Search result for sequence:
TACGAAGGGGGCTAGCGTTGCTCGGAATCACTGGGCGTAAAGGGTGCGTAGGCGGGTTTTTAAGTCAGGGGTGAAATCCTGGAGCTCAACTCCAGAACTGCCTTTGATACTGAAGATCTTGAGTCCGGGAGAGGTGAGTGGAACTGCGAG
common ontology terms
term enrichment score
TermScore
soil0.409767
rhizosphere0.374231
china0.226060
cultivated environment0.213333
oryza sativa0.140187
united states of america0.113991
citrus0.112676
brazil0.100587
depth (soil) 0-20cm0.096998
black soil0.096154
skin0.091954
ph 70.091743
triticum aestivum0.090703
root0.089686
research facility0.088420
greenhouse0.085308
agricultural field0.081818
glycine max0.078355
paddy field soil0.078049
mexico0.077088
orchard0.076555
jilin province0.073733
saccharum0.068796
sugarcane0.068796
farm0.068002
germany0.067925
leaf0.064368
costa rica0.063348
zhejiang province0.063348
water0.061644
state of california0.060377
state of florida0.059574
ph 60.058537
silt loam0.058537
hunan province0.057971
zea mays0.057692
marsh0.056872
state of tennessee0.053812
fresh water0.050420
heilongjiang province0.049875
mollisol0.049875
rice0.049261
guanajuato0.049261
campinas0.049261
pot expreiment0.049261
taihu lake0.049261
taihu national park0.049261
foot slope 0.049261
alabama0.049261
ultisol0.049261
auburn0.048077
topsoil0.046404
larval stage0.046225
lake sediment0.045872
ph 4-50.044346
desert0.042918
depth (water) 20-100cm0.041152
ph 6-6.50.040609
myrtillocactus geometrizans0.039801
opuntia robusta0.039801
populus0.039801
minas gerais state0.039801
campos rupestres0.039801
mature barley plants0.039801
days 1800.039801
quzhou county0.039801
dekalb county0.039801
illinois0.039801
bonn0.039801
campus klein-altendorf0.039801
ph 50.039409
cactus0.039024
semi-arid0.039024
hordeum vulgare0.039024
age 25-45 years0.039024
haplic luvisol0.039024
river0.038278
drinking water0.038278
frog0.038278
depth (soil) 15cm0.038278
mangrove0.038278
ph 6-70.037736
canis lupus familiaris0.037665
depth (soil) 0-10cm0.036530
state of illinois0.035556
stomach0.035242
ph 7-80.034632
tree0.034335
amphibia0.030651
qiao nature reserve0.030612
yunnan province0.030380
depth 5cm0.030303
fertilized soil0.030303
tomato0.030151
agave0.030151
yellow brown soil0.030151
barbacenia macrantha0.030151
endosphere0.030151
wanning city0.030151
vanilla planifolia0.030151
Fraction of dbbact annotations with this term covered by the query
TermScore
ph 6-6.51.000000
qiao nature reserve1.000000
sonneratia apetala1.000000
quaternary laterite soil1.000000
cucurbita moschata1.000000
pumpkin1.000000
fully formed stage1.000000
black soldier fly1.000000
hermetia illucens1.000000
tours1.000000
LOWER IN tonsil surface1.000000
tonsil tissue1.000000
cinnamomum camphora1.000000
anxi county1.000000
juvenile oyster containing diet1.000000
qingdao city prefecture1.000000
veined rapa whelk1.000000
rapana venosa1.000000
coventry1.000000
cultivated environment0.750000
oryza sativa0.714286
glycine max0.714286
LOWER IN ph<60.666667
non-fertilized soil0.666667
soybean0.666667
heilongjiang province0.666667
black soil0.666667
mollisol0.666667
paddy field soil0.666667
yunnan province0.666667
saccharum0.666667
sugarcane0.666667
depth (soil) 0-15cm0.666667
sandy loam0.666667
depth 5cm0.600000
citrus0.600000
fertilized soil0.600000
rhizosphere0.510638
maryland county0.500000
temperate grassland biome0.500000
flooded grassland biome0.500000
vero beach, fl0.500000
quincy, fl0.500000
immokalee, fl0.500000
ft. pierce, fl0.500000
central park0.500000
mississippi river0.500000
myrtillocactus geometrizans0.500000
opuntia robusta0.500000
root zone soil0.500000
polymetallic nodule0.500000
rice0.500000
tomato0.500000
slit loam soil0.500000
ph 60.500000
slit loam0.500000
phyllosphere0.500000
age <=24 hours0.500000
LOWER IN age &gt;= 7 days0.500000
reproductive system0.500000
reproductive organ0.500000
genitalia0.500000
jiulong river0.500000
arachis hypogaea0.500000
peanut0.500000
sea urchin0.500000
artificial seawater0.500000
moist tropical forest0.500000
ph>4.50.500000
LOWER IN ph&lt;4.50.500000
montane forest0.500000
savanna0.500000
agave0.500000
agave salmiana0.500000
guanajuato0.500000
agave tequiliana0.500000
rhaebo haematiticus0.500000
truando toad0.500000
oophaga pumilio0.500000
strawberry poison frog0.500000
craugastor fitzingeri0.500000
common rain frog0.500000
craugastor bransfordii0.500000
bransford’s litter frog0.500000
pseudomyrmex spinicola0.500000
pseudomyrmex simplex0.500000
red soil0.500000
orchard0.500000
reunion island0.500000
LOWER IN mediterranean0.500000
fragaria x ananassa0.500000
strawberry0.500000
yellow brown soil0.500000
LOWER IN age 10 years0.500000
LOWER IN continuous cropping0.500000
depth 30-75cm0.500000
silt clay loam0.500000
