in homo sapiens united states of america adult 2018-07-30v4No1 / 94
360amnoncommon desert, soil, rhizosphere, mexico, guanajuato, agave, agave tequiliana, cultivated environment2018-08-21v4No1 / 98
763amnoncommon glacier, surface, sweden, depth 0-20cm, filtered 0.2um, ice2021-04-10v3No1 / 98
99amnoncommon united states of america, mucus, skin, commonwealth of virginia, rana catesbeiana, bullfrog2017-04-02v4No1 / 99
548amnon high in plant root compared to rhizosphere in brazil minas gerais state campos rupestres vellozia epidendroides 2019-08-15v4No1 / 100
536amnoncommon united states of america, skin, snake, crotalus horridus, southern united states, timber rattlesnake2019-07-28v4No1 / 101
536amnoncommon united states of america, skin, snake, southern united states, fossorial snake, storeria dekayi, ground snake2019-07-28v4No1 / 101
499amnoncommon digestive system, pond, intestine, tadpole, brazil, frog, dendropsophus minutus2019-03-05v4No1 / 102
149amnon high in stream compared to pond in larval stage intestine amphibian larval stage germany salamandra salamandra fire salamander 2017-04-24v4No1 / 107
271amnon high in root structure root compared to soil rhizosphere in glycine max soybean depth 0-20cm china 2018-01-09v4No1 / 110
536amnoncommon united states of america, skin, snake, southern united states, thamnophis sirtalis, common garter snake2019-07-28v4No1 / 110
539amnon high in early timepoint days 1-15 aerobic fermentation compared to late timepoint days 30-60 anaerobic fermentation in ethiopia ensete ventricosum ethiopian banana food (fermented) 2019-07-31v4No1 / 110
536amnoncommon united states of america, skin, snake, southern united states, aquatic snake, nerodia sipedon, northern water snake2019-07-28v4No1 / 111
269amnoncommon in fresh yao meat food (common foodon product type, china)2018-01-09v4No1 / 113
98amnoncommon leaf, state of florida, citrus, vero beach, fl2017-04-01v4No1 / 115
536amnoncommon united states of america, skin, snake, southern united states, agkistrodon piscivorus, aquatic snake2019-07-28v4No1 / 115
343amnoncommon in apple flowers (common united states of america, flower structure, malus x domestica, state of connecticut, flower, apple)2018-05-28v4No1 / 118
410amnonlower in feces compared to rectal biopsies in children with treatment naive uc ( high in rectum biopsy site biopsy compared to feces in homo sapiens united states of america child ulcerative colitis )2018-11-22v4No1 / 118
414amnon high in manured soil compared to non-manured soil in agricultural feature soil zea mays glycine max triticum aestivum heilongjiang province black soil mollisol china 2018-11-26v4No1 / 118
196amnoncommon in biofilm in tap water (common united states of america, water, biofilm, drinking water)2017-09-12v4No1 / 121
311amnoncommon united states of america, state of rhode island, scallion, foodon product type2018-04-09v4No1 / 121
374amnoncommon skin, costa rica, amphibia, rhaebo haematiticus, truando toad, toad2018-09-09v4No1 / 121
718amnon high in hypolimnion compared to epilimnion in united states of america state of wisconsin polymictic lake bog lake freshwater lake "forestry bog" lake ph 4.5-5 2028-05-23v4No1 / 121
548amnoncommon stem, brazil, minas gerais state, campos rupestres, barbacenia macrantha, stem endosphere2019-08-17v4No1 / 123
98amnoncommon leaf, state of florida, citrus, ft. pierce, fl2017-04-01v4No1 / 126
823sheryoHigher in 50-70cm depth compared to 70-100cm depth in ultisol soil in auburn, alabama ( high in depth 50-70cm compared to depth 70-100cm in soil agricultural field ultisol upland soil auburn alabama )2021-08-08v3No1 / 127
417amnon high in winter china compared to mongolia summer in feces anser cygnoides bird swan goose 2018-12-01v4No1 / 132
263amnonlower in soils irrigated with artificial wastewater compared to other methods ( high in fertilized water irrigation treated wastewater irrigation tapwater irrigation compared to artificial wastewater irrigation in research facility soil israel negev desert sandy loam soil ph 7-8 irrigated )2017-12-11v4No1 / 134
374amnoncommon skin, costa rica, frog, amphibia, craugastor fitzingeri, common rain frog2018-09-09v4No1 / 136
585amnoncommon china, qingpu district, pomacea canaliculata, golden apple snail, nanheng river, buccal mass2020-02-02v3No1 / 136
617amnoncommon farm, milk, italy, cow milk (fluid), cow milk (raw), alpine, alpine pasture2020-05-03v3No1 / 137
582amnoncommon united states of america, axilla, wild, santa catalina island, urocyon littoralis, urocyon littoralis catalinae, santa catalina island fox2020-01-22v4No1 / 140
291amnoncommon nasal cavity, pair of nares, canis lupus familiaris, germany, dog2018-02-01v4No1 / 144
475amnoncommon in air next to subway stations in hong kong (common city, air, hong kong)2019-01-20v4No1 / 147
782amnon high in sparus aurata seabream compared to dicentrarchus labrax seabass in fish farm skin portuguese republic ria formosa open water pond 2021-05-06v4No1 / 149
615amnon high in stem stem endosphere upper stem compared to leaf leaf endosphere in brazil endosphere greenhouse campinas saccharum sugarcane 2020-04-27v4No1 / 153
171amnoncommon united states of america, oryza sativa, state of california, rice, root2017-07-25v4No1 / 156
108amnon high in colon compared to caecum in united states of america research facility state of texas quail coturnix coturnix 2017-04-07v4No1 / 157
515amnoncommon poland, whole body, plant, beetle, nida basin, herbivorous beetle, crioceris duodecimpunctata2019-04-18v4No1 / 157
653amnon high in dentition supragingival plaque supragingival dental plaque compared to saliva in homo sapiens adult toronto canada third decade human stage 2020-09-13v3No1 / 157
402amnoncommon mine tailing, sediment, soil, guangxi zhuang autonomous region, alkaline mine tailing, zone 2,3, china2018-11-18v4No1 / 159
98amnoncommon leaf, state of florida, citrus, immokalee, fl2017-04-01v4No1 / 160
815amnoncommon feces, mongolia, winter, wild, vulpes vulpes, lake hulun, red fox2021-07-04v3No1 / 160
475amnoncommon in air in subway train in hong kong (common city, air, hong kong, subway)2019-01-20v4No1 / 161
232amnoncoomon in foot of healthy controls (common homo sapiens, skin, foot, australia)2017-11-05v4No1 / 166
357amnoncommon in moist tropical forest topsoil around the world (common soil, topsoil, depth 0-10cm, moist tropical forest, woodland area, forest ecosystem)2018-08-18v4No1 / 171
374amnoncommon skin, costa rica, frog, amphibia, craugastor bransfordii, bransford’s litter frog2018-09-09v4No1 / 171
534amnoncommon river, water, fresh water, nepal, free floating, depth 10 cm, filtered 0.2um, koshi river2019-07-22v4No1 / 172
782amnon high in sparus aurata seabream compared to dicentrarchus labrax seabass in fish farm gill portuguese republic ria formosa open water pond 2021-05-06v4No1 / 174
384amnoncommon farm, pasture, nasal cavity, pair of nares, equus caballus, canada, horse2018-10-22v4No1 / 175
99amnoncommon united states of america, mucus, skin, commonwealth of virginia, anaxyrus americanus, american toad2017-04-02v4No1 / 176
499amnoncommon digestive system, pond, intestine, tadpole, brazil, frog, scinax fuscovarius2019-03-05v4No1 / 176
196amnoncommon united states of america, water, drinking water2017-09-12v4No1 / 178
311amnoncommon united states of america, state of rhode island, ginger, foodon product type2018-04-09v4No1 / 180
179amnoncommon united states of america, research facility, oral cavity, mus musculus, balb/c, mouse, mouth2017-08-13v4No1 / 183
536amnoncommon united states of america, skin, pantherophis obsoletus, snake, southern united states, black rat snake, arboreal snake2019-07-28v4No1 / 184
98amnoncommon leaf, state of florida, citrus, quincy, fl2017-04-01v4No1 / 188
75amnoncommon homo sapiens, arm, skin, venezuela, amerindian, hunter gatherer2017-02-27v4No1 / 190
534amnoncommon river, tributary, water, fresh water, nepal, depth 10 cm, filtered 2.7um, particle bound, koshi river2019-07-22v4No1 / 193
585amnoncommon stomach, china, qingpu district, pomacea canaliculata, golden apple snail, nanheng river2020-02-02v3No1 / 194
371amnoncommon homo sapiens, skin, venezuela, amerindian, hunter gatherer2018-09-06v4No1 / 195
827sheryoHigher in soil depth of 275cm compared to soil depth of 465cm in clayey till loam soil, Lund Denmark ( high in depth 200-350cm compared to depth 450-600cm in kingdom of denmark agricultural field lund loam soil clayey till late weichselian glaciation )2021-09-13v3No1 / 197
316amnoncommon united states of america, soil, topsoil, state of ohio, ph 5, depth 0-10cm, forest ecosystem2018-04-10v4No1 / 199
375amnonlower in oil contaminated soil planted with plants compared to control oil contaminated soil ( high in control compared to rhizosphere planted soil in desert soil oil contaminated soil kuwait )2018-09-09v4No1 / 200
6amnoncommon homo sapiens, urine, female, pregnancy, state of tennessee2016-10-13v4No1 / 201
618amnoncommon farm, canada, root endosphere, root, cannabis sativa, early flowering stage2020-05-04v4No1 / 205
783sheryohigher in desert soil in mongolia under water addition treatment compared to soil without water addition ( high in water addition 100% above ambient precipitation compared to ambient precipitation no water addition in soil mongolia sandy desert bajada china dengkou county ph 7.85 ulan buh desert cambic arenosols luvic gypsisols )2021-05-11v4No1 / 206
360amnoncommon desert, leaf, mexico, guanajuato, agave, agave tequiliana, leaf surface, cultivated environment2018-08-21v4No1 / 210
421amnonlower in paddy field soil incubated with copper compared to controls ( high in control compared to copper in research facility soil paddy field soil zhejiang province china )2018-12-02v4No1 / 212
98amnoncommon leaf, state of florida, citrus, gainesville, fl2017-04-01v4No1 / 215
196amnonhigher in water compared to biofilm ( high in water compared to biofilm in united states of america drinking water )2017-09-12v4No1 / 223
583amnoncommon mountain, soil, switzerland, depth 0-10cm, ph 4-6, elevation 2000-3000m, siliceous parent material, rhone river valley2020-01-27v3No1 / 234
811amnoncommon glacier, glacial ice, ice, shetland islands, south shetland glacier2021-06-22v3No1 / 234
279amnoncommon grassland, steppe, soil, mongolia, china2018-01-24v4No1 / 235
536amnoncommon united states of america, skin, snake, southern united states, agkistrodon contortrix, copperhead snake2019-07-28v4No1 / 236
585amnoncommon intestine, china, qingpu district, pomacea canaliculata, golden apple snail, nanheng river2020-02-02v3No1 / 240
69amnoncommon united states of america, research facility, oropharynx, canis lupus familiaris, beagle dog2017-02-21v4No1 / 241
384amnon high in pasture compared to hay barn in farm saliva equus caballus canada horse mouth 2018-10-22v4No1 / 245
279amnoncommon grassland, soil, alpine soil, tibetan plateau, china2018-01-24v4No1 / 253
617amnoncommon farm, milk, italy, cow milk (fluid), cow milk (raw), lowland pasture, lowland farm2020-05-03v3No1 / 257
788amnoncommon united states of america, state of georgia, mesocosm, plant litter2021-05-31v4No1 / 259
253amnoncommon in clouds in puy de dome mountain in france (common air, french republic, autumn, cloud)2017-11-22v4No1 / 267
499amnoncommon digestive system, pond, intestine, brazil, fish, astyanax paranae, astyanax2019-03-05v4No1 / 273
752sheryoHigher in treatments without biochar compared to treatments with biochar in soil planted with Panax notoginseng amended with 2% biochar ( high in without biochar compared to biochar in soil yunnan province ph 6 china panax notoginseng pot expreiment xundian county sanqi plants )2021-03-11v3No1 / 273
315amnoncommon in frog pond water (common pond, water, fresh water, jiangxi province, hunan province, china)2018-04-10v4No1 / 274
