Search result for sequence:
TACGAAGGGGGCTAGCGTTGCTCGGAATCACTGGGCGTAAAGGGTGCGTAGGCGGGTTTTTAAGTCAGAGGTGAAATCCTGGAGCTCAACTCCAGAACTGCCTTTGATACTGGGAATCTTGAGTATGGAAGAGGTGAGTGGAACTGCGAG
common ontology terms
term enrichment score
TermScore
soil0.224610
rhizosphere0.180995
skin0.156315
ph 70.152866
china0.148668
wheat0.126761
agricultural field0.119760
black soil0.105960
jilin province0.105960
depth (soil) 0-20cm0.101289
water0.101266
silt loam0.094595
triticum aestivum0.093567
fresh water0.092545
leaf0.089514
greenhouse0.086331
southern united states0.086331
snake0.082759
marsh0.082759
brazil0.077170
pyrenees0.072993
foot slope 0.072993
alabama0.072993
ultisol0.072993
united states of america0.071997
ph 60.070423
auburn0.070423
river0.068027
kingdom of spain0.063158
saccharum0.060150
sugarcane0.060150
fertilized soil0.059850
cambridgeshire0.059259
populus0.059259
robinia pseudoacacia0.059259
reforestation0.059259
shaanxi province0.059259
dekalb county0.059259
illinois0.059259
newt0.057554
loess plateau0.057554
glycine max0.056738
commonwealth of virginia0.055944
mangrove0.055944
root0.054422
state of tennessee0.054422
research facility0.053686
summer0.053476
state of new york0.052288
autumn0.052288
air0.052083
cultivated environment0.050314
state of illinois0.050314
kingdom of denmark0.049080
tree0.047904
germany0.047151
qiao nature reserve0.046154
coarse-loamy soil0.045113
day 820.045113
spring water0.045113
alycaeus jagori0.045113
state of sabah0.045113
glycine soja0.045113
futian national nature reserve0.045113
state of california0.044199
depth (soil) 0-5cm0.044118
malaysia0.044118
land snail0.044118
mollisol0.044118
drinking water0.043165
mexico0.042705
whole body0.041812
body proper0.041379
gastrointestinal system0.040541
israel0.039344
LOWER IN winter0.038585
united kingdom0.035874
stomach0.033708
state of florida0.033149
ph 7-80.032609
plant0.031088
sonneratia apetala0.031008
qingdao city prefecture0.031008
veined rapa whelk0.031008
rapana venosa0.031008
LOWER IN soil0.030573
reproductive system0.030534
reproductive organ0.030534
jiulong river0.030534
lissotriton vulgaris0.030534
triturus cristatus0.030534
agave0.030534
koshi river0.030534
stem surface0.030534
upper stem0.030534
exosphere0.030534
campinas0.030534
20 years0.030534
30 years0.030534
LOWER IN 10 years0.030534
Fraction of dbbact annotations with this term covered by the query
TermScore
cuticle1.000000
chitin-based cuticle1.000000
atlantic rainforest1.000000
parque estadual serra do mar-núcleo picinguaba1.000000
odontomachus hastatus1.000000
sao paulo state1.000000
qiao nature reserve1.000000
sonneratia apetala1.000000
quaternary laterite soil1.000000
cucurbita moschata1.000000
pumpkin1.000000
fully formed stage1.000000
black soldier fly1.000000
hermetia illucens1.000000
tours1.000000
LOWER IN tonsil surface1.000000
tonsil tissue1.000000
cinnamomum camphora1.000000
anxi county1.000000
juvenile oyster containing diet1.000000
qingdao city prefecture1.000000
veined rapa whelk1.000000
rapana venosa1.000000
LOWER IN deep bay1.000000
mirs bay1.000000
saccharum0.666667
sugarcane0.666667
wheat0.600000
fertilized soil0.600000
maryland county0.500000
coffea arabica0.500000
dry processing0.500000
pseudacris crucifer0.500000
peeper0.500000
anaxyrus americanus0.500000
american toad0.500000
merlot0.500000
grapevine0.500000
distribution system0.500000
LOWER IN water treatment plant0.500000
winter barley0.500000
hedera hibernica0.500000
ivy0.500000
myrtillocactus geometrizans0.500000