silt loam0.500000
populus0.500000
populus trichocarpa x deltoides0.500000
Fraction of annotations for the query sequences containing the term
TermScore
soil0.481865
china0.373057
rhizosphere0.295337
united states of america0.217617
cultivated environment0.124352
research facility0.098446
oryza sativa0.077720
depth (soil) 0-20cm0.072539
citrus0.062176
skin0.062176
brazil0.062176
root0.051813
triticum aestivum0.051813
black soil0.051813
ph 70.051813
mexico0.046632
water0.046632
greenhouse0.046632
agricultural field0.046632
germany0.046632
state of california0.041451
glycine max0.041451
orchard0.041451
paddy field soil0.041451
farm0.041451
jilin province0.041451
leaf0.036269
state of florida0.036269
homo sapiens0.036269
costa rica0.036269
zhejiang province0.036269
saccharum0.036269
sugarcane0.036269
fresh water0.031088
ph 60.031088
hunan province0.031088
zea mays0.031088
state of tennessee0.031088
silt loam0.031088
marsh0.031088
canis lupus familiaris0.025907
rice0.025907
topsoil0.025907
desert0.025907
guanajuato0.025907
larval stage0.025907
heilongjiang province0.025907
mollisol0.025907
adult0.025907
campinas0.025907
ph 4-50.025907
pot expreiment0.025907
taihu lake0.025907
taihu national park0.025907
depth (water) 20-100cm0.025907
lake sediment0.025907
foot slope 0.025907
alabama0.025907
auburn0.025907
ultisol0.025907
ph 6-70.020725
river0.020725
myrtillocactus geometrizans0.020725
opuntia robusta0.020725
cactus0.020725
semi-arid0.020725
ph 6-6.50.020725
drinking water0.020725
ph 50.020725
depth (soil) 0-10cm0.020725
amphibia0.020725
frog0.020725
stomach0.020725
ph 7-80.020725
populus0.020725
tree0.020725
minas gerais state0.020725
campos rupestres0.020725
mature barley plants0.020725
days 1800.020725
hordeum vulgare0.020725
depth (soil) 15cm0.020725
quzhou county0.020725
dekalb county0.020725
illinois0.020725
state of illinois0.020725
mangrove0.020725
age 25-45 years0.020725
female0.020725
haplic luvisol0.020725
bonn0.020725
campus klein-altendorf0.020725
beagle dog0.015544
depth 5cm0.015544
solanum lycopersicum0.015544
tomato0.015544
LOWER IN rhizosphere0.015544
woodland area0.015544
forest ecosystem0.015544
agave0.015544
Exp. ID User ID Description Date Region Flag Sequences
755sheryodominant in domesticated soybean (Glycine max) rhizosphere (dominant glycine max, china, black soil, soil, rhizosphere, jilin province, ph 7)2021-03-18v3No1 / 7
755sheryodominant in wild soybean (Glycine soja) rhizosphere (dominant glycine soja, china, black soil, soil, rhizosphere, jilin province, ph 7)2021-03-18v3No1 / 7
755sheryodominant in domesticated soybean (Glycine max) rhizosphere (dominant glycine max, china, black soil, soil, rhizosphere, jilin province, ph 7)2021-03-18v3No1 / 7
755sheryodominant in wild soybean (Glycine soja) rhizosphere (dominant glycine soja, china, black soil, soil, rhizosphere, jilin province, ph 7)2021-03-18v3No1 / 7
983amnon high in tonsil tissue compared to tonsil surface in tonsil child 2-5 year-old child stage china homo sapiens 2022-12-26v3No1 / 11
408amnondominant ant, costa rica, united states of america, crematogaster, stomach2018-11-22v4No1 / 13
621amnondominant tick, ixodes antechini, body proper, whole body, australia2020-05-07v1No1 / 16
408amnoncommon ant, costa rica, united states of america, larval stage, pseudomyrmex simplex2018-11-22v4No1 / 23
763amnon high in depth 20-100cm subsurface compared to depth 0-20cm surface in filtered 0.2um ice glacier sweden 2021-04-10v3No1 / 42
231amnoncommon in dog genitalia (common dog, canis lupus familiaris, united states of america, reproductive system, reproductive organ, genitalia)2017-11-02v4No1 / 43
69amnoncommon canis lupus familiaris, beagle dog, united states of america, research facility, bronchoalveolar lavage2017-02-21v4No1 / 44
818amnoncommon ileum, intestinal contents, digesta, female organism, research facility, china, age 60 weeks, hen, gallus gallus, chicken2021-07-10v3No1 / 45
894amnoncommon orchard, zhejiang province, china, citrus unshiu, citrus, leaf, endosphere2022-04-11v4No1 / 47
374amnoncommon skin, costa rica, amphibia, oophaga pumilio, strawberry poison frog, frog2018-09-09v4No1 / 61
819amnoncommon dalian city prefecture, skin of cheek, age 25-45 years, china, adult, skin, female, homo sapiens2021-07-12v1No1 / 61
231amnoncommon in dog urine (common dog, canis lupus familiaris, united states of america, urine)2017-11-02v4No1 / 69
696amnoncommon alycaeus jagori, state of sabah, malaysia, gastrointestinal system, stomach, land snail2028-03-27v3No1 / 74
69amnoncommon canis lupus familiaris, beagle dog, united states of america, research facility, nasal cavity, mucus2017-02-21v4No1 / 77