762sheryoCommon in rhizosphere soil of a pot experiment with lettuce planted in npk fertilized haplic luvisol Switzerland (common soil, rhizosphere, switzerland, thyrow, pot expreiment, npk fertilization, lettuce, mineral fertilization, haplic luvisol)2021-04-08v3No1 / 286
423amnoncommon skin, ukraine, bank vole, myodes glareolus2018-12-05v4No1 / 291
156amnoncommon leaf, brassica oleracea, brassica, phyllosphere, china2017-07-27v4No1 / 292
827sheryoHigher in soil depth of 60cm compared to soil depth of 275cm in clayey till loam soil, Lund Denmark ( high in depth 20-120cm compared to depth 200-350cm in kingdom of denmark agricultural field lund loam soil clayey till late weichselian glaciation )2021-09-13v3No1 / 295
37amnoncommon in plastic leaf plants (in field next to tomato plants) (common leaf, maryland county)2016-12-09v4No1 / 298
462amnon high in populus trichocarpa x deltoides compared to populus deltoides in united states of america state of tennessee populus tree cultivated environment root 2019-01-13v4No1 / 300
577amnoncommon lake, water, high salinity, lake water, hypersaline water, romania, ursu lake, depth 4-9m, monimolimnion2020-01-09v3No1 / 303
384amnon high in pasture compared to hay barn in farm nasal cavity pair of nares equus caballus canada horse 2018-10-22v4No1 / 304
515amnoncommon river, poland, whole body, beetle, carnivorous beetle, raba river, bembidion punctulatum2019-04-18v4No1 / 305
751sheryoCommon in tomato soil infected with Fusarium oxysporum (common soil, solanum lycopersicum, fusarium oxysporum, shandong province, china, luojiazhuang)2021-03-11v3No1 / 305
653amnon high in tongue dermal layer of tongue compared to dentition supragingival plaque supragingival dental plaque in homo sapiens adult toronto canada third decade human stage 2020-09-13v3No1 / 306
828sheryoHigher at 0-20cm depth compared to 20-40cm depth in gleysol soil of poplar plantation, sihong, china ( high in depth 0-20cm compared to depth 20-40cm in soil jiangsu province clay loam ph 6-7 gleysol china sihong county poplar poplar plantation chenwei forest )2021-08-25v4No1 / 312
534amnoncommon river, water, fresh water, nepal, depth 10 cm, filtered 2.7um, particle bound, koshi river2019-07-22v4No1 / 315
309amnon high in other plants compared to meadow pea-vine lathyrus pratensis in rhizosphere germany 2018-04-05v4No1 / 316
618amnoncommon farm, canada, root endosphere, root, cannabis sativa, pre-vegetative stage2020-05-04v4No1 / 318
807amnonhigher during typhoon with red soil pollution compared to normal weather ( high in storm typhoon compared to normal weather in surface water sea water autumn near shore filtered 0.2um japan okinawa islands )2021-06-20v3No1 / 318
827sheryoCommon in soil at 575cm depth in clayey till loam soil, Lund Denmark (common kingdom of denmark, agricultural field, lund, loam soil, clayey till, late weichselian glaciation, depth 550-600cm)2021-09-13v3No1 / 318
322amnon high in tadpole compared to adult in digestive system united states of america research facility state of florida frog osteopilus septentrionalis 2018-04-23v4No1 / 320
615amnon high in leaf leaf surface compared to stem upper stem stem surface in brazil greenhouse exosphere campinas saccharum sugarcane 2020-04-27v4No1 / 321
311amnoncommon in floor of kimchi production facility (common united states of america, food processing factory, state of rhode island, floor)2018-04-09v4No1 / 324
782amnon high in skin compared to gill in fish farm portuguese republic sparus aurata ria formosa open water pond seabream 2021-05-06v4No1 / 325
512amnoncommon peatland, fen, soil, peat soil, baekdudaegan, ph 5-6, hani peatland, china2019-03-22v4No1 / 329
565amnoncommon farm, skin, canada, equus asinus africanus, donkey2019-11-21v3No1 / 335
175amnonhigher in winter compared to summer in heavy metal contaminated soils in china ( high in winter compared to summer in soil heavy metal china )2017-07-29v4No1 / 337
750sheryoCommon in soil of wheat field in China (common soil, triticum aestivum, china, hebei province, luancheng county, ph 7.6, fluvo-aquic soil)2021-03-11v3No1 / 337
819amnon high in baoding city prefecture high atmospheric pollution compared to dalian city prefecture low atmospheric pollution in homo sapiens female skin adult scalp china age 25-45 years 2021-07-12v1No1 / 337
129amnoncommon rhizosphere, mexico, myrtillocactus geometrizans, opuntia robusta, cactus, semi-arid2017-04-15v4No1 / 338
618amnoncommon farm, canada, root endosphere, root, cannabis sativa, late flowering stage2020-05-04v4No1 / 352
762sheryoCommon in rhizosphere soil of a pot experiment with lettuce planted in npk fertilized albic luvisol Germany (common soil, rhizosphere, germany, thyrow, pot expreiment, npk fertilization, albic luvisol, lettuce, mineral fertilization)2021-04-08v3No1 / 353
583amnoncommon mountain, soil, switzerland, depth 0-10cm, canton of graubunden, elevation 2000-3000m, siliceous parent material, ph 4.5-72020-01-27v3No1 / 359
762sheryoCommon in rhizosphere soil of a pot experiment with lettuce planted in organic fertilized albic luvisol Germany (common soil, manured soil, rhizosphere, germany, thyrow, pot expreiment, manure fertilization, albic luvisol, lettuce, organic fertilization)2021-04-08v3No1 / 359
512amnon high in baekdudaegan ph 5-6 hani peatland compared to tibetan plateau riganqiao peatland ph 5.5-6.5 in peatland fen soil peat soil china 2019-03-22v4No1 / 363
252amnonhigh on sand biofilm compared to rock biofilm in river ( high in sand epipsammic compared to rock epilithic in river sediment biofilm kingdom of spain )2017-11-22v4No1 / 374
582amnon high in external acoustic meatus ear canal compared to rectum perianal skin in united states of america wild santa catalina island urocyon littoralis urocyon littoralis catalinae santa catalina island fox 2020-01-22v4No1 / 374
791sheryoCommon in highly saline sodic soil at8 80cm depth in China (common soil, high salinity, china, songnen plain, da'an station, salic solonetz, high sodicity, ph 10, depth (soil) 80cm)2021-06-07v4No1 / 377
798amnon high in hay plant litter litter bag compared to soil ph 7-8 in orchard italy depth 10 cm apennine mountains prunus armeniaca apricot 2021-06-13v3No1 / 377
256amnoncommon duodenum, jejunum, ileum, sus scrofa, pig, united kingdom2017-11-26v4No1 / 380
256amnonhigher in small intestine compared to colon in pigs ( high in duodenum jejunum ileum compared to caecum left colon right colon in sus scrofa pig united kingdom )2017-11-26v4No1 / 387
170amnonhigher in low turbidity river water ( high in turbidity low turbidity compared to high turbidity in united states of america river stream water fresh water depth 10 cm )2017-07-24v4No1 / 395
662amnoncommon soil, israel, depth 0-10cm, irrigated, agricultural field, clay soil, neve yaar2020-09-21v3No1 / 402
347amnoncommon permafrost, soil, kingdom of norway, svalbard archipelago, depth 0-20cm, permafrost active layer2018-07-15v4No1 / 405
558amnon high in gizzard compared to crop in united states of america state of wyoming bird centrocercus urophasianus greater sage-grouse 2019-09-20v4No1 / 408
755sheryocommon in domesticated rice (Oryza stavia) rhizosphere (common soil, rhizosphere, oryza sativa, ph 7, black soil, china, jilin province)2021-03-18v3No1 / 415
353amnoncommon in wild Lissotriton vulgaris newts skin (common skin, adult, cambridgeshire, newt, lissotriton vulgaris, united kingdom)2018-07-30v4No1 / 418
309amnon high in onobrychis viciifolia common sainfoin compared to other plants in rhizosphere germany 2018-04-05v4No1 / 420
612amnoncommon united states of america, water, fresh water, state of florida, spring water, location 32020-04-22v4No1 / 420
837sheryoHigher in agricultural field at depths 0-40cm compared to 100-300cm, shaanxi, China ( high in depth 0-40cm compared to depth 100-300cm in soil zea mays triticum aestivum silt loam agricultural field china shaanxi province loess plateau )2021-09-26v4No1 / 431
360amnoncommon desert, soil, rhizosphere, state of california, agave, agave deserti2018-08-21v4No1 / 432
360amnoncommon desert, soil, mexico, guanajuato2018-08-21v4No1 / 437
99amnoncommon united states of america, mucus, skin, commonwealth of virginia, pseudacris crucifer, peeper2017-04-02v4No1 / 438
577amnon high in high salinity hypersaline water depth 4-9m monimolimnion compared to low salinity depth 0-3m mixolimnion in lake water lake water romania ursu lake 2020-01-09v3No1 / 439
762sheryocommon in rhizosphere soil of a pot experiment with lettuce planted in organic fertilized haplic luvisol Switzerland (common soil, manured soil, rhizosphere, switzerland, thyrow, pot expreiment, manure fertilization, lettuce, organic fertilization, haplic luvisol, bio-dynamic fertilizer)2021-04-08v3No1 / 455
823sheryoHigher in 10-25cm depth compared to 25-50cm depth in ultisol soil in auburn, alabama ( high in depth 10-25cm compared to depth 25-50cm in soil agricultural field ultisol upland soil auburn alabama )2021-08-07v3No1 / 455
353amnoncommon in wild Triturus cristatus newts skin (common skin, adult, cambridgeshire, newt, triturus cristatus, united kingdom)2018-07-30v4No1 / 456
415amnonhigher in citrus from humid subtropical compared to mediterranean and semi-arid climate ( high in subtropical compared to mediterranean semi-arid in orchard soil rhizosphere citrus cultivated environment )2018-11-27v4No1 / 458
823sheryoCommon at 70-100cm depth in ultisol soil in auburn, alabama (common soil, agricultural field, ultisol, upland soil, auburn, alabama, depth 70-100cm)2021-08-07v3No1 / 459
128amnoncommon city, dense settlement biome, leaf, belgium, ivy, hedera hibernica2017-04-14v4No1 / 461
662amnoncommon water, wastewater treatment plant, israel, treated wastewater2020-09-20v3No1 / 473
357amnoncommon soil, topsoil, depth 0-10cm, woodland area, forest ecosystem2018-08-19v4No1 / 474
813amnoncommon united states of america, soil, state of washington, olympic national park, canopy soil, intact branch, epiphytic material2021-06-22v4No1 / 475
347amnon high in depth 0-20cm permafrost transition layer compared to depth (soil) 20-30cm in permafrost soil kingdom of norway svalbard archipelago 2018-07-15v4No1 / 477
786sheryoCommon in flood plain soil near cosumnes river, california, at 400-700cm depth (common united states of america, soil, state of california, flood plain, sacramento, cosumnes river preserve, depth (soil) 400-700cm)2021-05-18v3No1 / 481
236amnoncommon ocean, zostera marina, state of california, bodega bay, marine eelgrass, root2017-11-07v4No1 / 483
360amnoncommon desert, soil, rhizosphere, mexico, guanajuato, agave, agave salmiana2018-08-21v4No1 / 484
438amnon high in adult 65-79 year-old human stage fourth decade human stage fifth decade human stage compared to child age 3-6 age 8-12 2-5 year-old child stage 6-12 year-old child stage in feces homo sapiens china 2018-12-30v4No1 / 486
662amnoncommon soil, israel, depth 0-10cm, irrigated, agricultural field, loam, neve yaar, loam soil2020-09-21v3No1 / 489
375amnoncommon in oil contaminated desert soil (common desert, soil, oil contaminated soil, kuwait)2018-09-09v4No1 / 490
829sheryoCommon in soil depth of 56-116cm in Mollisol soil, Dekalb, Illinois, united states of america (common united states of america, soil, state of illinois, mollisol, silt loam, dekalb county, illinois, depth 56-116cm)2021-08-26v3No1 / 491
360amnoncommon desert, leaf, mexico, guanajuato, agave, agave salmiana, leaf surface2018-08-21v4No1 / 492
415amnoncommon united states of america, orchard, soil, rhizosphere, citrus, cultivated environment2018-11-27v4No1 / 494
357amnoncommon soil, topsoil, depth 0-10cm, southern temperate forest, temperate broadleaf and mixed forest biome, woodland area, forest ecosystem2018-08-19v4No1 / 499
360amnoncommon desert, soil, mexico, guanajuato, cultivated environment2018-08-21v4No1 / 500
373amnoncommon rice field, soil, rhizosphere, oryza sativa, hunan province, rice, china2018-09-08v4No1 / 501
616amnon high in non-fertilized soil ph 6.7 compared to fertilized soil ph 5.5-6 in soil topsoil guangzhou city prefecture depth 0-20cm china saccharum sugarcane 2020-04-27v3No1 / 504