opuntia robusta0.500000
root interior0.500000
reproductive system0.500000
reproductive organ0.500000
genitalia0.500000
bon portage island0.500000
oceanodroma leucorhoa0.500000
seabird0.500000
LOWER IN burrow0.500000
jiulong river0.500000
north china plain0.500000
ph>5, ph<60.500000
zoo0.500000
andrias japonicus0.500000
japanese giant salamander0.500000
LOWER IN area designated as a nature reserve0.500000
lissotriton vulgaris0.500000
cambridgeshire0.500000
triturus cristatus0.500000
guanajuato0.500000
agave0.500000
greenhouse0.500000
aechmea eurycorymbus0.500000
chlorophytum comosum0.500000
craugastor bransfordii0.500000
bransford’s litter frog0.500000
pyrenees0.500000
populus0.500000
populus deltoides0.500000
LOWER IN populus trichocarpa x deltoides0.500000
bufo bufo0.500000
common toad0.500000
stachytarpheta frantzii0.500000
purple porterweed0.500000
nida basin0.500000
herbivorous beetle0.500000
crioceris duodecimpunctata0.500000
carnivorous beetle0.500000
carabidae0.500000
LOWER IN staphylinidae0.500000
koshi river0.500000
crotalus horridus0.500000
southern united states0.500000
timber rattlesnake0.500000
agkistrodon contortrix0.500000
copperhead snake0.500000
coluber constrictor0.500000
eastern racer snake0.500000
thamnophis sirtalis0.500000
common garter snake0.500000
fossorial snake0.500000
storeria dekayi0.500000
ground snake0.500000
terrestrial snake0.500000
LOWER IN aquatic snake0.500000
minas gerais state0.500000
Fraction of annotations for the query sequences containing the term
TermScore
soil0.385827
china0.314961
united states of america0.236220
rhizosphere0.157480
skin0.125984
water0.094488
ph 70.094488
depth (soil) 0-20cm0.086614
agricultural field0.078740
wheat0.070866
fresh water0.070866
research facility0.070866
triticum aestivum0.062992
black soil0.062992
jilin province0.062992
leaf0.055118
silt loam0.055118
greenhouse0.047244
kingdom of spain0.047244
brazil0.047244
snake0.047244
southern united states0.047244
marsh0.047244
river0.039370
summer0.039370
adult0.039370
air0.039370
pyrenees0.039370
ph 60.039370
foot slope 0.039370
alabama0.039370
auburn0.039370
ultisol0.039370
commonwealth of virginia0.031496
state of new york0.031496
germany0.031496
root0.031496
LOWER IN soil0.031496
autumn0.031496
glycine max0.031496
newt0.031496
cambridgeshire0.031496
united kingdom0.031496
state of california0.031496
state of tennessee0.031496
populus0.031496
tree0.031496
cultivated environment0.031496
saccharum0.031496
sugarcane0.031496
robinia pseudoacacia0.031496
reforestation0.031496
loess plateau0.031496
shaanxi province0.031496
fertilized soil0.031496
kingdom of denmark0.031496
dekalb county0.031496
illinois0.031496
state of illinois0.031496
mangrove0.031496
drinking water0.023622
mexico0.023622
LOWER IN winter0.023622
plant0.023622
whole body0.023622
depth (soil) 0-5cm0.023622
coarse-loamy soil0.023622
day 820.023622
state of florida0.023622
spring water0.023622
israel0.023622
alycaeus jagori0.023622
state of sabah0.023622
malaysia0.023622
gastrointestinal system0.023622
stomach0.023622
land snail0.023622
glycine soja0.023622
mollisol0.023622
qiao nature reserve0.023622
ph 7-80.023622
futian national nature reserve0.023622
body proper0.023622
control0.015748
mucus0.015748
LOWER IN bulk soil0.015748
winter0.015748
dog0.015748
canis lupus familiaris0.015748
reproductive system0.015748
reproductive organ0.015748
homo sapiens0.015748
australia0.015748
depth (soil) 50cm0.015748
jiulong river0.015748
fujian province0.015748