819amnoncommon skin of cheek, baoding city prefecture, age 25-45 years, china, adult, skin, female, homo sapiens2021-07-12v1No1 / 77
227amnonhiger in first 24hrs compared to later timepoints in baby nasopharynx ( high in newborn human stage age age <=24 hours compared to newborn human stage age >= 7 days in homo sapiens nasopharynx nasal cavity infant kingdom of the netherlands )2017-10-30v4No1 / 85
662amnoncommon tap water, drinking water, water, israel2020-09-20v3No1 / 89
662amnon high in drinking water tap water compared to treated wastewater wastewater treatment plant in water israel 2020-09-20v3No1 / 89
360amnoncommon desert, soil, rhizosphere, agave, mexico, guanajuato, agave tequiliana, cultivated environment2018-08-21v4No1 / 98
499amnoncommon digestive system, pond, intestine, brazil, remartinia, aeshnidae, dragonfly, larval stage2019-03-05v4No1 / 104
374amnoncommon skin, costa rica, amphibia, rhaebo haematiticus, truando toad, toad2018-09-09v4No1 / 121
548amnoncommon minas gerais state, campos rupestres, brazil, barbacenia macrantha, stem, stem endosphere2019-08-17v4No1 / 123
100amnon high in ph 6-7 ph compared to ph<6 ph>7 in soil urban biome park new york city central park 2017-04-03v4No1 / 126
590amnoncommon in turtle pond water (common china, turtle farm, farm, hainan autonomous prefecture, pond water, water)2020-02-10v4No1 / 127
374amnoncommon skin, costa rica, amphibia, craugastor fitzingeri, common rain frog, frog2018-09-09v4No1 / 136
171amnoncommon united states of america, state of california, oryza sativa, rice, root2017-07-25v4No1 / 156
408amnon high in larval stage compared to stomach in ant costa rica united states of america pseudomyrmex spinicola 2018-11-22v4No1 / 165
600sheryolower in biochar ammendment soil ( high in unamended compared to biochar in depth (soil) 0-5cm state of new york soil united states of america coarse-loamy soil ph 6 day 82 )2020-03-27v4No1 / 166
374amnoncommon skin, costa rica, amphibia, craugastor bransfordii, bransford’s litter frog, frog2018-09-09v4No1 / 171
196amnoncommon water, drinking water, united states of america2017-09-12v4No1 / 178
990amnoncommon control diet, qingdao city prefecture, research facility, china, larval stage, body proper, veined rapa whelk, rapana venosa2022-12-26v3No1 / 187
761sheryoHigher in maize rhizosphere compared to bulk soil in sandy soil maize field in Germany ( high in rhizosphere compared to bulk soil in ph 5 lower saxony sandy soil germany maize field )2021-04-06v3No1 / 200
787amnonhigher in excess grain induced rumen acidosis compared to healthy controls ( high in subacute rumen acidosis acidosis compared to control in dairy goat shanxi province rumen ruminal fluid research facility china goat capra hircus )2021-05-23v3No1 / 207
755sheryocommon in wild soybean (Glycine soja) rhizosphere (common ph 7, jilin province, rhizosphere, soil, black soil, china, glycine soja)2021-03-18v3No1 / 210
171amnonhigher in roots compared to rhizosphere soil in rice ( high in root compared to rhizosphere in united states of america state of california oryza sativa rice )2017-07-25v4No1 / 213
587amnoncommon israel, food product type, alfalfa sprouts, medicago sativa, producer c22020-02-10v3No1 / 215
196amnonhigher in water compared to biofilm ( high in water compared to biofilm biofilm in drinking water united states of america )2017-09-12v4No1 / 223
755sheryocommon in domesticated soybean (Glycine max) rhizosphere (common glycine max, china, black soil, soil, rhizosphere, jilin province, ph 7)2021-03-18v3No1 / 234
492amnoncommon skin, adult, rana catesbeiana, bullfrog, lithobates catesbeianus, frog, japan2019-02-27v4No1 / 236
69amnoncommon canis lupus familiaris, beagle dog, united states of america, research facility, oropharynx2017-02-21v4No1 / 241
990amnoncommon juvenile oyster containing diet, qingdao city prefecture, research facility, china, larval stage, body proper, veined rapa whelk, rapana venosa2022-12-26v3No1 / 246
973amnoncommon pes, skin, interdigital region, farm, research facility, coventry, united kingdom, ovis aries, sheep2022-12-24v1No1 / 254
948amnon high in fully formed stage compared to larva larval stage in black soldier fly hermetia illucens research facility tours french republic 2022-12-05v3No1 / 272
156amnoncommon brassica, brassica oleracea, leaf, phyllosphere, china2017-07-27v4No1 / 292
37amnoncommon in plastic leaf plants (in field next to tomato plants) (common maryland county, leaf)2016-12-09v4No1 / 298
462amnon high in populus trichocarpa x deltoides compared to populus deltoides in united states of america state of tennessee populus tree root cultivated environment 2019-01-13v4No1 / 300