315amnonhigher in frog pond water compared to frog gut ( high in water fresh water compared to digestive system colon frog quasipaa spinosa giant spiny frog in jiangxi province hunan province china )2018-04-10v4No1 / 505
798amnoncommon orchard, hay, italy, depth 10 cm, plant litter, apennine mountains, prunus armeniaca, apricot, litter bag2021-06-13v3No1 / 508
718amnon high in epilimnion compared to hypolimnion in united states of america state of wisconsin dimictic lake bog lake freshwater lake ph 4.5-5 "trout bog" lake 2028-05-23v4No1 / 509
829sheryoCommon in soil depth of 116-140cm in Mollisol soil, Dekalb, Illinois, united states of america (common united states of america, soil, state of illinois, mollisol, silt loam, dekalb county, illinois, depth 116-140cm)2021-08-26v3No1 / 516
612amnoncommon united states of america, water, fresh water, state of florida, spring water, location 12020-04-22v4No1 / 518
615amnon high in endosphere root compared to rhizosphere in brazil greenhouse campinas saccharum sugarcane 2020-04-27v4No1 / 529
618amnoncommon farm, rhizosphere, canada, cannabis sativa, pre-vegetative stage2020-05-04v4No1 / 530
755sheryocommon in wild rice (Oryza rufipogon) rhizosphere (common soil, rhizosphere, ph 7, black soil, oryza rufipogon, china, jilin province)2021-03-18v3No1 / 530
762sheryocommin in bulk soil of a pot experiment with lettuce planted in npk fertilzed albic luvisol from Germany (common soil, bulk soil, germany, thyrow, pot expreiment, npk fertilization, albic luvisol, ph 6.4, lettuce, mineral fertilization)2021-04-07v3No1 / 531
178amnonlower in drinking water compared to loose deposits in water pipes ( high in deposits compared to drinking water in water kingdom of the netherlands )2017-08-10v4No1 / 538
603amnoncommon in baijiu fermentation pit mud in first 2 batches (common mud, fermentation pit mud, china, hefei city prefecture, baijiu, days 0-90)2020-04-05v3No1 / 542
98amnoncommon rhizosphere, state of florida, citrus, immokalee, fl, root2017-04-01v4No1 / 543
98amnoncommon rhizosphere, state of florida, citrus, vero beach, fl, root2017-04-01v4No1 / 544
548amnoncommon on leaf surface (common leaf, brazil, minas gerais state, campos rupestres, vellozia epidendroides)2019-08-17v4No1 / 548
309amnon high in other plants compared to prunella vulgaris woundwort in rhizosphere germany 2018-04-05v4No1 / 550
548amnoncommon in leaf surface of barbacenia macrantha (common leaf, brazil, minas gerais state, leaf surface, campos rupestres, barbacenia macrantha)2019-08-17v4No1 / 550
129amnoncommon leaf, mexico, myrtillocactus geometrizans, opuntia robusta, cactus, semi-arid2017-04-15v4No1 / 562
357amnoncommon soil, mediterranean forest biome, topsoil, depth 0-10cm, woodland area, forest ecosystem2018-08-19v4No1 / 564
254amnon high in summer autumn wet season compared to winter dry season in river water fresh water fujian province depth 0.5m jiulong river china 2017-11-23v4No1 / 571
548amnoncommon brazil, minas gerais state, root endosphere, campos rupestres, barbacenia macrantha, root2019-08-17v4No1 / 575
667amnoncommon soil, topsoil, jiangxi province, ph 4.5, depth 0-20cm, forested area, china, lushan mountain, elevation 500-600m2020-09-25v4No1 / 575
696amnon high in georissa georissa similis compared to opisthostoma concinnum plectostoma concinnum in stomach gastrointestinal system malaysia state of sabah land snail 2028-03-28v3No1 / 576
762sheryoHigh in bulk soil comparedc to rhizosphere of a pot experiment with lettuce planted in haplic luvisol Switzerland ( high in bulk soil compared to rhizosphere in soil switzerland thyrow pot expreiment lettuce haplic luvisol )2021-04-08v3No1 / 577
762sheryoHigh in bulk soil compared to rhizosphere of a pot experiment with lettuce planted in albic luvisol Germany ( high in bulk soil compared to rhizosphere in soil germany thyrow pot expreiment albic luvisol lettuce haplic luvisol )2021-04-08v3No1 / 578
254amnon high in summer wet season compared to winter autumn dry season in river water fresh water fujian province depth 0.5m jiulong river china 2017-11-23v4No1 / 581
808amnon high in ileum compared to caecum in research facility mucosa gallus gallus germany chicken age 35 weeks hen 2021-06-20v1No1 / 587
357amnoncommon soil, topsoil, depth 0-10cm, montane forest, woodland area, forest ecosystem2018-08-19v4No1 / 592
360amnon high in rhizosphere agave compared to soil in desert state of california mexico 2018-08-21v4No1 / 593
612amnoncommon united states of america, water, fresh water, state of florida, spring water, location 22020-04-22v4No1 / 596
791sheryoCommon in highly saline sodic soil at 20cm depth in China (common soil, depth 20cm, high salinity, china, songnen plain, da'an station, salic solonetz, high sodicity, ph 10.5)2021-06-07v4No1 / 596
801sheryoCommon at depth 15-30cm in corn agriculture fields, Iowa USA (common soil, zea mays, iowa, agricultural field, united states, des moines, ph 7.7, nicollet soil series, depth 15-30cm, kanawha)2021-06-15v4No1 / 598
415amnoncommon orchard, soil, rhizosphere, south africa, citrus, cultivated environment2018-11-27v4No1 / 600
762sheryoCommon in bulk soil of a pot experiment with lettuce planted in organic fertilized haplic luvisol Switzerland (common soil, manured soil, bulk soil, switzerland, pot expreiment, manure fertilization, lettuce, organic fertilization, haplic luvisol, therwil, bio-dynamic fertilizer, ph 6.6)2021-04-07v3No1 / 602
788amnoncommon feces, united states of america, state of georgia, mesocosm, cherokia georgiana georgiana, millipede2021-05-31v4No1 / 607
662amnoncommon soil, israel, depth 0-10cm, irrigated, agricultural field, neve yaar, loamy sand soil2020-09-22v3No1 / 609
667amnoncommon soil, topsoil, jiangxi province, ph 4.5, depth 0-20cm, forested area, china, elevation 200-300m, lushan mountain2020-09-25v4No1 / 613
357amnoncommon savanna, soil, topsoil, depth 0-10cm, woodland area, forest ecosystem2018-08-19v4No1 / 614
438amnonlower in students and soldiers age 19-24 compared to older adults ( high in age >94 65-79 year-old human stage fourth decade human stage fifth decade human stage ninth decade human stage tenth decade human stage compared to soldiers young adult stage in feces homo sapiens china )2018-12-30v4No1 / 617
791sheryoCommon in highly saline sodic soil at 40cm depth in China (common soil, high salinity, china, songnen plain, da'an station, salic solonetz, high sodicity, ph 10.5, depth (soil) 40cm)2021-06-07v4No1 / 618
823sheryoCommon at 50-70cm depth in ultisol soil in auburn, alabama (common soil, agricultural field, ultisol, upland soil, auburn, alabama, depth 50-70cm)2021-08-07v3No1 / 620
128amnoncommon moor, scrubland, leaf, belgium, ivy, hedera hibernica2017-04-14v4No1 / 623
698amnoncommon park, rhizosphere, depth 0-30cm, united kingdom, london, quercus, ph 4-4.5, oak2028-04-01v3No1 / 623
786sheryoHigher at 0-30cm depth compared to 30-60cm depth in flood plain soil near cosumnes river, california ( high in depth 0-30cm compared to depth 30-60cm in united states of america soil state of california flood plain sacramento cosumnes river preserve )2021-09-13v3No1 / 627
642amnon high in feces digesta compared to gastrointestinal system alimentary part of gastrointestinal system in pacific ocean san diego fish scomber japonicus chub mackerel 2020-08-28v4No1 / 628
667amnoncommon soil, topsoil, jiangxi province, depth 0-20cm, forested area, coniferous forest biome, china, lushan mountain, elevation 1000-1100m, ph 4-4.52020-09-25v4No1 / 630
813amnoncommon united states of america, soil, state of washington, olympic national park, canopy soil, severed branch, epiphytic material2021-06-22v4No1 / 633
609sheryoCommon in soil with tobacco plants amended with difenoconazole fungicide and biochar (common soil, ph 7-8, depth 0-20cm, limestone, biochar, fungicide, china, tobacco field, difenoconazole, tobacco plant present)2020-04-21v4No1 / 634
360amnoncommon desert, soil, state of california2018-08-21v4No1 / 637
827sheryoCommon in soil at 230cm depth in clayey till loam soil, Lund Denmark (common kingdom of denmark, agricultural field, lund, loam soil, clayey till, late weichselian glaciation, depth 200-260cm)2021-08-24v3No1 / 644
762sheryoCommon in bulk soil of a pot experiment with lettuce planted in npk fertilized haplic luvisol Switzerland (common soil, bulk soil, switzerland, ph 5.6, pot expreiment, npk fertilization, lettuce, mineral fertilization, haplic luvisol, therwil)2021-04-07v3No1 / 648
820naCommon in upper subsoil, 45-75cm depth, wheat rhizosphere haplic luvisol in germany (common soil, rhizosphere, triticum aestivum, germany, bonn, haplic luvisol, ph 6.9, campus klein-altendorf, depth 45-75cm, silty clay loam)2021-07-14v1No1 / 648
360amnoncommon desert, leaf, state of california, agave, agave deserti, leaf surface2018-08-21v4No1 / 649
801sheryoCommon in soybean and corn agriculture fields at depth 60-90cm, Iowa USA (common soil, zea mays, glycine max, iowa, agricultural field, united states, ames, des moines, ph 7.7, nicollet soil series, depth 60-90cm)2021-06-15v4No1 / 650
548amnoncommon rhizosphere, brazil, minas gerais state, campos rupestres, barbacenia macrantha2019-08-17v4No1 / 651
823sheryoCommon at 25-50cm depth in ultisol soil in auburn, alabama (common soil, agricultural field, ultisol, upland soil, auburn, alabama, depth 25-50cm)2021-08-07v3No1 / 652
200amnoncommon in river downstream of wastewater treatment plant (common united states of america, river, water, fresh water, wastewater treatment plant, effluent)2017-10-01v4No1 / 655
612amnoncommon united states of america, water, fresh water, state of florida, spring water, location 42020-04-22v4No1 / 655
178amnoncommon in drinking water pipe loose deposits (common water, drinking water, kingdom of the netherlands, deposits)2017-08-10v4No1 / 656
801sheryoCommon at depth 60-90cm in corn and soybean agriculture fields, Iowa USA (common soil, zea mays, glycine max, iowa, agricultural field, united states, des moines, ph 7.9, nicollet soil series, depth 60-90cm, kelley, subsurface drainage)2021-06-16v4No1 / 667
609sheryocommon in soil with tobacco plants amended with difenoconazole fungicide (common soil, ph 7-8, depth 0-20cm, limestone, fungicide, china, tobacco field, difenoconazole, tobacco plant present)2020-04-21v4No1 / 671
236amnon high in root compared to sediment marine sediment in ocean zostera marina state of california bodega bay marine eelgrass 2017-11-07v4No1 / 674
357amnoncommon in temperate deciduous forests around the world (common soil, temperate woodland biome, topsoil, depth 0-10cm, temperate deciduos forest, woodland area, forest ecosystem)2018-08-18v4No1 / 681
422amnoncommon soil, paddy field soil, oryza sativa, heilongjiang province, ph 6-7, cultivated environment, china2018-12-04v4No1 / 682
100amnoncommon park, soil, urban biome, new york city, central park2017-04-03v4No1 / 685
829sheryohigher soil depth of 0-12cm compared to 12-44cm in Alfisol soil, Dekalb, Illinois, united states of america ( high in depth 0-12cm compared to depth 12-44cm in united states of america soil state of illinois sandy loam soil dekalb county illinois alfisol hapludalf sandy loam )2021-08-26v3No1 / 685
128amnoncommon leaf, belgium, ivy, forest ecosystem, hedera hibernica2017-04-14v4No1 / 693
134amnon high in subtropical taxus mairei southeast china compared to temperate taxus media taxus cuspidata northeast china in rhizosphere tree taxus china 2017-04-16v4No1 / 694
667amnoncommon soil, topsoil, jiangxi province, ph 4.5, depth 0-20cm, forested area, china, lushan mountain, elevation 800-900m2020-09-25v4No1 / 694
722amnon high in hunts point compared to soundview oyster reef in united states of america estuary sediment marine sediment state of new york new york city sediment surface 2021-01-02v4No1 / 696