LOWER IN dry season0.015748
wet season0.015748
LOWER IN root0.015748
lissotriton vulgaris0.015748
Exp. ID User ID Description Date Region Flag Sequences
755sheryodominant in domesticated soybean (Glycine max) rhizosphere (dominant glycine max, china, black soil, soil, rhizosphere, jilin province, ph 7)2021-03-18v3No1 / 7
755sheryodominant in wild soybean (Glycine soja) rhizosphere (dominant glycine soja, china, black soil, soil, rhizosphere, jilin province, ph 7)2021-03-18v3No1 / 7
755sheryodominant in domesticated soybean (Glycine max) rhizosphere (dominant glycine max, china, black soil, soil, rhizosphere, jilin province, ph 7)2021-03-18v3No1 / 7
755sheryodominant in wild soybean (Glycine soja) rhizosphere (dominant glycine soja, china, black soil, soil, rhizosphere, jilin province, ph 7)2021-03-18v3No1 / 7
983amnon high in tonsil tissue compared to tonsil surface in tonsil child 2-5 year-old child stage china homo sapiens 2022-12-26v3No1 / 11
231amnonlower in urine compared to genitalia in dogs ( high in reproductive system reproductive organ compared to urine in dog canis lupus familiaris united states of america )2017-11-02v4No1 / 14
499amnondominant brazil, pond, water, pond water, fresh water2019-03-05v4No1 / 16
403amnondominant air, kingdom of spain, pyrenees, autumn2018-11-18v4No1 / 18
403amnondominant air, kingdom of spain, pyrenees, summer2018-11-18v4No1 / 22
129amnonfound INSIDE roots of cactus (common mexico, myrtillocactus geometrizans, opuntia robusta, cactus, semi-arid, root interior, root)2017-04-15v4No1 / 29
610sheryoHigher in agricultural field soil amended with straw ( high in soil amended with straw compared to soil unamended with straw in triticum aestivum ph 7 wheat kingdom of denmark agricultural field soil )2020-04-21v3No1 / 34
403amnoncommon air, kingdom of spain, pyrenees, autumn2018-11-18v4No1 / 36
403amnoncommon air, kingdom of spain, pyrenees, summer2018-11-18v4No1 / 39
501amnoncommon costa rica, flower, nectar, stachytarpheta frantzii, purple porterweed2019-03-08v4No1 / 40
763amnon high in depth 20-100cm subsurface compared to depth 0-20cm surface in filtered 0.2um ice glacier sweden 2021-04-10v3No1 / 42
231amnoncommon in dog genitalia (common dog, canis lupus familiaris, united states of america, reproductive system, reproductive organ, genitalia)2017-11-02v4No1 / 43
818amnoncommon ileum, intestinal contents, digesta, female organism, research facility, china, age 60 weeks, hen, gallus gallus, chicken2021-07-10v3No1 / 45
109amnon high in distribution system compared to water treatment plant in water drinking water united states of america site d 2017-04-08v4No1 / 46
536amnoncommon snake, skin, united states of america, southern united states, coluber constrictor, eastern racer snake2019-07-28v4No1 / 64
403amnon high in summer compared to winter in air kingdom of spain pyrenees autumn 2018-11-18v4No1 / 67
727amnoncommon ixodes ricinus, body proper, whole body, la rioja province, kingdom of spain, tick2021-01-03v3No1 / 69
696amnoncommon alycaeus jagori, state of sabah, malaysia, gastrointestinal system, stomach, land snail2028-03-27v3No1 / 74
662amnoncommon tap water, drinking water, water, israel2020-09-20v3No1 / 89
662amnon high in drinking water tap water compared to treated wastewater wastewater treatment plant in water israel 2020-09-20v3No1 / 89
536amnoncommon crotalus horridus, snake, skin, united states of america, southern united states, timber rattlesnake2019-07-28v4No1 / 101