615amnon high in leaf surface leaf compared to stem surface upper stem stem in exosphere saccharum sugarcane campinas brazil greenhouse 2020-04-27v4No1 / 321
855sheryoHigher in soil depth of 175cm compared to soil depth of 75cm in fertilized soil in china ( high in depth 175cm compared to depth 75cm in luancheng county china agricultural field fertilized soil soil )2021-12-27v3No1 / 334
819amnon high in high atmospheric pollution baoding city prefecture compared to low atmospheric pollution dalian city prefecture in adult age 25-45 years female china scalp skin homo sapiens 2021-07-12v1No1 / 337
129amnoncommon mexico, myrtillocactus geometrizans, opuntia robusta, cactus, rhizosphere, semi-arid2017-04-15v4No1 / 338
351amnoncommon in artificial sea water where sea urchins were grown (common sea urchin, lytechinus variegatus, research facility, state of florida, united states of america, artificial seawater, sea water)2018-07-30v4No1 / 338
755sheryocommon in domesticated rice (Oryza stavia) rhizosphere (common oryza sativa, ph 7, jilin province, rhizosphere, soil, black soil, china)2021-03-18v3No1 / 415
360amnoncommon desert, soil, mexico, guanajuato2018-08-21v4No1 / 437
758amnon high in cheyenne menthol box cigar cheyenne full flavor cigar compared to swisher sweets sweet cherry cigar swisher sweets original cigar in tobacco nicotiana tabacum cigar 2021-03-28v3No1 / 452
415amnonhigher in citrus from humid subtropical compared to mediterranean and semi-arid climate ( high in subtropical compared to mediterranean semi-arid in rhizosphere soil citrus orchard cultivated environment )2018-11-27v4No1 / 458
989amnoncommon rhizosphere, depth (soil) 0-20cm, cinnamomum camphora, anxi county, ph 4-5, farm, china2022-12-26v3No1 / 476
786sheryoCommon in flood plain soil near cosumnes river, california, at 400-700cm depth (common depth (soil) 400-700cm, flood plain, soil, united states of america, state of california, sacramento, cosumnes river preserve)2021-05-18v3No1 / 481
259amnonlower in fertilized soil (npk) compared to non-fertilized ( high in non-fertilized soil compared to fertilized soil in soil rhizosphere ph 5 arachis hypogaea peanut china )2017-12-02v4No1 / 483
360amnoncommon desert, soil, rhizosphere, agave, agave salmiana, mexico, guanajuato2018-08-21v4No1 / 484
617amnonlower in cow milk of cows in alpine pasture compared to lowland farm ( high in lowland farm lowland pasture compared to alpine pasture alpine in farm italy cow milk (raw) cow milk (fluid) milk )2020-05-03v3No1 / 484
360amnoncommon agave, desert, leaf, leaf surface, agave salmiana, mexico, guanajuato2018-08-21v4No1 / 492
360amnoncommon desert, soil, mexico, guanajuato, cultivated environment2018-08-21v4No1 / 500
718amnon high in epilimnion compared to hypolimnion in "trout bog" lake ph 4.5-5 dimictic lake freshwater lake bog lake united states of america state of wisconsin 2028-05-23v4No1 / 509
615amnon high in endosphere root compared to rhizosphere in saccharum sugarcane campinas brazil greenhouse 2020-04-27v4No1 / 529
755sheryocommon in wild rice (Oryza rufipogon) rhizosphere (common oryza rufipogon, ph 7, jilin province, rhizosphere, soil, black soil, china)2021-03-18v3No1 / 530
98amnoncommon citrus, rhizosphere, immokalee, fl, root, state of florida2017-04-01v4No1 / 543
98amnoncommon citrus, rhizosphere, vero beach, fl, root, state of florida2017-04-01v4No1 / 544
129amnoncommon mexico, myrtillocactus geometrizans, opuntia robusta, cactus, semi-arid, leaf2017-04-15v4No1 / 562
254amnon high in summer wet season autumn compared to winter dry season in river water fresh water depth (soil) 50cm jiulong river fujian province china 2017-11-23v4No1 / 571
548amnoncommon minas gerais state, campos rupestres, brazil, barbacenia macrantha, root endosphere, root2019-08-17v4No1 / 575
254amnon high in summer wet season compared to winter dry season autumn in river water fresh water depth (soil) 50cm jiulong river fujian province china 2017-11-23v4No1 / 581
893amnon high in sandy loam compared to silty clay loam in raphanus sativus greenhouse radish commonwealth of virginia rhizosphere fertilized soil research facility united states of america 2022-04-11v4No1 / 582
808amnon high in ileum compared to caecum in mucosa germany age 35 weeks research facility hen chicken gallus gallus 2021-06-20v1No1 / 587
357amnoncommon soil, topsoil, depth (soil) 0-10cm, montane forest, woodland area, forest ecosystem2018-08-19v4No1 / 592
612amnoncommon state of florida, united states of america, spring water, water, fresh water, location 22020-04-22v4No1 / 596
415amnoncommon rhizosphere, soil, citrus, orchard, south africa, cultivated environment2018-11-27v4No1 / 600