347amnoncommon permafrost, soil, kingdom of norway, svalbard archipelago, depth (soil) 20-30cm2018-07-15v4No1 / 698
820naCommon in lower subsoil, 75-105cm depth, wheat rhizosphere haplic luvisol in germany (common soil, rhizosphere, triticum aestivum, germany, bonn, haplic luvisol, ph 6.9, campus klein-altendorf, silty clay loam, depth 75-105cm)2021-07-14v1No1 / 700
754sheryoCommon in soil planted with cucmber, fertilized with bioorganic fertilizer (Bacillus amyloliquefaciens SQR 9) and infected with Fusarium oxysporum f. sp. cucumerinum (common soil, zhejiang province, cucumber, fusarium oxysporum, china, bio-organic fertilizer, bacillus amyloliquefaciens sqr9)2021-03-15v3No1 / 701
746sheryoHigh in saline soil fertilized with biological fertilizer compared to chemical fertilizer, planted with tomatos, in dafeng, china ( high in trichoderma guizhouense njau 4742 biological fertilization chicken manure compared to chemical fertilization n,p,k in solanum lycopersicum jiangsu province solonchak china dafeng city saline soil ph 7.5 )2021-03-03v4No1 / 703
801sheryoCommon at depth 30-60cm in corn agriculture fields, Iowa USA (common soil, zea mays, iowa, agricultural field, united states, des moines, depth (soil) 30-60cm, nicollet soil series, kanawha, ph 8.1)2021-06-15v4No1 / 703
762sheryoCommon in bulk soil of a pot experiment with lettuce planted in organic fertilized albic luvisol from Germany (common soil, manured soil, bulk soil, germany, thyrow, pot expreiment, manure fertilization, albic luvisol, ph 6.4, lettuce, organic fertilization)2021-04-07v3No1 / 704
809amnoncommon research facility, rhizosphere, greenhouse, china, lu'an city prefecture, dendrobium officinale, flowerpot2021-06-20v4No1 / 715
357amnon high in ph>3 compared to ph<3 in soil subpolar coniferous forest biome topsoil depth 0-10cm boreal forest woodland area forest ecosystem 2018-08-19v4No1 / 719
415amnoncommon orchard, soil, rhizosphere, reunion island, citrus, cultivated environment2018-11-27v4No1 / 721
829sheryoCommon in soil depth of 12-44m in Alfisol soil, Dekalb, Illinois, united states of america (common united states of america, soil, state of illinois, sandy loam soil, dekalb county, illinois, alfisol, hapludalf, sandy loam, depth 12-44cm)2021-08-26v3No1 / 721
422amnoncommon soil, paddy field soil, oryza sativa, heilongjiang province, ph 5-6, cultivated environment, china2018-12-04v4No1 / 726
821sheryoComoon in soil of miscanthus field at 50-100cm depth, Michigan USA (common united states of america, soil, state of michigan, depth 50-100m, miscanthus, kalamazoo loam, mesic type hapludalf, kellogg biological station, restored prairie)2021-08-02v4No1 / 726
462amnoncommon united states of america, state of tennessee, soil, silt clay loam, depth 30-75cm, cultivated environment2019-01-13v4No1 / 728
752sheryoCommon in soil planted with Panax notoginseng (common soil, yunnan province, ph 6, china, panax notoginseng, pot expreiment, xundian county, sanqi plants)2021-03-11v3No1 / 730
823sheryoCommon at 0-10cm depth in ultisol soil in auburn, alabama (common soil, depth 0-10cm, agricultural field, ultisol, upland soil, auburn, alabama)2021-08-07v3No1 / 730
823sheryoCommon at 10-25cm depth in ultisol soil in auburn, alabama (common soil, agricultural field, ultisol, upland soil, auburn, alabama, depth 10-25cm)2021-08-07v3No1 / 732
829sheryoCommon in soil depth of 0-12m in Alfisol soil, Dekalb, Illinois, united states of america (common united states of america, soil, state of illinois, sandy loam soil, dekalb county, illinois, depth 0-12cm, alfisol, hapludalf, sandy loam)2021-08-26v3No1 / 737
421amnoncommon in paddy field soil incubated with copper (common research facility, soil, paddy field soil, copper, zhejiang province, china)2018-12-02v4No1 / 740
813amnoncommon united states of america, soil, state of washington, forested area, olympic national park, temperate rainforest2021-06-22v4No1 / 740
761sheryoCommon in maize rhizosphere sandy soil maize field in Germany (common rhizosphere, zea mays, germany, ph 5, maize field, lower saxony, sandy soil)2021-04-06v3No1 / 742
415amnoncommon orchard, soil, rhizosphere, australia, citrus, cultivated environment2018-11-27v4No1 / 743
821sheryoCommon in soil of restored prairie at 50-100cm depth, Michigan USA (common united states of america, soil, state of michigan, depth 50-100m, kalamazoo loam, mesic type hapludalf, kellogg biological station, restored prairie)2021-07-28v4No1 / 744
600sheryoDecreases after 12 days of stover ammendment in soil ( high in day 1 compared to day 12 in united states of america soil state of new york depth 0-5cm ph 6 coarse-loamy soil stover ammendment soil )2020-03-27v4No1 / 747
791sheryoHigher at 0cm depth compared to 80cm depth in low saline low sodicity soil in China ( high in depth 0cm compared to depth (soil) 80cm in soil low salinity china songnen plain da'an station salic solonetz low sodicity ph 9 )2021-06-08v4No1 / 748
271amnon high in rhizosphere glycine max soybean compared to soil in depth 0-20cm china 2018-01-09v4No1 / 750
829sheryoCommon in soil depth of 44-108cm in Alfisol soil, Dekalb, Illinois, united states of america (common united states of america, soil, state of illinois, sandy loam soil, dekalb county, illinois, alfisol, hapludalf, sandy loam, depth 44-108cm)2021-08-26v3No1 / 751
823sheryoCommon at 30-50cm depth in foot slope ultisol soil in auburn, alabama (common soil, agricultural field, ultisol, auburn, alabama, foot slope , depth 30-50cm)2021-08-08v3No1 / 753
801sheryoCommon at depth 30-60cm in corn and soybean agriculture fields, Iowa USA (common soil, zea mays, glycine max, iowa, agricultural field, united states, des moines, ph 6.7, depth (soil) 30-60cm, nicollet soil series, kelley, subsurface drainage)2021-06-15v4No1 / 760
801sheryoCommon at depth 60-90cm in corn agriculture fields, Iowa USA (common soil, zea mays, iowa, agricultural field, united states, des moines, nicollet soil series, depth 60-90cm, kanawha, ph 8.3)2021-06-15v4No1 / 764
206amnoncommon in air from israel particles <10um size (common air, dust, israel, size < 10um, clear day)2017-10-04v4No1 / 765
813amnonlower in epiphytic materiall attached to intact branch compared to severed suspended branch ( high in severed branch compared to intact branch in united states of america soil state of washington olympic national park canopy soil epiphytic material )2021-06-22v4No1 / 768
821sheryoCommon in soil of continuous corn field at 50-100cm depth, Michigan USA (common united states of america, soil, state of michigan, corn, depth 50-100m, continuous corn, kalamazoo loam, mesic type hapludalf, kellogg biological station)2021-07-28v4No1 / 769
171amnon high in drought environment compared to control in united states of america soil rhizosphere oryza sativa state of california rice 2017-07-25v4No1 / 770
171amnoncommon united states of america, soil, rhizosphere, oryza sativa, state of california, rice2017-07-25v4No1 / 772
615amnoncommon brazil, endosphere, greenhouse, root, campinas, saccharum, sugarcane2020-04-27v4No1 / 776
667amnoncommon soil, topsoil, jiangxi province, ph 4, depth 0-20cm, forested area, coniferous forest biome, china, lushan mountain, elevation 1300-1400m2020-09-25v4No1 / 777
615amnoncommon in control soil with no sugarcane (common soil, brazil, greenhouse, campinas)2020-04-27v4No1 / 780
823sheryoCommon at 90-100cm depth in foot slope ultisol soil in auburn, alabama (common soil, agricultural field, ultisol, auburn, alabama, foot slope , depth 90-100cm)2021-08-08v3No1 / 782
752sheryoCommon in soil planted with Panax notoginseng amended with2% biochar (common soil, yunnan province, ph 6, biochar, china, panax notoginseng, pot expreiment, xundian county, sanqi plants)2021-03-11v3No1 / 783
828sheryoCommon in gleysol soil of poplar plantation at 40-50cm depth, sihong, china (common soil, jiangsu province, clay loam, ph 6-7, gleysol, china, sihong county, poplar, poplar plantation, chenwei forest, depth 40-50cm)2021-08-25v4No1 / 790
478amnoncommon farm, intestine, litopenaeus vannamei, pacific white shrimp, china2019-02-19v4No1 / 795
829sheryoCommon in soil depth of 0-27cm in Mollisol soil, Dekalb, Illinois, united states of america (common united states of america, soil, state of illinois, mollisol, silt loam, dekalb county, illinois, depth 0-27cm)2021-08-26v3No1 / 798
478amnoncommon farm, water, saline water, shrimp farm, china2019-02-19v4No1 / 799
548amnoncommon in endopytic roots of Vellozia epidendroides (common brazil, minas gerais state, plant, campos rupestres, vellozia epidendroides, root)2019-08-15v4No1 / 800
823sheryoCommon at 50-90cm depth in foot slope ultisol soil in auburn, alabama (common soil, agricultural field, ultisol, auburn, alabama, foot slope , depth 50-90cm)2021-08-08v3No1 / 815
480amnoncommon farm, pasture, soil, ireland2019-02-05v4No1 / 816
618amnoncommon farm, rhizosphere, canada, cannabis sativa, late flowering stage2020-05-04v4No1 / 819
422amnoncommon soil, paddy field soil, oryza sativa, yunnan province, cultivated environment, china2018-12-02v4No1 / 821
412amnoncommon soil, cambisol, red soil, zea mays, triticum aestivum, hunan province, ph<5, china2018-11-26v4No1 / 823
421amnoncommon in paddy field soil incubated without copper (common research facility, soil, paddy field soil, zhejiang province, china)2018-12-02v4No1 / 824
415amnoncommon orchard, soil, rhizosphere, citrus, cultivated environment, china2018-11-27v4No1 / 830
583amnoncommon mountain, soil, switzerland, depth 0-10cm, ph 7-8, canton of graubunden, elevation 2000-3000m, calcareous parent material2020-01-28v3No1 / 830
444amnoncommon farm, greenhouse soil, rhizosphere, fragaria x ananassa, nanjing city prefecture, strawberry, yellow brown soil, age 5 years, age 10 years, continuous cropping, cultivated environment, china2019-01-07v4No1 / 833
356amnoncommon in deciduous broad leaved forest top soil in japan (common soil, topsoil, hokkaido, depth 0-10cm, ph 5.4, forest ecosystem, japan)2018-08-15v4No1 / 834
761sheryoCommon in bulk sandy soil maize field in Germany (common bulk soil, germany, ph 5, maize field, lower saxony, sandy soil)2021-04-06v3No1 / 835
801sheryoCommon in soybean and corn agriculture fields at depth 30-60cm, Iowa USA (common soil, zea mays, glycine max, iowa, agricultural field, united states, ames, des moines, depth (soil) 30-60cm, nicollet soil series, ph 7.4)2021-06-15v4No1 / 839
801sheryoCommon at depth 15-30cm in corn and soybean agriculture fields, Iowa USA (common soil, zea mays, glycine max, iowa, ph 6, agricultural field, united states, des moines, nicollet soil series, depth 15-30cm, kelley, subsurface drainage)2021-06-15v4No1 / 841
266amnoncommon in roots in JAM garden (common united states of america, state of idaho, plant, brassicaceae, boechera stricta, root)2017-12-19v4No1 / 843
828sheryoCommon in gleysol soil of poplar plantation at 30-40cm depth, sihong, china (common soil, jiangsu province, clay loam, ph 6-7, gleysol, china, sihong county, poplar, poplar plantation, chenwei forest, depth 30-4cm)2021-08-25v4No1 / 844
698amnoncommon park, rhizosphere, disease, ph 5-6, depth 0-30cm, united kingdom, quercus, oak, acute oak decline, plant disease2028-04-01v3No1 / 848
412amnoncommon soil, cambisol, red soil, zea mays, triticum aestivum, hunan province, ph>5, china2018-11-26v4No1 / 856
769sheryocommon in conventional tillage wheat field in northern israel (common soil, bulk soil, triticum aestivum, israel, vertisol, conventional tillage, northen israel)2021-04-18v4No1 / 861
801sheryoCommon at depth 0-15cm in corn agriculture fields, Iowa USA (common soil, zea mays, iowa, agricultural field, united states, des moines, depth 0-15cm, nicollet soil series, ph 7.1, kanawha)2021-06-15v4No1 / 862
767sheryoCommon in soil planted with Chrysanthemum, fertilized with bio-organic fertilizer in Nanjing China (common soil, compost biofilter, compost, pig manure, paenibacillus, china, nanjing county, chrysanthemum, bio-organic fertilizer, chrysanthemum morifolium ramat., ph 6.9, paenibacillus polymyxa)2021-04-14v4No1 / 866