536amnoncommon snake, skin, united states of america, southern united states, fossorial snake, storeria dekayi, ground snake2019-07-28v4No1 / 101
536amnoncommon snake, skin, united states of america, southern united states, thamnophis sirtalis, common garter snake2019-07-28v4No1 / 110
492amnoncommon skin, adult, germany, bufo bufo, toad, common toad2019-02-27v4No1 / 115
361amnoncommon leaf, austria, greenhouse, plant, aechmea eurycorymbus2018-08-21v4No1 / 117
67amnoncommon in dry processing of coffee beans (common coffea arabica, dry processing, ecuador)2017-02-19v4No1 / 126
615amnoncommon stem surface, upper stem, stem, exosphere, saccharum, sugarcane, campinas, brazil, greenhouse2020-04-27v4No1 / 129
893amnoncommon silty clay loam, raphanus sativus, greenhouse, radish, commonwealth of virginia, rhizosphere, fertilized soil, research facility, united states of america2022-04-11v4No1 / 140
615amnon high in stem surface upper stem stem compared to leaf surface leaf in exosphere saccharum sugarcane campinas brazil greenhouse 2020-04-27v4No1 / 143
515amnoncommon poland, whole body, beetle, plant, nida basin, herbivorous beetle, crioceris duodecimpunctata2019-04-18v4No1 / 157
374amnoncommon skin, costa rica, amphibia, craugastor bransfordii, bransford’s litter frog, frog2018-09-09v4No1 / 171
534amnoncommon river, water, fresh water, depth (water) 10cm, koshi river, nepal, free floating, filtered 0.2um2019-07-22v4No1 / 172
99amnoncommon commonwealth of virginia, united states of america, skin, mucus, anaxyrus americanus, american toad2017-04-02v4No1 / 176
990amnoncommon control diet, qingdao city prefecture, research facility, china, larval stage, body proper, veined rapa whelk, rapana venosa2022-12-26v3No1 / 187
761sheryoHigher in maize rhizosphere compared to bulk soil in sandy soil maize field in Germany ( high in rhizosphere compared to bulk soil in ph 5 lower saxony sandy soil germany maize field )2021-04-06v3No1 / 200
787amnonhigher in excess grain induced rumen acidosis compared to healthy controls ( high in subacute rumen acidosis acidosis compared to control in dairy goat shanxi province rumen ruminal fluid research facility china goat capra hircus )2021-05-23v3No1 / 207
755sheryocommon in wild soybean (Glycine soja) rhizosphere (common ph 7, jilin province, rhizosphere, soil, black soil, china, glycine soja)2021-03-18v3No1 / 210
587amnoncommon israel, food product type, alfalfa sprouts, medicago sativa, producer c22020-02-10v3No1 / 215
499amnoncommon brazil, pond, water, pond water, fresh water2019-03-05v4No1 / 228
755sheryocommon in domesticated soybean (Glycine max) rhizosphere (common glycine max, china, black soil, soil, rhizosphere, jilin province, ph 7)2021-03-18v3No1 / 234
536amnoncommon snake, skin, united states of america, southern united states, agkistrodon contortrix, copperhead snake2019-07-28v4No1 / 236
951amnon high in mirs bay compared to deep bay in depth (water) 20-100cm coast china surface water sea water 2022-12-08v3No1 / 236
990amnoncommon juvenile oyster containing diet, qingdao city prefecture, research facility, china, larval stage, body proper, veined rapa whelk, rapana venosa2022-12-26v3No1 / 246
101amnon high in soil compared to rhizosphere in state of new york vitis vinifera united states of america merlot grapevine 2017-04-03v4No1 / 249
600sheryohigher in biochar ammendment soil ( high in biochar compared to unamended in depth (soil) 0-5cm state of new york soil united states of america coarse-loamy soil ph 6 day 82 )2020-03-27v4No1 / 252