357amnoncommon soil, topsoil, depth (soil) 0-10cm, savanna, forest ecosystem, woodland area2018-08-19v4No1 / 614
829sheryoHigher in soil depth of 0-56cm compared to soil depth of 56-140cm in Mollisol soil, Dekalb, Illinois, united states of america ( high in depth 0-56 compared to depth 56-140 in united states of america soil silt loam mollisol state of illinois illinois dekalb county )2021-08-26v3No1 / 631
820naCommon in upper subsoil, 45-75cm depth, wheat rhizosphere haplic luvisol in germany (common silty clay loam, ph 6.9, depth (soil) 45-75cm, triticum aestivum, haplic luvisol, germany, bonn, campus klein-altendorf, rhizosphere, soil)2021-07-14v1No1 / 648
548amnoncommon minas gerais state, campos rupestres, brazil, barbacenia macrantha, rhizosphere2019-08-17v4No1 / 651
612amnoncommon state of florida, united states of america, spring water, water, fresh water, location 42020-04-22v4No1 / 655
422amnoncommon soil, paddy field soil, oryza sativa, heilongjiang province, ph 6-7, cultivated environment, china2018-12-04v4No1 / 682
100amnoncommon soil, urban biome, park, new york city, central park2017-04-03v4No1 / 685
820naCommon in lower subsoil, 75-105cm depth, wheat rhizosphere haplic luvisol in germany (common depth (soil) 75-105cm, silty clay loam, ph 6.9, triticum aestivum, haplic luvisol, germany, bonn, campus klein-altendorf, rhizosphere, soil)2021-07-14v1No1 / 700
809amnoncommon lu'an city prefecture, flowerpot, research facility, greenhouse, dendrobium officinale, rhizosphere, china2021-06-20v4No1 / 715
415amnoncommon rhizosphere, soil, citrus, orchard, reunion island, cultivated environment2018-11-27v4No1 / 721
422amnoncommon soil, paddy field soil, oryza sativa, heilongjiang province, ph 5-6, cultivated environment, china2018-12-04v4No1 / 726
462amnoncommon depth (soil) 20-60cm, united states of america, state of tennessee, soil, depth 30-75cm, silt clay loam, cultivated environment2019-01-13v4No1 / 728
752sheryoCommon in soil planted with Panax notoginseng (common panax notoginseng, sanqi plants, ph 6, xundian county, yunnan province, china, pot expreiment, soil)2021-03-11v3No1 / 730
813amnoncommon forested area, temperate rainforest, united states of america, state of washington, olympic national park, soil2021-06-22v4No1 / 740
761sheryoCommon in maize rhizosphere sandy soil maize field in Germany (common zea mays, rhizosphere, ph 5, lower saxony, sandy soil, germany, maize field)2021-04-06v3No1 / 742
415amnoncommon rhizosphere, soil, citrus, australia, orchard, cultivated environment2018-11-27v4No1 / 743
829sheryoCommon in soil depth of 44-108cm in Alfisol soil, Dekalb, Illinois, united states of america (common depth 44-108cm, sandy loam, sandy loam soil, hapludalf, alfisol, united states of america, soil, state of illinois, illinois, dekalb county)2021-08-26v3No1 / 751
823sheryoCommon at 30-50cm depth in foot slope ultisol soil in auburn, alabama (common depth 30-50cm, foot slope , alabama, auburn, ultisol, agricultural field, soil)2021-08-08v3No1 / 753
171amnon high in drought environment compared to control in soil united states of america state of california rhizosphere oryza sativa rice 2017-07-25v4No1 / 770
171amnoncommon soil, united states of america, state of california, rhizosphere, oryza sativa, rice2017-07-25v4No1 / 772
615amnoncommon endosphere, root, saccharum, sugarcane, campinas, brazil, greenhouse2020-04-27v4No1 / 776
752sheryoCommon in soil planted with Panax notoginseng amended with2% biochar (common biochar, panax notoginseng, sanqi plants, ph 6, xundian county, yunnan province, china, pot expreiment, soil)2021-03-11v3No1 / 783
829sheryoCommon in soil depth of 0-27cm in Mollisol soil, Dekalb, Illinois, united states of america (common depth 0-27cm, dekalb county, illinois, state of illinois, mollisol, silt loam, soil, united states of america)2021-08-26v3No1 / 798
823sheryoCommon at 50-90cm depth in foot slope ultisol soil in auburn, alabama (common depth 50-90cm, foot slope , alabama, auburn, ultisol, agricultural field, soil)2021-08-08v3No1 / 815
422amnoncommon soil, paddy field soil, oryza sativa, yunnan province, china, cultivated environment2018-12-02v4No1 / 821
421amnoncommon in paddy field soil incubated without copper (common research facility, soil, paddy field soil, zhejiang province, china)2018-12-02v4No1 / 824
415amnoncommon rhizosphere, soil, citrus, orchard, china, cultivated environment2018-11-27v4No1 / 830
371amnonhigher in skin of amerindians compared to western visitors ( high in venezuela hunter gatherer amerindian compared to city united states of america in homo sapiens skin )2018-09-06v4No1 / 854