827sheryoCommon in soil at 325cm depth in clayey till loam soil, Lund Denmark (common kingdom of denmark, agricultural field, lund, loam soil, clayey till, late weichselian glaciation, depth 300-350cm)2021-08-24v3No1 / 866
769sheryocommon in no tillage wheat field in northern israel (common soil, bulk soil, triticum aestivum, israel, vertisol, northen israel, no tillage)2021-04-18v4No1 / 871
829sheryoCommon in soil depth of 108-140cm in Alfisol soil, Dekalb, Illinois, united states of america (common united states of america, soil, state of illinois, sandy loam soil, dekalb county, illinois, alfisol, hapludalf, sandy loam, depth 108-140cm)2021-08-26v3No1 / 871
821sheryoCommon in soil of switchgrass field at 50-100cm depth, Michigan USA (common united states of america, soil, state of michigan, depth 50-100m, panicum virgatum, kalamazoo loam, mesic type hapludalf, kellogg biological station)2021-08-03v4No1 / 872
618amnoncommon farm, rhizosphere, canada, cannabis sativa, early flowering stage2020-05-04v4No1 / 873
786sheryoCommon in flood plain soil near cosumnes river, california, at 60-100cm depth (common united states of america, soil, state of california, flood plain, sacramento, cosumnes river preserve, depth (soil) 60-100cm)2021-05-18v3No1 / 878
129amnoncommon soil, mexico, myrtillocactus geometrizans, opuntia robusta, cactus, semi-arid, ph 6-6.52017-04-15v4No1 / 884
171amnoncommon in soil with rice growth irrigation protocol (common united states of america, soil, state of california, depth 5cm)2017-07-25v4No1 / 890
462amnon high in leaf compared to stem in united states of america state of tennessee populus tree cultivated environment 2019-01-13v4No1 / 890
146amnoncommon united states of america, rhizosphere, solanum lycopersicum, tomato, slit loam soil, ph 62017-04-20v4No1 / 894
791sheryoHigher in low sodicity and low salinity soil compared to high sodicity and high salinity soil at 80cm depth in China ( high in low salinity low sodicity ph 9 compared to high salinity high sodicity ph 10 in soil china songnen plain da'an station salic solonetz depth (soil) 80cm )2021-06-08v4No1 / 895
788amnoncommon united states of america, soil, state of georgia, mesocosm2021-05-31v4No1 / 897
786sheryoCommon in flood plain soil near cosumnes river, california, at 133-166cm depth (common united states of america, soil, state of california, flood plain, sacramento, cosumnes river preserve, depth (soil) 133-166cm)2021-05-18v3No1 / 898
479amnoncommon united states of america, rhizosphere, state of california, ph 6-7, ceanothus jepsonii2019-02-05v4No1 / 900
821sheryoCommon in soil of miscanthus field at 25-50cm depth, Michigan USA (common united states of america, soil, state of michigan, miscanthus, kalamazoo loam, mesic type hapludalf, kellogg biological station, depth 25-50cm, restored prairie)2021-08-02v4No1 / 901
801sheryoCommon in soybean and corn agriculture fields at depth 15-30cm, Iowa USA (common soil, zea mays, glycine max, iowa, agricultural field, united states, ames, des moines, nicollet soil series, depth 15-30cm, ph 7.4)2021-06-15v4No1 / 905
807amnoncommon surface water, sea water, summer, near shore, filtered 0.2um, tropical storm, japan, okinawa islands2021-06-20v3No1 / 905
829sheryoCommon in soil depth of 27-56cm in Mollisol soil, Dekalb, Illinois, united states of america (common united states of america, soil, state of illinois, mollisol, silt loam, dekalb county, illinois, depth 27-56cm)2021-08-26v3No1 / 906
462amnoncommon united states of america, state of tennessee, rhizosphere, populus, tree, silt clay loam, depth 30-75cm, cultivated environment2019-01-13v4No1 / 908
103amnoncommon united states of america, river, aquatic biome, fresh water, mississippi river, particles2017-04-05v4No1 / 909
103amnoncommon united states of america, river, aquatic biome, fresh water, mississippi river, free floating2017-04-05v4No1 / 909
609sheryoCommon in soil without tobacco plants amended with difenoconazole fungicide and biochar (common soil, ph 7-8, depth 0-20cm, limestone, biochar, fungicide, china, tobacco field, difenoconazole, without plants)2020-07-05v4No1 / 910
609sheryoCommon in soil without tobacco plants amended with difenoconazole fungicide (common soil, ph 7-8, depth 0-20cm, limestone, fungicide, china, tobacco field, difenoconazole, without plants)2020-07-05v4No1 / 915
820naHigher in 0-20cm depth compared to 75-105cm depth in wheat rhizosphere haplic luvisol in germany ( high in depth 0-20cm compared to depth 75-105cm in soil rhizosphere triticum aestivum germany bonn haplic luvisol ph 6.9 campus klein-altendorf silty clay loam )2021-07-14v1No1 / 917
767sheryocommon in soil planted with Chrysanthemum, infested with fusarium in Nanjing China (common soil, fusarium, china, nanjing county, chrysanthemum, chrysanthemum morifolium ramat., ph 6.9, fusarium oxysporum f. sp. chrysanthemi)2021-04-14v4No1 / 922
548amnoncommon rock, brazil, minas gerais state, campos rupestres2019-08-17v4No1 / 924
126amnoncommon rhizosphere, hordeum vulgare, germany, winter barley2017-04-14v4No1 / 925
791sheryoHigher in low sodicity and low salinity soil compared to high sodicity and high salinity soil at 0cm depth in China ( high in low salinity low sodicity ph 8.5 compared to high salinity high sodicity ph 10.5 in soil depth 0cm china songnen plain da'an station salic solonetz )2021-06-08v4No1 / 932
359amnoncommon soil, subtropical broadleaf forest biome, topsoil, guangdong province, depth 0-10cm, woodland area, forest ecosystem, china2018-08-19v4No1 / 935
786sheryoCommon in flood plain soil near cosumnes river, california, at 166-200cm depth (common united states of america, soil, state of california, flood plain, sacramento, cosumnes river preserve, depth (soil) 166-200cm)2021-05-18v3No1 / 936
462amnoncommon united states of america, state of tennessee, soil, depth 0-30cm, silt loam, cultivated environment2019-01-13v4No1 / 938
444amnoncommon in uncultivated soil plot (common soil, nanjing city prefecture, yellow brown soil, china)2019-01-07v4No1 / 946
767sheryoCommon in soil planted with Chrysanthemum, amended with soil fumigant 'Dazomet' in Nanjing China (common soil, china, nanjing county, chrysanthemum, chrysanthemum morifolium ramat., ph 6.9, soil fumigation, dazomet)2021-04-14v4No1 / 946
37amnonlower in tomato plant leaves compared to plastic control ( high in control compared to solanum lycopersicum in leaf maryland county )2016-12-09v4No1 / 950
98amnoncommon rhizosphere, state of florida, citrus, quincy, fl, root2017-04-01v4No1 / 950
422amnoncommon soil, paddy field soil, oryza sativa, jiangsu province, cultivated environment, china2018-12-02v4No1 / 957
821sheryoCommon in soil of continuous corn field at 25-50cm depth, Michigan USA (common united states of america, soil, state of michigan, corn, continuous corn, kalamazoo loam, mesic type hapludalf, kellogg biological station, depth 25-50cm)2021-07-28v4No1 / 963
624sheryoCommon in ryegrass rhizosphere soil after 30-40 days (common soil, rhizosphere, 10 cm depth, jiangsu province, ph 7-8, china, ryegrass, days 30-40)2020-05-11v4No1 / 966
129amnoncommon soil, mexico, myrtillocactus geometrizans, opuntia robusta, cactus, semi-arid, root zone soil, ph 6-6.52017-04-15v4No1 / 968
821sheryoCommon in soil of restored prairie at 25-50cm depth, Michigan USA (common united states of america, soil, state of michigan, kalamazoo loam, mesic type hapludalf, kellogg biological station, depth 25-50cm, restored prairie)2021-07-28v4No1 / 968
480amnoncommon farm, pasture, soil, new zealand2019-02-05v4No1 / 970
134amnoncommon rhizosphere, temperate, tree, taxus, taxus mairei, northeast china, china2017-04-16v4No1 / 973
474amnoncommon farm, soil, glycine max, brazil, soybean, ph 4-6, cultivated environment2019-01-16v4No1 / 974
615amnoncommon rhizosphere, brazil, greenhouse, campinas, saccharum, sugarcane2020-04-27v4No1 / 974
821sheryoCommon in soil of switchgrass field at 25-50cm depth, Michigan USA (common united states of america, soil, state of michigan, panicum virgatum, kalamazoo loam, mesic type hapludalf, kellogg biological station, depth 25-50cm)2021-08-03v4No1 / 974
821sheryoCommon in soil of switchgrass field at 25-50cm depth, Michigan USA (common united states of america, soil, state of michigan, panicum virgatum, kalamazoo loam, mesic type hapludalf, kellogg biological station, depth 25-50cm)2021-08-03v4No1 / 974
266amnoncommon in soil from MIL garden (common united states of america, soil, state of idaho, ph 6.5)2017-12-18v4No1 / 980
675sheryoCommon in watermelon rhizosphere soil (common rhizosphere, ph 7, citrullus lanatus, china, co culture with wheat (triticum aestivum l.), un-inoculated)2028-02-22v4No1 / 980
828sheryoCommon in gleysol soil of poplar plantation at 20-30cm depth, sihong, china (common soil, jiangsu province, depth (soil) 20-30cm, clay loam, ph 6-7, gleysol, china, sihong county, poplar, poplar plantation, chenwei forest)2021-08-25v4No1 / 989
462amnoncommon united states of america, state of tennessee, rhizosphere, populus, tree, depth 0-30cm, silt loam, cultivated environment2019-01-13v4No1 / 997
610sheryoCommon in agricultural field soil amended with straw (common soil, triticum aestivum, kingdom of denmark, wheat, ph 7, agricultural field, straw)2020-04-21v3No1 / 998
809amnoncommon research facility, rhizosphere, greenhouse, china, lu'an city prefecture, dendrobium moniliforme, flowerpot2021-06-20v4No1 / 1002
479amnoncommon united states of america, rhizosphere, state of california, ph 6-7, heteromeles arbutifolia2019-02-05v4No1 / 1006
610sheryoCommon in agricultural field soil amended with low biochar (common soil, triticum aestivum, kingdom of denmark, wheat, ph 7, agricultural field, low biochar)2020-04-21v3No1 / 1009
820naCommon in top soil, 0-20cm depth, wheat rhizosphere haplic luvisol in germany (common soil, rhizosphere, triticum aestivum, germany, ph 6.5, depth 0-20cm, silt loam, bonn, haplic luvisol, campus klein-altendorf)2021-07-14v1No1 / 1011
786sheryoCommon in flood plain soil near cosumnes river, california, at 100-133cm depth (common united states of america, soil, state of california, flood plain, sacramento, cosumnes river preserve, depth (soil) 100-133cm)2021-05-18v3No1 / 1015
624sheryocommon in ryegrass rhizosphere soil amended with biochar after 30-40 days (common soil, rhizosphere, 10 cm depth, jiangsu province, ph 7-8, biochar, china, ryegrass, days 30-40)2020-05-11v4No1 / 1017
628sheryocommon in bulk soil with barley plants after 180 days in treatments amended with biochar (common soil, bulk soil, hordeum vulgare, zhejiang province, depth (soil) 15cm, ph 4-5, biochar, china, quzhou county, days 180, mature barley plants)2020-05-18v4No1 / 1023
824sheryoHigher at 20-40cm depth compared to 40-60cm depth in soil after grazing exclusion, Ningxia china ( high in depth 20-40cm compared to depth 40-60cm in soil china grazing exclusion haplic calcisol calci-orthic aridisol ningxia province yunwushan national natural grassland protection zone )2021-08-08v4No1 / 1025
266amnoncommon in soil from PAR garden (common united states of america, soil, state of idaho, ph 5.5)2017-12-18v4No1 / 1032
768sheryoCommon in maize fields in Brittany, France (common soil, cambisol, zea mays, french republic, maize field, bretagne region)2021-04-18v3No1 / 1034
791sheryoCommon at 0cm depth in low saline low sodicity soil in China (common soil, depth 0cm, low salinity, china, songnen plain, da'an station, salic solonetz, low sodicity, ph 8.5)2021-06-07v4No1 / 1035
801sheryoHigher at depth 0-15cm compared to depth 60-90cm in corn and soybean agriculture fields, Iowa USA ( high in depth 0-15cm compared to depth 60-90cm in soil zea mays glycine max iowa agricultural field united states des moines nicollet soil series kelley subsurface drainage )2021-06-16v4No1 / 1036