361amnoncommon leaf, austria, greenhouse, plant, chlorophytum comosum2018-08-21v4No1 / 270
948amnon high in fully formed stage compared to larva larval stage in black soldier fly hermetia illucens research facility tours french republic 2022-12-05v3No1 / 272
237amnonlower in burrow soil compared to bird ( high in oceanodroma leucorhoa bird seabird compared to soil burrow in canada bon portage island )2017-11-07v4No1 / 298
534amnoncommon river, water, fresh water, depth (water) 10cm, koshi river, nepal, particle bound, filtered 2.7um2019-07-22v4No1 / 315
338amnonlower in wild salamanders compared to zoo grown salamanders ( high in zoological garden zoo compared to pond area designated as a nature reserve in skin andrias japonicus japanese giant salamander japan )2018-05-21v4No1 / 334
932amnon high in cuticle chitin-based cuticle compared to stomach gaster in atlantic rainforest parque estadual serra do mar-núcleo picinguaba odontomachus hastatus sao paulo state ant brazil tropical moist broadleaf forest biome 2022-08-30v4No1 / 334
855sheryoHigher in soil depth of 175cm compared to soil depth of 75cm in fertilized soil in china ( high in depth 175cm compared to depth 75cm in luancheng county china agricultural field fertilized soil soil )2021-12-27v3No1 / 334
175amnonhigher in winter compared to summer in heavy metal contaminated soils in china ( high in winter compared to summer in soil heavy metal china )2017-07-29v4No1 / 337
612amnoncommon state of florida, united states of america, spring water, water, fresh water, location 52020-04-22v4No1 / 383
755sheryocommon in domesticated rice (Oryza stavia) rhizosphere (common oryza sativa, ph 7, jilin province, rhizosphere, soil, black soil, china)2021-03-18v3No1 / 415
353amnoncommon in wild Lissotriton vulgaris newts skin (common newt, adult, skin, lissotriton vulgaris, cambridgeshire, united kingdom)2018-07-30v4No1 / 418
612amnoncommon state of florida, united states of america, spring water, water, fresh water, location 32020-04-22v4No1 / 420
99amnoncommon commonwealth of virginia, united states of america, skin, mucus, pseudacris crucifer, peeper2017-04-02v4No1 / 438
758amnon high in cheyenne menthol box cigar cheyenne full flavor cigar compared to swisher sweets sweet cherry cigar swisher sweets original cigar in tobacco nicotiana tabacum cigar 2021-03-28v3No1 / 452
353amnoncommon in wild Triturus cristatus newts skin (common newt, adult, skin, cambridgeshire, triturus cristatus, united kingdom)2018-07-30v4No1 / 456
610sheryoCommon in agricultural field soil amended with straw (common straw, triticum aestivum, ph 7, wheat, kingdom of denmark, agricultural field, soil)2020-04-21v3No2 / 998
989amnoncommon rhizosphere, depth (soil) 0-20cm, cinnamomum camphora, anxi county, ph 4-5, farm, china2022-12-26v3No1 / 476
786sheryoCommon in flood plain soil near cosumnes river, california, at 400-700cm depth (common depth (soil) 400-700cm, flood plain, soil, united states of america, state of california, sacramento, cosumnes river preserve)2021-05-18v3No1 / 481
617amnonlower in cow milk of cows in alpine pasture compared to lowland farm ( high in lowland farm lowland pasture compared to alpine pasture alpine in farm italy cow milk (raw) cow milk (fluid) milk )2020-05-03v3No1 / 484
755sheryocommon in wild rice (Oryza rufipogon) rhizosphere (common oryza rufipogon, ph 7, jilin province, rhizosphere, soil, black soil, china)2021-03-18v3No1 / 530