412amnoncommon soil, hunan province, red soil, cambisol, zea mays, triticum aestivum, ph>5, china2018-11-26v4No1 / 856
129amnoncommon ph 6-6.5, mexico, myrtillocactus geometrizans, opuntia robusta, cactus, semi-arid, soil2017-04-15v4No1 / 884
171amnoncommon in soil with rice growth irrigation protocol (common soil, united states of america, state of california, depth 5cm)2017-07-25v4No1 / 890
146amnoncommon united states of america, solanum lycopersicum, tomato, slit loam soil, ph 6, rhizosphere2017-04-20v4No1 / 894
829sheryoCommon in soil depth of 27-56cm in Mollisol soil, Dekalb, Illinois, united states of america (common depth 27-56cm, united states of america, soil, silt loam, mollisol, state of illinois, illinois, dekalb county)2021-08-26v3No1 / 906
462amnoncommon depth (soil) 20-60cm, united states of america, state of tennessee, depth 30-75cm, silt clay loam, rhizosphere, populus, tree, cultivated environment2019-01-13v4No1 / 908
820naHigher in 0-20cm depth compared to 75-105cm depth in wheat rhizosphere haplic luvisol in germany ( high in depth (soil) 0-20cm compared to depth (soil) 75-105cm in silty clay loam ph 6.9 triticum aestivum haplic luvisol germany bonn campus klein-altendorf rhizosphere soil )2021-07-14v1No1 / 917
548amnoncommon minas gerais state, campos rupestres, brazil, rock2019-08-17v4No1 / 924
786sheryoCommon in flood plain soil near cosumnes river, california, at 166-200cm depth (common depth (soil) 166-200cm, flood plain, soil, united states of america, state of california, sacramento, cosumnes river preserve)2021-05-18v3No1 / 936
462amnoncommon depth (soil) 0-30 cm, depth (soil) 0-20cm, united states of america, state of tennessee, soil, silt loam, cultivated environment2019-01-13v4No1 / 938
444amnoncommon in uncultivated soil plot (common yellow brown soil, nanjing city prefecture, soil, china)2019-01-07v4No1 / 946
37amnonlower in tomato plant leaves compared to plastic control ( high in control compared to solanum lycopersicum in maryland county leaf )2016-12-09v4No1 / 950
98amnoncommon citrus, rhizosphere, quincy, fl, root, state of florida2017-04-01v4No1 / 950
422amnoncommon soil, paddy field soil, jiangsu province, oryza sativa, china, cultivated environment2018-12-02v4No1 / 957
129amnoncommon ph 6-6.5, mexico, myrtillocactus geometrizans, opuntia robusta, cactus, semi-arid, soil, root zone soil2017-04-15v4No1 / 968
823sheryoHigher at 15-30cm depth compared to 50-90cm depth in foot slope ultisol soil in auburn, alabama ( high in depth (soil) 15-30cm compared to depth 50-90cm in foot slope alabama auburn ultisol agricultural field soil )2021-08-08v3No1 / 968
480amnoncommon soil, pasture, farm, new zealand2019-02-05v4No1 / 970
474amnoncommon soil, farm, glycine max, soybean, ph 4-6, brazil, cultivated environment2019-01-16v4No1 / 974
615amnoncommon saccharum, sugarcane, rhizosphere, campinas, brazil, greenhouse2020-04-27v4No1 / 974
462amnoncommon depth (soil) 0-30 cm, depth (soil) 0-20cm, united states of america, state of tennessee, rhizosphere, populus, tree, silt loam, cultivated environment2019-01-13v4No1 / 997
610sheryoCommon in agricultural field soil amended with straw (common straw, triticum aestivum, ph 7, wheat, kingdom of denmark, agricultural field, soil)2020-04-21v3No1 / 998
809amnoncommon dendrobium moniliforme, lu'an city prefecture, flowerpot, research facility, greenhouse, rhizosphere, china2021-06-20v4No1 / 1002
933amnoncommon guangxi zhuang autonomous region, ph 5.5, quaternary laterite soil, research facility, china, cucurbita moschata, pumpkin, rhizosphere2022-09-11v3No1 / 1002
412amnon high in ph>5 compared to ph<5 in soil hunan province red soil cambisol zea mays triticum aestivum china 2018-11-26v4No1 / 1005
820naCommon in top soil, 0-20cm depth, wheat rhizosphere haplic luvisol in germany (common depth (soil) 0-20cm, triticum aestivum, ph 6.5, silt loam, haplic luvisol, germany, bonn, campus klein-altendorf, rhizosphere, soil)2021-07-14v1No1 / 1011
628sheryocommon in bulk soil with barley plants after 180 days in treatments amended with biochar (common biochar, bulk soil, china, zhejiang province, quzhou county, soil, depth (soil) 15cm, ph 4-5, hordeum vulgare, days 180, mature barley plants)2020-05-18v4No1 / 1023
828sheryoCommon in gleysol soil of poplar plantation at 0-10cm depth, sihong, china (common depth (soil) 0-10cm, ph 6-7, clay loam, gleysol, china, jiangsu province, sihong county, chenwei forest, soil, poplar plantation, poplar)2021-08-25v4No1 / 1069
610sheryoCommon in agricultural field soil amended with high biochar (common soil, agricultural field, kingdom of denmark, wheat, ph 7, high biochar, triticum aestivum)2020-04-21v3No1 / 1079