824sheryoHigher at 10-20cm depth compared to 20-40cm depth in soil after grazing exclusion, Ningxia china ( high in depth 10-20cm compared to depth 20-40cm in soil china grazing exclusion haplic calcisol calci-orthic aridisol ningxia province yunwushan national natural grassland protection zone )2021-08-08v4No1 / 1038
548amnoncommon rhizosphere, brazil, minas gerais state, campos rupestres, vellozia epidendroides2019-08-15v4No1 / 1040
786sheryocommon in flood plain soil near cosumnes river, california, at 0-30cm depth (common united states of america, soil, state of california, depth 0-30cm, flood plain, sacramento, cosumnes river preserve)2021-05-18v3No1 / 1048
422amnoncommon soil, paddy field soil, oryza sativa, heilongjiang province, cultivated environment, china2018-12-02v4No1 / 1049
610sheryoCommon in agricultural field soil (common soil, triticum aestivum, kingdom of denmark, wheat, ph 7, agricultural field)2020-04-21v3No1 / 1053
837sheryoCommon in soil after 10 years reforestation with Black locust trees at 100-300cm depth, shaanxi, China (common soil, silt loam, reforestation, china, shaanxi province, loess plateau, robinia pseudoacacia, depth 100-300cm, 10 years)2021-09-26v4No1 / 1061
837sheryoCommon in soil after 10 years reforestation with Black locust trees at 40-100cm depth, shaanxi, China (common soil, silt loam, reforestation, china, shaanxi province, loess plateau, robinia pseudoacacia, depth 40-100cm, 10 years)2021-09-26v4No1 / 1065
828sheryoCommon in gleysol soil of poplar plantation at 0-10cm depth, sihong, china (common soil, jiangsu province, depth 0-10cm, clay loam, ph 6-7, gleysol, china, sihong county, poplar, poplar plantation, chenwei forest)2021-08-25v4No1 / 1069
263amnoncommon in desert soil irrigated daily in lab (common research facility, soil, israel, negev desert, sandy loam soil, ph 7-8, irrigated)2017-12-11v4No1 / 1076
610sheryoCommon in agricultural field soil amended with high biochar (common soil, triticum aestivum, kingdom of denmark, wheat, ph 7, agricultural field, high biochar)2020-04-21v3No1 / 1079
347amnon high in depth (soil) 20-30cm compared to depth 100-150cm depth 150-200cm in permafrost soil kingdom of norway svalbard archipelago 2018-07-15v4No1 / 1080
252amnoncommon in river rock biofilm (common river, rock, biofilm, kingdom of spain, epilithic)2017-11-22v4No1 / 1081
478amnoncommon farm, sediment, shrimp farm, china2019-02-19v4No1 / 1085
791sheryoCommon at 40cm depth in low saline low sodicity soil in China (common soil, low salinity, china, songnen plain, da'an station, salic solonetz, low sodicity, ph 9, depth (soil) 40cm)2021-06-08v4No1 / 1085
765sheryocommon in wheat field in the loess plateau in china (common soil, triticum aestivum, silt loam, china, shanxi province, loess plateau, chromic cambisol, ph 7.7)2021-04-12v3No1 / 1087
415amnoncommon orchard, soil, rhizosphere, brazil, citrus, cultivated environment2018-11-27v4No1 / 1091
415amnoncommon orchard, soil, rhizosphere, kingdom of spain, citrus, cultivated environment2018-11-27v4No1 / 1099
801sheryoHigher at depth 0-15cm compared to depth 60-90cm in soybean and corn agriculture fields , Iowa USA ( high in depth 0-15cm compared to depth 60-90cm in soil zea mays glycine max iowa agricultural field united states ames des moines nicollet soil series )2021-06-15v4No1 / 1102
84amnoncommon peatland, soil, sphagnum bog, peat soil, temperate grassland biome, depth 5cm, wetland area2017-03-06v4No1 / 1103
414amnoncommon agricultural feature, soil, zea mays, glycine max, triticum aestivum, heilongjiang province, ph<6, black soil, mollisol, npk fertilizer, china2018-11-26v4No1 / 1105
101amnoncommon united states of america, vitis vinifera, state of new york, merlot, grapevine, root2017-04-03v4No1 / 1106
767sheryocommon in soil planted with Chrysanthemum, fertilized with bio-organic fertilizer, amended with soil fumigant 'Dazomet' and deep plough in Nanjing China (common soil, compost biofilter, pig manure, compost soil, paenibacillus, china, nanjing county, chrysanthemum, bio-organic fertilizer, conventional tillage, chrysanthemum morifolium ramat., ph 6.9, paenibacillus polymyxa, soil fumigation, dazomet, deep plough)2021-04-18v4No1 / 1109
266amnoncommon in roots in MAH garden (common united states of america, state of idaho, plant, brassicaceae, boechera stricta, root)2017-12-19v4No1 / 1110
827sheryoCommon in soil at 25cm depth in clayey till loam soil, Lund Denmark (common kingdom of denmark, depth (soil) 20-30cm, agricultural field, lund, loam soil, clayey till, late weichselian glaciation, plough layer )2021-08-24v3No1 / 1111
824sheryocommon in soil after 0-9 years of grazing exclusion at 40-60cm depth, Ningxia china (common soil, china, depth 40-60cm, grazing exclusion, haplic calcisol, calci-orthic aridisol, ningxia province, yunwushan national natural grassland protection zone, 0-9 years of grazing exclusion)2021-08-08v4No1 / 1113
698amnoncommon control, park, rhizosphere, ph 6-7, depth 0-30cm, united kingdom, quercus, oak2028-04-01v3No1 / 1115
828sheryoCommon in gleysol soil of poplar plantation at 10-20cm depth, sihong, china (common soil, jiangsu province, clay loam, ph 6-7, gleysol, china, sihong county, poplar, depth 10-20cm, poplar plantation, chenwei forest)2021-08-25v4No1 / 1123
791sheryoCommon at 80cm depth in low saline low sodicity soil in China (common soil, low salinity, china, songnen plain, da'an station, salic solonetz, low sodicity, ph 9, depth (soil) 80cm)2021-06-08v4No1 / 1128
764sheryocommon in leoss soil in wheat field grown under crop rotation with rapeseed pre-crop in germany (common soil, triticum aestivum, brassica napus, germany, ph 7.6, bernburg, crop rotation, rapeseed pre-crop)2021-04-12v3No1 / 1129
515amnon high in carabidae compared to staphylinidae in river poland whole body beetle carnivorous beetle 2019-04-19v4No1 / 1130
146amnon high in soil compared to rhizosphere in united states of america solanum lycopersicum tomato ph 6 slit loam 2017-04-20v4No1 / 1135
628sheryocommon in bulk soil with barley plants after 180 days in treatments unamended with biochar (common soil, bulk soil, hordeum vulgare, zhejiang province, depth (soil) 15cm, ph 4-5, china, quzhou county, days 180, mature barley plants)2020-05-18v4No1 / 1136
764sheryoCommon in leoss soil in wheat field grown under conservation tillage and crop rotation in germany (common soil, triticum aestivum, germany, ph 7.6, bernburg, crop rotation, conservation tillage, cultivator tillage)2021-04-12v3No1 / 1140
134amnoncommon rhizosphere, temperate, tree, taxus, taxus cuspidata, northeast china, china2017-04-16v4No1 / 1141
827sheryoCommon in soil at 95cm depth in clayey till loam soil, Lund Denmark (common kingdom of denmark, agricultural field, lund, loam soil, clayey till, late weichselian glaciation, depth 70-120cm, sandy till )2021-08-24v3No1 / 1142
146amnoncommon united states of america, soil, solanum lycopersicum, tomato, slit loam soil, ph 62017-04-20v4No1 / 1144
93amnoncommon in marine sediment near the shore in hawaii (common shore, marine sediment, hawaii)2017-03-12v4No1 / 1151
791sheryoCommon at 20cm depth in low saline low sodicity soil in China (common soil, depth 20cm, low salinity, china, songnen plain, da'an station, salic solonetz, low sodicity, ph 8.5, ph 9)2021-06-08v4No1 / 1155
236amnoncommon ocean, water, sea water, state of california, pacific ocean, bodega bay2017-11-07v4No1 / 1156
422amnoncommon soil, paddy field soil, oryza sativa, heilongjiang province, ph 7-8, cultivated environment, china2018-12-04v4No1 / 1169
746sheryoCommon in saline soil in dafeng, china (common jiangsu province, solonchak, china, dafeng city, ph 7.6, saline soil)2021-03-03v4No1 / 1170
786sheryoCommon in flood plain soil near cosumnes river, california, at 30-60cm depth (common united states of america, soil, state of california, flood plain, sacramento, cosumnes river preserve, depth (soil) 30-60cm)2021-05-18v3No1 / 1180
252amnoncommon in river sand biofilm (common river, biofilm, sand, kingdom of spain)2017-11-22v4No1 / 1181
615amnon high in rhizosphere compared to soil in brazil greenhouse campinas saccharum sugarcane 2020-04-27v4No1 / 1181
807amnon high in tropical storm compared to normal weather in surface water sea water summer near shore filtered 0.2um japan okinawa islands 2021-06-20v3No1 / 1191
628sheryocommon in rhizosphere of barley roots after 180 days in treatments amended with biochar (common soil, rhizosphere, hordeum vulgare, zhejiang province, depth (soil) 15cm, ph 4-5, biochar, china, quzhou county, days 180, mature barley plants)2020-05-18v4No1 / 1192
421amnoncommon soil, paddy field soil, zhejiang province, china2018-12-04v4No1 / 1194
718amnon high in epilimnion compared to hypolimnion in united states of america state of wisconsin meromictic lake bog lake freshwater lake ph 5.5-6 "mary lake" 2028-05-23v4No1 / 1195
823sheryoCommon at 0-15cm depth in foot slope ultisol soil in auburn, alabama (common soil, agricultural field, ultisol, auburn, alabama, depth 0-15cm, foot slope )2021-08-08v3No1 / 1199
801sheryoCommon at depth 0-15cm in corn and soybean agriculture fields, Iowa USA (common soil, zea mays, glycine max, iowa, agricultural field, united states, des moines, depth 0-15cm, nicollet soil series, kelley, ph 6.2, subsurface drainage)2021-06-15v4No1 / 1202
628sheryocommon in rhizosphere of barley roots after 180 days in treatments unamended with biochar (common soil, rhizosphere, hordeum vulgare, zhejiang province, depth (soil) 15cm, ph 4-5, china, quzhou county, days 180, mature barley plants)2020-05-18v4No1 / 1209
764sheryoCommon in leoss soil in wheat field grown under conventional tillage and crop rotation in germany (common soil, triticum aestivum, germany, ph 7.6, bernburg, loess chernozem, conventional tillage, mouldboard plough, crop rotation)2021-04-12v3No1 / 1213
823sheryoCommon at 15-30cm depth in foot slope ultisol soil in auburn, alabama (common soil, agricultural field, ultisol, auburn, alabama, depth 15-30cm, foot slope )2021-08-08v3No1 / 1218
837sheryoCommon in agricultural field at depths 100-300cm, shaanxi, China (common soil, zea mays, triticum aestivum, silt loam, agricultural field, china, shaanxi province, loess plateau, depth 100-300cm)2021-09-26v4No1 / 1220
531amnoncommon farm, greenhouse soil, rhizosphere, cucumis sativus, orthic anthrosol, cucumber, china2019-07-21v3No1 / 1223
764sheryoCommon in leoss soil in wheat field grown under crop rotation with maize pre-crop in germany (common soil, triticum aestivum, germany, ph 7.6, bernburg, crop rotation, maize pre-crop)2021-04-12v3No1 / 1225
801sheryoCommon in soybean and corn agriculture fields at depth 0-15cm, Iowa USA (common soil, zea mays, glycine max, iowa, agricultural field, united states, ames, des moines, ph 7.5, depth 0-15cm, nicollet soil series)2021-06-15v4No1 / 1226
798amnoncommon orchard, soil, italy, depth 10 cm, ph 7-8, apennine mountains, prunus armeniaca, apricot2021-06-13v3No1 / 1230
824sheryoCommon in soil after 27-35 years of grazing exclusion at 40-60cm depth, Ningxia china (common soil, china, depth 40-60cm, grazing exclusion, 27-35 years of grazing exclusion, haplic calcisol, calci-orthic aridisol, ningxia province, yunwushan national natural grassland protection zone)2021-08-08v4No1 / 1232
420amnoncommon in soil of vegetables in organic field (common agricultural feature, farm, soil, shanghai proper, ph>7, ph 7-8, clay loam, organic farming, cultivated environment, china)2018-12-02v4No1 / 1240
821sheryoCommon in soil of restored prairie at 10-25cm depth, Michigan USA (common united states of america, soil, state of michigan, kalamazoo loam, mesic type hapludalf, kellogg biological station, depth 10-25cm, restored prairie)2021-07-28v4No1 / 1241
800amnoncommon 7-18 days following heavy metal contamination (common lake, sediment, fresh water, heavy metal, reservoir, china, xiannv lake, sediment depth 0-10cm, spring)2021-06-15v4No1 / 1248