462amnon high in populus deltoides compared to populus trichocarpa x deltoides in united states of america state of tennessee populus tree leaf cultivated environment 2019-01-13v4No1 / 559
600sheryohigher in stover ammendment soil ( high in stover amended soil compared to unamended soil in depth (soil) 0-5cm state of new york soil united states of america coarse-loamy soil ph 6 day 82 )2020-03-27v4No1 / 567
254amnon high in summer wet season autumn compared to winter dry season in river water fresh water depth (soil) 50cm jiulong river fujian province china 2017-11-23v4No1 / 571
548amnoncommon minas gerais state, campos rupestres, brazil, barbacenia macrantha, root endosphere, root2019-08-17v4No1 / 575
254amnon high in summer wet season compared to winter dry season autumn in river water fresh water depth (soil) 50cm jiulong river fujian province china 2017-11-23v4No1 / 581
536amnon high in terrestrial snake compared to aquatic snake in snake skin united states of america southern united states 2019-07-28v4No1 / 590
360amnon high in rhizosphere agave compared to soil in desert mexico state of california 2018-08-21v4No1 / 593
893amnon high in silty clay loam compared to sandy loam in research facility greenhouse raphanus sativus radish fertilized soil commonwealth of virginia united states of america rhizosphere 2022-04-11v4No1 / 605
829sheryoHigher in soil depth of 0-56cm compared to soil depth of 56-140cm in Mollisol soil, Dekalb, Illinois, united states of america ( high in depth 0-56 compared to depth 56-140 in united states of america soil silt loam mollisol state of illinois illinois dekalb county )2021-08-26v3No1 / 631
360amnonhigher in leaf surface compared to soil in agave plants ( high in leaf leaf surface compared to soil in desert state of california mexico guanajuato agave )2018-08-21v4No1 / 645
612amnoncommon state of florida, united states of america, spring water, water, fresh water, location 42020-04-22v4No1 / 655
128amnoncommon hedera hibernica, belgium, ivy, leaf, forest ecosystem2017-04-14v4No1 / 693
232amnonlower in diabetec patient foot skin compared to healthy controls ( high in control compared to diabetes mellitus in homo sapiens skin australia foot )2017-11-05v4No1 / 708
752sheryoCommon in soil planted with Panax notoginseng (common panax notoginseng, sanqi plants, ph 6, xundian county, yunnan province, china, pot expreiment, soil)2021-03-11v3No1 / 730
761sheryoCommon in maize rhizosphere sandy soil maize field in Germany (common zea mays, rhizosphere, ph 5, lower saxony, sandy soil, germany, maize field)2021-04-06v3No1 / 742
829sheryoCommon in soil depth of 44-108cm in Alfisol soil, Dekalb, Illinois, united states of america (common depth 44-108cm, sandy loam, sandy loam soil, hapludalf, alfisol, united states of america, soil, state of illinois, illinois, dekalb county)2021-08-26v3No1 / 751
823sheryoCommon at 30-50cm depth in foot slope ultisol soil in auburn, alabama (common depth 30-50cm, foot slope , alabama, auburn, ultisol, agricultural field, soil)2021-08-08v3No1 / 753
752sheryoCommon in soil planted with Panax notoginseng amended with2% biochar (common biochar, panax notoginseng, sanqi plants, ph 6, xundian county, yunnan province, china, pot expreiment, soil)2021-03-11v3No1 / 783
829sheryoCommon in soil depth of 0-27cm in Mollisol soil, Dekalb, Illinois, united states of america (common depth 0-27cm, dekalb county, illinois, state of illinois, mollisol, silt loam, soil, united states of america)2021-08-26v3No1 / 798