415amnoncommon rhizosphere, soil, citrus, orchard, brazil, cultivated environment2018-11-27v4No1 / 1091
415amnoncommon rhizosphere, soil, citrus, orchard, kingdom of spain, cultivated environment2018-11-27v4No1 / 1099
917amnoncommon qiao nature reserve, depth (soil) 0-20cm, sonneratia apetala, china, marsh, mangrove, ph 7-8, soil2022-07-08v3No1 / 1107
146amnon high in soil compared to rhizosphere in united states of america solanum lycopersicum tomato slit loam ph 6 2017-04-20v4No1 / 1135
628sheryocommon in bulk soil with barley plants after 180 days in treatments unamended with biochar (common bulk soil, china, zhejiang province, quzhou county, soil, depth (soil) 15cm, ph 4-5, hordeum vulgare, days 180, mature barley plants)2020-05-18v4No1 / 1136
146amnoncommon united states of america, solanum lycopersicum, tomato, soil, slit loam soil, ph 62017-04-20v4No1 / 1144
422amnoncommon soil, paddy field soil, oryza sativa, heilongjiang province, ph 7-8, cultivated environment, china2018-12-04v4No1 / 1169
615amnon high in rhizosphere compared to soil in saccharum sugarcane campinas brazil greenhouse 2020-04-27v4No1 / 1181
628sheryocommon in rhizosphere of barley roots after 180 days in treatments amended with biochar (common mature barley plants, days 180, rhizosphere, hordeum vulgare, biochar, ph 4-5, depth (soil) 15cm, china, quzhou county, zhejiang province, soil)2020-05-18v4No1 / 1192
421amnoncommon soil, paddy field soil, zhejiang province, china2018-12-04v4No1 / 1194
910amnon high in mouth mucosa oral cavity compared to rumen in research facility germany juvenile stage age 140 days holstein dairy cow calve bos taurus 2022-05-20v1No1 / 1194
917amnoncommon ph 7-8, futian national nature reserve, depth (soil) 0-20cm, kandelia candel, china, marsh, mangrove, soil2022-07-08v3No1 / 1197
823sheryoCommon at 0-15cm depth in foot slope ultisol soil in auburn, alabama (common foot slope , depth (soil) 0-15cm, alabama, auburn, ultisol, agricultural field, soil)2021-08-08v3No1 / 1199
801sheryoCommon at depth 0-15cm in corn and soybean agriculture fields, Iowa USA (common subsurface drainage, ph 6.2, depth (soil) 0-15cm, glycine max, kelley, nicollet soil series, des moines, united states, agricultural field, iowa, zea mays, soil)2021-06-15v4No1 / 1202
628sheryocommon in rhizosphere of barley roots after 180 days in treatments unamended with biochar (common china, zhejiang province, quzhou county, soil, depth (soil) 15cm, ph 4-5, hordeum vulgare, rhizosphere, days 180, mature barley plants)2020-05-18v4No1 / 1209
917amnoncommon qiao nature reserve, depth (soil) 0-20cm, china, mudflat, marsh, ph 7-8, soil, saline marsh2022-07-08v3No1 / 1211
823sheryoCommon at 15-30cm depth in foot slope ultisol soil in auburn, alabama (common depth (soil) 15-30cm, foot slope , alabama, auburn, ultisol, agricultural field, soil)2021-08-08v3No1 / 1218
444amnonlower in continuously cropped strawberry soil ( high in age 1 year compared to age 5 years age 10 years continuous cropping in rhizosphere fragaria x ananassa strawberry greenhouse soil farm yellow brown soil nanjing city prefecture china cultivated environment )2019-01-07v4No1 / 1221
901amnoncommon taihu lake, depth (sediment) 0-20cm, depth (water) 20-100cm, taihu national park, china, lake sediment2022-04-25v4No1 / 1246
616amnoncommon in topsoil of non-fertilized sugarcane field (common depth (soil) 0-20cm, ph 6.7, sugarcane, saccharum, soil, topsoil, china, guangzhou city prefecture, non-fertilized soil)2020-04-27v3No1 / 1277
414amnoncommon soil, heilongjiang province, agricultural feature, triticum aestivum, glycine max, zea mays, black soil, mollisol, ph>6, china2018-11-26v4No1 / 1282
917amnoncommon ph 6-6.5, futian national nature reserve, depth (soil) 0-20cm, china, mudflat, marsh, soil, saline marsh2022-07-08v3No1 / 1290
259amnoncommon in soil and rhizpsphere of peanut plants (common soil, rhizosphere, ph 5, arachis hypogaea, peanut, china)2017-12-02v4No1 / 1334
98amnoncommon citrus, rhizosphere, ft. pierce, fl, root, state of florida2017-04-01v4No1 / 1340
809amnoncommon dendrobium huoshanense, lu'an city prefecture, flowerpot, research facility, greenhouse, rhizosphere, china2021-06-20v4No1 / 1356
808amnon high in ileal mucosa mucosa compared to digesta in ileum germany age 35 weeks research facility hen chicken gallus gallus 2021-06-20v1No1 / 1360
917amnoncommon ph 6-6.5, kandelia candel, depth (soil) 0-20cm, marsh, china, qiao nature reserve, mangrove, soil2022-07-08v3No1 / 1364
901amnoncommon in macrophyte plant rhizosphere (common rhizosphere, depth (sediment) 0-20cm, taihu lake, taihu national park, china, depth (water) 20-100cm, lake sediment)2022-04-25v4No1 / 1378