134amnoncommon rhizosphere, temperate, tree, taxus, taxus media, northeast china, china2017-04-16v4No1 / 1251
837sheryoCommon in agricultural field at depths 40-100cm, shaanxi, China (common soil, zea mays, triticum aestivum, silt loam, agricultural field, china, shaanxi province, loess plateau, depth 40-100cm)2021-09-26v4No1 / 1263
675sheryoCommon in watermelon rhizosphere soil inoculated with Fusarium oxysporum f. sp. niveum (common rhizosphere, ph 7, citrullus lanatus, china, co culture with wheat (triticum aestivum l.), inoculated with fusarium oxysporum f. sp. niveum)2028-02-22v4No1 / 1271
824sheryoCommoon in soil after 0-9 years of grazing exclusion at 20-40cm depth, Ningxia china (common soil, china, grazing exclusion, haplic calcisol, calci-orthic aridisol, ningxia province, yunwushan national natural grassland protection zone, 0-9 years of grazing exclusion, depth 20-40cm)2021-08-08v4No1 / 1274
616amnoncommon in topsoil of non-fertilized sugarcane field (common soil, topsoil, guangzhou city prefecture, non-fertilized soil, depth 0-20cm, china, saccharum, sugarcane, ph 6.7)2020-04-27v3No1 / 1277
415amnoncommon orchard, soil, rhizosphere, italy, citrus, cultivated environment2018-11-27v4No1 / 1279
788amnon high in soil compared to plant litter in united states of america state of georgia mesocosm 2021-05-31v4No1 / 1280
414amnoncommon agricultural feature, soil, zea mays, glycine max, triticum aestivum, heilongjiang province, ph>6, black soil, mollisol, china2018-11-26v4No1 / 1282
821sheryoCommon in soil of restored prairie at 0-10cm depth, Michigan USA (common united states of america, soil, state of michigan, depth 0-10cm, ph 6.5, kalamazoo loam, mesic type hapludalf, kellogg biological station, restored prairie)2021-07-28v4No1 / 1291
420amnoncommon in soil of vegetables in organic plastic tunnel (common agricultural feature, farm, soil, greenhouse soil, shanghai proper, ph>7, ph 7-8, clay loam, organic farming, cultivated environment, china)2018-12-02v4No1 / 1294
837sheryoCommon in soil at 0-40-100cm depth after 20 years reforestation with Black locust trees, shaanxi, China (common soil, silt loam, reforestation, china, shaanxi province, loess plateau, robinia pseudoacacia, depth 40-100cm, 20 years)2021-09-26v4No1 / 1294
266amnonCommon in soil from MAH garden (common united states of america, soil, state of idaho, ph 6)2017-12-18v4No1 / 1299
837sheryoCommon in soil at 40-100cm depth after 30 years reforestation with Black locust trees, shaanxi, China (common soil, silt loam, reforestation, china, shaanxi province, loess plateau, robinia pseudoacacia, depth 40-100cm, 30 years)2021-09-26v4No1 / 1311
837sheryoCommon in soil after 10 years reforestation with Black locust trees at 0-40cm depth, shaanxi, China (common soil, silt loam, reforestation, china, shaanxi province, loess plateau, robinia pseudoacacia, depth 0-40cm, 10 years)2021-09-26v4No1 / 1317
837sheryoCommon in soil at 100-300cm depth after 20 years reforestation with Black locust trees, shaanxi, China (common soil, silt loam, reforestation, china, shaanxi province, loess plateau, robinia pseudoacacia, depth 100-300cm, 20 years)2021-09-26v4No1 / 1317
309amnoncommon rhizosphere, germany, onobrychis viciifolia, common sainfoin2018-04-05v4No1 / 1323
837sheryoבCommon in soil at 0-40cm depth after 20 years reforestation with Black locust trees, shaanxi, China (common soil, silt loam, reforestation, china, shaanxi province, loess plateau, robinia pseudoacacia, depth 0-40cm, 20 years)2021-09-26v4No1 / 1323
783sheryocommon in desert soil in mongolia without water addition treatment (common soil, mongolia, sandy desert, bajada, china, dengkou county, ph 7.85, ulan buh desert, cambic arenosols, luvic gypsisols, ambient precipitation, no water addition)2021-05-11v4No1 / 1324
600sheryoCommon in biochar ammended soil after 82 days (common united states of america, soil, state of new york, depth 0-5cm, ph 6, biochar, coarse-loamy soil, day 82)2020-03-27v4No1 / 1326
600sheryoCommon in stover ammended soil after 82 days (common united states of america, soil, state of new york, depth 0-5cm, ph 6, coarse-loamy soil, day 82, stover ammendment )2020-03-27v4No1 / 1327
259amnoncommon in soil and rhizpsphere of peanut plants (common soil, rhizosphere, arachis hypogaea, ph 5, peanut, china)2017-12-02v4No1 / 1334
98amnoncommon rhizosphere, state of florida, citrus, ft. pierce, fl, root2017-04-01v4No1 / 1340
837sheryoCommon in soil at 0-40 cm depth after 30 years reforestation with Black locust trees, shaanxi, China (common soil, silt loam, reforestation, china, shaanxi province, loess plateau, robinia pseudoacacia, depth 0-40cm, 30 years)2021-09-26v4No1 / 1346
837sheryoCommon in soil at 100-300cm depth after 30 years reforestation with Black locust trees, shaanxi, China (common soil, silt loam, reforestation, china, shaanxi province, loess plateau, robinia pseudoacacia, depth 100-300cm, 30 years)2021-09-26v4No1 / 1354
809amnoncommon research facility, rhizosphere, greenhouse, china, lu'an city prefecture, dendrobium huoshanense, flowerpot2021-06-20v4No1 / 1356
808amnon high in mucosa ileal mucosa compared to digesta in research facility ileum gallus gallus germany chicken age 35 weeks hen 2021-06-20v1No1 / 1360
824sheryoCommon in soil after 27-35 years of grazing exclusion at 20-40cm depth, Ningxia china (common soil, china, grazing exclusion, 27-35 years of grazing exclusion, haplic calcisol, calci-orthic aridisol, ningxia province, yunwushan national natural grassland protection zone, depth 20-40cm)2021-08-08v4No1 / 1369
98amnoncommon rhizosphere, state of florida, citrus, gainesville, fl, root2017-04-01v4No1 / 1371
420amnoncommon in soil of vegetable open field (common agricultural feature, farm, soil, shanghai proper, ph>7, ph 7-8, npk fertilizer, clay loam, cultivated environment, china)2018-12-02v4No1 / 1376
821sheryoCommon in soil of miscanthus field at 10-25cm depth, Michigan USA (common united states of america, soil, state of michigan, miscanthus, kalamazoo loam, mesic type hapludalf, kellogg biological station, depth 10-25cm, restored prairie)2021-08-02v4No1 / 1377
821sheryoCommon in soil of continuous corn field at 0-10cm depth, Michigan USA (common united states of america, soil, state of michigan, depth 0-10cm, corn, ph 5.9, continuous corn, kalamazoo loam, mesic type hapludalf, kellogg biological station)2021-07-28v4No1 / 1380
821sheryoHigher at 0-10cm depth compared to 10-25cm depth in soil in Michigan USA ( high in depth 0-10cm compared to depth 10-25cm in united states of america soil state of michigan corn panicum virgatum miscanthus kalamazoo loam mesic type hapludalf kellogg biological station restored prairie )2021-08-05v4No1 / 1383
309amnoncommon rhizosphere, germany, plantago lanceolata, ribwort plantain2018-04-05v4No1 / 1386
821sheryoCommon in soil of switchgrass field at 10-25cm depth, Michigan USA (common united states of america, soil, state of michigan, panicum virgatum, kalamazoo loam, mesic type hapludalf, kellogg biological station, depth 10-25cm)2021-08-02v4No1 / 1387
266amnoncommon in soil from SIL garden (common united states of america, soil, state of idaho, ph 6)2017-12-18v4No1 / 1389
600sheryoCommon in unammended soil after 82 days (common united states of america, soil, state of new york, depth 0-5cm, ph 6, coarse-loamy soil, day 82)2020-03-27v4No1 / 1395
420amnonhigh freq. in soil of vegetable in plastic tunnel (common agricultural feature, farm, soil, greenhouse soil, shanghai proper, ph>7, ph 7-8, npk fertilizer, clay loam, cultivated environment, china)2018-12-02v4No1 / 1396
824sheryoCommon in soil after 0-9 years of grazing exclusion at 10-20cm depth, Ningxia china (common soil, china, grazing exclusion, haplic calcisol, calci-orthic aridisol, ningxia province, yunwushan national natural grassland protection zone, 0-9 years of grazing exclusion, depth 10-20cm)2021-08-08v4No1 / 1397
266amnoncoomon in roots in SIL garden (common united states of america, state of idaho, plant, brassicaceae, boechera stricta, root)2017-12-19v4No1 / 1399
422amnoncommon soil, paddy field soil, oryza sativa, hubei province, hunan province, cultivated environment, china2018-12-02v4No1 / 1399
76amnoncommon in non-seleniferous soil (common united states of america, soil, rhizosphere, state of florida, non-seleniferous)2017-02-28v4No1 / 1414
443amnonhigher in lower mississippi river (downstream) compared to upper mississippi river ( high in downstream lower mississippi river compared to upstream upper mississippi river in united states of america river water fresh water mississippi river particles depth 1m filtered 2.7um )2019-01-07v4No1 / 1418
40amnoncommon soil, field soil, rhizosphere, nicotiana tabacum, china2016-12-09v4No1 / 1420
462amnon high in rhizosphere compared to soil in united states of america state of tennessee populus tree cultivated environment 2019-01-12v4No1 / 1428
309amnoncommon rhizosphere, germany, geranium pratense, meadow geranium2018-04-05v4No1 / 1434
76amnoncommon in seleniferous soil (common united states of america, soil, rhizosphere, selenium, seleniferous, woodland area)2017-02-28v4No1 / 1438
444amnoncommon farm, greenhouse soil, rhizosphere, fragaria x ananassa, nanjing city prefecture, age 1 year, strawberry, yellow brown soil, cultivated environment, china2019-01-07v4No1 / 1439
783sheryocommon in desert soil in mongolia under water addition treatment (common soil, mongolia, sandy desert, bajada, china, dengkou county, ph 7.85, ulan buh desert, cambic arenosols, luvic gypsisols, water addition, 100% above ambient precipitation)2021-05-11v4No1 / 1442
821sheryoCommon in soil of miscanthus field at 0-10cm depth, Michigan USA (common united states of america, soil, state of michigan, depth 0-10cm, miscanthus, kalamazoo loam, mesic type hapludalf, kellogg biological station, restored prairie)2021-07-28v4No1 / 1447
686sheryoCommon in vanilla field soil infected with Fusarium oxysporum, fertilized with chemical fertilizer and had high Fusarium cumulative disease incidence (common wanning city, vanilla planifolia, ph 7.6, pot expreiment, soil from vanilla field, fusarium oxysporum f. sp. vanillae, chemical fertilization n,p,k, high fusarium cumulative disease incidence )2028-03-08v4No1 / 1456
271amnoncommon rhizosphere, glycine max, soybean, depth 0-20cm, china2018-01-09v4No1 / 1459
837sheryoCommon in agricultural field at depths 0-40cm, shaanxi, China (common soil, zea mays, triticum aestivum, silt loam, agricultural field, china, shaanxi province, loess plateau, depth 0-40cm)2021-09-26v4No1 / 1470
824sheryoCommon in soil after 27-35 years of grazing exclusion at 10-20cm depth, Ningxia china (common soil, china, grazing exclusion, 27-35 years of grazing exclusion, haplic calcisol, calci-orthic aridisol, ningxia province, yunwushan national natural grassland protection zone, depth 10-20cm)2021-08-08v4No1 / 1477
548amnoncommon in phosphorus impoverished soil (common soil, brazil, minas gerais state, campos rupestres, ph 3.5)2019-08-15v4No1 / 1483
760sheryoCommon in rhizosphere soil of rice plants with NPK fertilization in a long term fertilization experiment (common soil, rhizosphere, oryza sativa, hunan province, npk fertilizer, china, qiyang county, quaternary red clay, ph 5.9, npk fertilization)2021-04-06v4No1 / 1491
631sheryoCommon in maize field biochar amended rhizosphere soil (common soil, rhizosphere, maize field, biochar, china, guizhou province, kaiyang county, after 6 years, ph 7.85)2020-06-02v3No1 / 1492
760sheryoCommon in rhizosphere soil of rice plants without fertilization in a long term fertilization experiment (common soil, rhizosphere, oryza sativa, hunan province, china, qiyang county, quaternary red clay, no fertilization, ph 5.9)2021-04-06v4No1 / 1506
309amnoncommon rhizosphere, germany, red fescue grass, festuca rubra2018-04-05v4No1 / 1510
145amnoncommon united states of america, soil, rhizosphere, oryza sativa, rice, ph 5.62017-04-19v4No1 / 1515