823sheryoCommon at 50-90cm depth in foot slope ultisol soil in auburn, alabama (common depth 50-90cm, foot slope , alabama, auburn, ultisol, agricultural field, soil)2021-08-08v3No1 / 815
462amnon high in leaf compared to stem in united states of america state of tennessee populus tree cultivated environment 2019-01-13v4No1 / 890
829sheryoCommon in soil depth of 27-56cm in Mollisol soil, Dekalb, Illinois, united states of america (common depth 27-56cm, united states of america, soil, silt loam, mollisol, state of illinois, illinois, dekalb county)2021-08-26v3No1 / 906
126amnoncommon rhizosphere, germany, hordeum vulgare, winter barley2017-04-14v4No1 / 925
786sheryoCommon in flood plain soil near cosumnes river, california, at 166-200cm depth (common depth (soil) 166-200cm, flood plain, soil, united states of america, state of california, sacramento, cosumnes river preserve)2021-05-18v3No1 / 936
37amnonlower in tomato plant leaves compared to plastic control ( high in control compared to solanum lycopersicum in maryland county leaf )2016-12-09v4No1 / 950
823sheryoHigher at 15-30cm depth compared to 50-90cm depth in foot slope ultisol soil in auburn, alabama ( high in depth (soil) 15-30cm compared to depth 50-90cm in foot slope alabama auburn ultisol agricultural field soil )2021-08-08v3No1 / 968
933amnoncommon guangxi zhuang autonomous region, ph 5.5, quaternary laterite soil, research facility, china, cucurbita moschata, pumpkin, rhizosphere2022-09-11v3No1 / 1002
610sheryoCommon in agricultural field soil amended with high biochar (common soil, agricultural field, kingdom of denmark, wheat, ph 7, high biochar, triticum aestivum)2020-04-21v3No1 / 1079
905amnon high in ileum jejunum compared to feces colon caecum in western australia sheep age 1 year australia ovis aries research facility 2022-05-18v3No1 / 1092
917amnoncommon qiao nature reserve, depth (soil) 0-20cm, sonneratia apetala, china, marsh, mangrove, ph 7-8, soil2022-07-08v3No1 / 1107
515amnon high in carabidae compared to staphylinidae in whole body beetle carnivorous beetle river poland 2019-04-19v4No1 / 1130
917amnoncommon ph 7-8, futian national nature reserve, depth (soil) 0-20cm, kandelia candel, china, marsh, mangrove, soil2022-07-08v3No1 / 1197
823sheryoCommon at 0-15cm depth in foot slope ultisol soil in auburn, alabama (common foot slope , depth (soil) 0-15cm, alabama, auburn, ultisol, agricultural field, soil)2021-08-08v3No1 / 1199
917amnoncommon qiao nature reserve, depth (soil) 0-20cm, china, mudflat, marsh, ph 7-8, soil, saline marsh2022-07-08v3No1 / 1211
823sheryoCommon at 15-30cm depth in foot slope ultisol soil in auburn, alabama (common depth (soil) 15-30cm, foot slope , alabama, auburn, ultisol, agricultural field, soil)2021-08-08v3No1 / 1218
616amnoncommon in topsoil of non-fertilized sugarcane field (common depth (soil) 0-20cm, ph 6.7, sugarcane, saccharum, soil, topsoil, china, guangzhou city prefecture, non-fertilized soil)2020-04-27v3No1 / 1277
917amnoncommon ph 6-6.5, futian national nature reserve, depth (soil) 0-20cm, china, mudflat, marsh, soil, saline marsh2022-07-08v3No1 / 1290
600sheryoCommon in stover ammended soil after 82 days (common depth (soil) 0-5cm, state of new york, soil, united states of america, coarse-loamy soil, ph 6, day 82, stover ammendment )2020-03-27v4No1 / 1327
917amnoncommon ph 6-6.5, kandelia candel, depth (soil) 0-20cm, marsh, china, qiao nature reserve, mangrove, soil2022-07-08v3No1 / 1364
917amnoncommon ph 6-7, depth (soil) 0-20cm, futian national nature reserve, sonneratia apetala, china, marsh, mangrove, soil2022-07-08v3No1 / 1379
462amnon high in rhizosphere compared to soil in united states of america state of tennessee populus tree cultivated environment 2019-01-12v4No1 / 1428
696amnon high in alycaeus jagori compared to opisthostoma concinnum plectostoma concinnum in land snail stomach gastrointestinal system malaysia state of sabah 2028-03-28v3No1 / 1672
696amnon high in alycaeus jagori compared to georissa similis georissa in land snail stomach gastrointestinal system malaysia state of sabah 2028-03-28v3No1 / 1698
616amnoncommon in topsoil of PK/NP/NPK/NK fertilized sugarcane field (common depth (soil) 0-20cm, fertilized soil, ph 5.5-6, sugarcane, saccharum, soil, topsoil, china, guangzhou city prefecture)2020-04-27v3No1 / 1710
155amnonhigher in tightly bound root soil compared to loose soil and bulk soil ( high in root compared to bulk soil in triticum aestivum wheat soil china )2017-07-02v4No1 / 1714
353amnonlower in captive compared to wild caught Lissotriton vulgaris newts skin ( high in wild compared to research facility in newt adult skin cambridgeshire triturus cristatus united kingdom )2018-07-30v4No1 / 1834
155amnoncommon in soil tightly bound to wheat root (common triticum aestivum, wheat, soil, root, china)2017-07-02v4No1 / 1977
353amnonlower in captive compared to wild caught Lissotriton vulgaris newts skin ( high in wild compared to research facility in newt adult skin cambridgeshire lissotriton vulgaris united kingdom )2018-07-30v4No1 / 2162
155amnoncommon in soil loosely bound to wheat root (common triticum aestivum, wheat, soil, rhizosphere, china)2017-07-02v4No1 / 2425
155amnoncommon in bulk soil in wheat field (common triticum aestivum, wheat, soil, bulk soil, china)2017-07-02v4No1 / 2594
296amnoncommon depth (soil) 0-20cm, soil, north china plain, agricultural feature, wheat, winter, ph>5, ph<6, china2018-02-11v4No1 / 3508
462amnon high in rhizosphere compared to root in united states of america state of tennessee populus tree cultivated environment 2019-01-13v4No1 / 4630
837sheryoHigher in soil after 30 years compared to 10 years of reforestation with Black locust trees, shaanxi, China ( high in 30 years compared to 10 years in robinia pseudoacacia reforestation silt loam china loess plateau shaanxi province soil )2021-09-27v4No1 / 5245
837sheryoHigher in soil after 20 years compared to 10 years of reforestation with Black locust trees, shaanxi, China ( high in 20 years compared to 10 years in robinia pseudoacacia reforestation silt loam china loess plateau shaanxi province soil )2021-09-27v4No1 / 5270
837sheryoHigher in soil after 30 years reforestation with Black locust trees compared to agricultural feild, shaanxi, China ( high in robinia pseudoacacia reforestation 30 years compared to zea mays triticum aestivum agricultural field in silt loam china loess plateau shaanxi province soil )2021-09-27v4No1 / 5596
837sheryoHigher in soil after 20 years reforestation with Black locust trees compared agricultural feild, shaanxi, China ( high in robinia pseudoacacia reforestation 20 years compared to triticum aestivum zea mays agricultural field in silt loam china loess plateau shaanxi province soil )2021-09-26v4No1 / 5661
271amnon high in soil rhizosphere compared to root structure root in depth (soil) 0-20cm glycine max soybean china 2018-01-09v4No1 / 7954

Problems / suggestions? Please email info AT dbbact DOT org