600sheryolower in stover ammendment soil ( high in unamended soil compared to stover amended in united states of america soil state of new york depth 0-5cm ph 6 coarse-loamy soil day 82 )2020-03-27v4No1 / 1612
76amnonhigher in non-seleniferous soil compared to seleniferous soil ( high in non-seleniferous compared to selenium seleniferous in united states of america soil rhizosphere woodland area )2017-02-28v4No1 / 1621
665amnon high in inlet compared to outlet in united states of america state of california late time points biomat microbial biomat water treatment pond benthic biomat engineered wetland 2020-09-23v4No1 / 1629
631sheryocommon in maize field unamended rhizosphere soil (common soil, rhizosphere, maize field, china, guizhou province, kaiyang county, unamended soil, after 6 years, ph 7.6)2020-06-02v3No1 / 1637
608sheryoCommon in wheat field in China, amended and unamended biochar, unamended with nitrogen fertilizer (common soil, china, silty clay, triticum aestivum l. cv., xiaoyan no. 22)2020-04-20v4No1 / 1643
462amnon high in depth 0-30cm silt loam compared to silt clay loam detph 30-75cm in united states of america state of tennessee soil cultivated environment 2019-01-12v4No1 / 1648
821sheryoCommon in soil of continuous corn field at 10-25cm depth, Michigan USA (common united states of america, soil, state of michigan, corn, continuous corn, kalamazoo loam, mesic type hapludalf, kellogg biological station, depth 10-25cm)2021-07-28v4No1 / 1649
824sheryoCommon in soil after 27-35 years of grazing exclusion at 0-10cm depth, Ningxia china (common soil, depth 0-10cm, china, grazing exclusion, 27-35 years of grazing exclusion, haplic calcisol, calci-orthic aridisol, ningxia province, yunwushan national natural grassland protection zone)2021-08-08v4No1 / 1659
686sheryoCommon in vanilla field soil infected with Fusarium oxysporum, fertilized with fungal bio-fertilizer and had low Fusarium cumulative disease incidence (common wanning city, vanilla planifolia, ph 7.6, pot expreiment, soil from vanilla field, fusarium oxysporum f. sp. vanillae, low fusarium cumulative disease incidence , fungal enriched bio-fertilizer, trichoderma guizhouense njau 4742)2028-03-08v4No1 / 1661
154amnon high in control compared to uranium high uranium in sediment soil australia kakadu national park 2017-06-29v4No1 / 1663
760sheryoCommon in rhizosphere soil of rice plants with manure fertilization in a long term fertilization experiment (common soil, manured soil, rhizosphere, oryza sativa, hunan province, china, qiyang county, quaternary red clay, ph 5.9, manure fertilization)2021-04-06v4No1 / 1670
696amnon high in alycaeus jagori compared to opisthostoma concinnum plectostoma concinnum in stomach gastrointestinal system malaysia state of sabah land snail 2028-03-28v3No1 / 1672
507amnonhigher in mine tailing contaminated sediment compared to uncontaminated control ( high in contaminated sediment compared to control in lake sediment sediment canada province of british columbia quesnel lake )2019-03-17v4No1 / 1681
608sheryoCommon in wheat field in China, amended and unamended biochar, amended with nitrogen fertilizer (common soil, urea enriched soil, china, silty clay, triticum aestivum l. cv., xiaoyan no. 22)2020-04-20v4No1 / 1682
819amnon high in skin of cheek compared to scalp in homo sapiens female skin adult china age 25-45 years 2021-07-12v1No1 / 1684
696amnon high in alycaeus jagori compared to georissa georissa similis in stomach gastrointestinal system malaysia state of sabah land snail 2028-03-28v3No1 / 1698
616amnoncommon in topsoil of PK/NP/NPK/NK fertilized sugarcane field (common soil, fertilized soil, topsoil, guangzhou city prefecture, depth 0-20cm, china, saccharum, sugarcane, ph 5.5-6)2020-04-27v3No1 / 1710
155amnonhigher in tightly bound root soil compared to loose soil and bulk soil ( high in root compared to bulk soil in soil triticum aestivum wheat china )2017-07-02v4No1 / 1714
686sheryoCommon in vanilla field soil infected with Fusarium oxysporum, fertilized with bacterial bio-fertilizer and had low Fusarium cumulative disease incidence (common wanning city, vanilla planifolia, ph 7.6, pot expreiment, soil from vanilla field, fusarium oxysporum f. sp. vanillae, bacterial enriched bio-fertilizer, bacillus amyloliquefaciens w19, low fusarium cumulative disease incidence )2028-03-08v4No1 / 1726
722amnon high in sediment marine sediment sediment surface compared to surface water sea water in united states of america estuary state of new york new york city 2021-01-02v4No1 / 1736
686sheryoCommon in vanilla field soil infected with Fusarium oxysporum, fertilized with organic fertilizer and had high Fusarium cumulative disease incidence (common wanning city, vanilla planifolia, ph 7.6, pot expreiment, soil from vanilla field, fusarium oxysporum f. sp. vanillae, high fusarium cumulative disease incidence , organic fertilizer- chicken manure compost)2028-03-08v4No1 / 1765
309amnoncommon rhizosphere, germany, veronica chamaedrys, germander speedwell2018-04-05v4No1 / 1788
631sheryoCommon in maize field unamended bulk soil (common soil, bulk soil, maize field, china, guizhou province, kaiyang county, unamended soil, ph 7.9)2020-06-02v3No1 / 1814
353amnonlower in captive compared to wild caught Lissotriton vulgaris newts skin ( high in wild compared to research facility in skin adult cambridgeshire newt triturus cristatus united kingdom )2018-07-30v4No1 / 1834
631sheryocommon in maize field biochar amended bulk soil, after 6 years of biochar amended (common soil, bulk soil, maize field, biochar, china, guizhou province, kaiyang county, after 6 years, ph 8)2020-06-02v3No1 / 1872
156amnoncommon soil, rhizosphere, brassica oleracea, brassica, china2017-07-27v4No1 / 1885
296amnoncommon agricultural feature, soil, winter, wheat, depth 0-20cm, north china plain, ph>4, ph<5, china2018-02-11v4No1 / 1886
263amnonlower in heat stressed soil (65C) compared to control ( high in control compared to heat stressed soil in research facility soil israel negev desert sandy loam soil ph 7-8 irrigated )2017-12-11v4No1 / 1893
824sheryoCommon in soil after 0-9 years of grazing exclusion at 0-10cm depth, Ningxia china (common soil, depth 0-10cm, china, grazing exclusion, haplic calcisol, calci-orthic aridisol, ningxia province, yunwushan national natural grassland protection zone, 0-9 years of grazing exclusion)2021-08-08v4No1 / 1903
800amnonlower at 100-250 days compared to 7-28 days following heavy metal contamination ( high in spring compared to summer autumn in lake sediment fresh water heavy metal reservoir china xiannv lake sediment depth 0-10cm )2021-06-15v4No1 / 1962
155amnoncommon in soil tightly bound to wheat root (common soil, triticum aestivum, wheat, root, china)2017-07-02v4No1 / 1977
101amnoncommon united states of america, rhizosphere, vitis vinifera, state of new york, merlot, grapevine2017-04-03v4No1 / 1980
821sheryoCommon in soil of switchgrass field at 0-10cm depth, Michigan USA (common united states of america, soil, state of michigan, depth 0-10cm, panicum virgatum, kalamazoo loam, mesic type hapludalf, kellogg biological station)2021-08-02v4No1 / 2067
101amnon high in root compared to rhizosphere in united states of america vitis vinifera state of new york merlot grapevine 2017-04-03v4No1 / 2075
175amnoncommon in heavy metal contaminated soils in china (common soil, heavy metal, ph 7-9, china)2017-07-29v4No1 / 2133
296amnoncommon agricultural feature, soil, winter, wheat, depth 0-20cm, north china plain, ph>7, ph<8, china2018-02-11v4No1 / 2160
353amnonlower in captive compared to wild caught Lissotriton vulgaris newts skin ( high in wild compared to research facility in skin adult cambridgeshire newt lissotriton vulgaris united kingdom )2018-07-30v4No1 / 2162
296amnoncommon agricultural feature, soil, winter, wheat, depth 0-20cm, north china plain, ph>6, ph<7, china2018-02-11v4No1 / 2223
166amnoncommon in river sediment (5cm) with mussels (common united states of america, river, sediment, freshwater biome, mississippi river, depth 5cm, upper mississippi river, mussel, unionidae)2017-07-18v4No1 / 2254
296amnoncommon in wheat field soil (common agricultural feature, soil, winter, depth 5cm, wheat, north china plain, china)2018-02-11v4No1 / 2341
155amnoncommon in soil loosely bound to wheat root (common soil, rhizosphere, triticum aestivum, wheat, china)2017-07-02v4No1 / 2425
101amnoncommon united states of america, soil, vitis vinifera, state of new york, merlot, grapevine2017-04-03v4No1 / 2537
155amnoncommon in bulk soil in wheat field (common soil, bulk soil, triticum aestivum, wheat, china)2017-07-02v4No1 / 2594
296amnoncommon agricultural feature, soil, winter, wheat, depth 0-20cm, north china plain, ph>8, china2018-02-11v4No1 / 2646
271amnoncommon soil, depth 0-20cm, china2018-01-09v4No1 / 2856
84amnoncommon fen, soil, peat soil, temperate grassland biome, flooded grassland biome, depth 20 cm, united kingdom2017-03-06v4No1 / 2866
166amnoncommon in river sediment (5cm) without mussels (common united states of america, river, sediment, freshwater biome, mississippi river, depth 5cm, upper mississippi river)2017-07-18v4No1 / 2877
837sheryoHigher in soil in agricultural feild compared after 10 years reforestation with Black locust trees, shaanxi, China ( high in zea mays triticum aestivum agricultural field compared to reforestation robinia pseudoacacia 10 years in soil silt loam china shaanxi province loess plateau )2021-09-26v4No1 / 2994
618amnon high in rhizosphere compared to root endosphere root in farm canada cannabis sativa 2020-05-04v4No1 / 3134
422amnon high in ph 7-8 compared to ph 5-6 in soil paddy field soil oryza sativa heilongjiang province cultivated environment china 2018-12-04v4No1 / 3267
84amnoncommon fen, soil, peat soil, temperate grassland biome, flooded grassland biome, depth 5 cm, united kingdom2017-03-07v4No1 / 3434
296amnoncommon agricultural feature, soil, winter, wheat, depth 0-20cm, north china plain, ph>5, ph<6, china2018-02-11v4No1 / 3508
103amnonhigher in particle bound fraction compared to free floating bacteria in mississippi river ( high in particles compared to free floating in united states of america river aquatic biome fresh water mississippi river )2017-04-05v4No1 / 3559
837sheryoHigher in soil after 20 years compared to 30 years of reforestation with Black locust trees, shaanxi, China ( high in 20 years compared to 30 years in soil silt loam reforestation china shaanxi province loess plateau robinia pseudoacacia )2021-09-27v4No1 / 3893
837sheryoHigher in soil after 30 years compared to 10 years of reforestation with Black locust trees, shaanxi, China ( high in 30 years compared to 10 years in soil silt loam reforestation china shaanxi province loess plateau robinia pseudoacacia )2021-09-27v4No1 / 5245
837sheryoHigher in soil after 20 years compared to 10 years of reforestation with Black locust trees, shaanxi, China ( high in 20 years compared to 10 years in soil silt loam reforestation china shaanxi province loess plateau robinia pseudoacacia )2021-09-27v4No1 / 5270
837sheryoHigher in soil after 30 years reforestation with Black locust trees compared to agricultural feild, shaanxi, China ( high in reforestation robinia pseudoacacia 30 years compared to zea mays triticum aestivum agricultural field in soil silt loam china shaanxi province loess plateau )2021-09-27v4No1 / 5596
837sheryoHigher in soil after 20 years reforestation with Black locust trees compared agricultural feild, shaanxi, China ( high in reforestation robinia pseudoacacia 20 years compared to zea mays triticum aestivum agricultural field in soil silt loam china shaanxi province loess plateau )2021-09-26v4No1 / 5661
266amnon high in root compared to leaf in united states of america state of idaho plant brassicaceae boechera stricta 2017-12-19v4No1 / 5886

Problems / suggestions? Please email info AT dbbact DOT org