917amnoncommon ph 6-7, depth (soil) 0-20cm, futian national nature reserve, sonneratia apetala, china, marsh, mangrove, soil2022-07-08v3No1 / 1379
422amnoncommon soil, paddy field soil, oryza sativa, hunan province, hubei province, china, cultivated environment2018-12-02v4No1 / 1399
444amnoncommon rhizosphere, fragaria x ananassa, strawberry, greenhouse soil, farm, yellow brown soil, nanjing city prefecture, age 1 year, china, cultivated environment2019-01-07v4No1 / 1439
414amnon high in ph>6 compared to ph<6 npk fertilizer in soil heilongjiang province agricultural feature triticum aestivum glycine max zea mays black soil mollisol china 2018-11-26v4No1 / 1451
686sheryoCommon in vanilla field soil infected with Fusarium oxysporum, fertilized with chemical fertilizer and had high Fusarium cumulative disease incidence (common ph 7.6, wanning city, pot expreiment, vanilla planifolia, soil from vanilla field, fusarium oxysporum f. sp. vanillae, chemical fertilization n,p,k, high fusarium cumulative disease incidence )2028-03-08v4No1 / 1456
139amnon high in polymetallic nodule compared to marine sediment in pacific ocean depth (water) 4000m 2017-04-18v4No1 / 1483
760sheryoCommon in rhizosphere soil of rice plants with NPK fertilization in a long term fertilization experiment (common npk fertilization, npk fertilizer, ph 5.9, china, soil, qiyang county, hunan province, quaternary red clay, oryza sativa, rhizosphere)2021-04-06v4No1 / 1491
760sheryoCommon in rhizosphere soil of rice plants without fertilization in a long term fertilization experiment (common ph 5.9, china, soil, qiyang county, hunan province, quaternary red clay, no fertilization, oryza sativa, rhizosphere)2021-04-06v4No1 / 1506
145amnoncommon soil, rhizosphere, oryza sativa, rice, united states of america, ph 5.62017-04-19v4No1 / 1515
901amnoncommon sediment surface, depth (sediment) 0cm, taihu lake, depth (water) 20-100cm, taihu national park, china, lake sediment2022-04-25v4No1 / 1550
665amnon high in inlet compared to outlet in late time points engineered wetland benthic biomat state of california water treatment pond microbial biomat biomat united states of america 2020-09-23v4No1 / 1629
686sheryoCommon in vanilla field soil infected with Fusarium oxysporum, fertilized with fungal bio-fertilizer and had low Fusarium cumulative disease incidence (common trichoderma guizhouense njau 4742, fungal enriched bio-fertilizer, fusarium oxysporum f. sp. vanillae, soil from vanilla field, vanilla planifolia, pot expreiment, wanning city, ph 7.6, low fusarium cumulative disease incidence )2028-03-08v4No1 / 1661
760sheryoCommon in rhizosphere soil of rice plants with manure fertilization in a long term fertilization experiment (common manure fertilization, manured soil, ph 5.9, china, soil, qiyang county, hunan province, quaternary red clay, oryza sativa, rhizosphere)2021-04-06v4No1 / 1670
696amnon high in alycaeus jagori compared to opisthostoma concinnum plectostoma concinnum in land snail stomach gastrointestinal system malaysia state of sabah 2028-03-28v3No1 / 1672
819amnon high in skin of cheek compared to scalp in age 25-45 years china adult skin female homo sapiens 2021-07-12v1No1 / 1684
696amnon high in alycaeus jagori compared to georissa similis georissa in land snail stomach gastrointestinal system malaysia state of sabah 2028-03-28v3No1 / 1698
616amnoncommon in topsoil of PK/NP/NPK/NK fertilized sugarcane field (common depth (soil) 0-20cm, fertilized soil, ph 5.5-6, sugarcane, saccharum, soil, topsoil, china, guangzhou city prefecture)2020-04-27v3No1 / 1710
686sheryoCommon in vanilla field soil infected with Fusarium oxysporum, fertilized with bacterial bio-fertilizer and had low Fusarium cumulative disease incidence (common fusarium oxysporum f. sp. vanillae, soil from vanilla field, vanilla planifolia, pot expreiment, wanning city, ph 7.6, bacterial enriched bio-fertilizer, bacillus amyloliquefaciens w19, low fusarium cumulative disease incidence )2028-03-08v4No1 / 1726
536amnon high in aquatic snake compared to terrestrial snake in snake skin united states of america southern united states 2019-07-28v4No1 / 1772
901amnon high in sediment surface depth (sediment) 0cm compared to depth (sediment) 0-20cm in taihu lake depth (water) 20-100cm taihu national park china lake sediment 2022-04-25v4No1 / 1819
156amnoncommon soil, rhizosphere, brassica, brassica oleracea, china2017-07-27v4No1 / 1885
901amnon high in rhizosphere compared to bulk sediment in depth (sediment) 0-20cm taihu lake depth (water) 20-100cm taihu national park china lake sediment 2022-04-25v4No1 / 1892
800amnonlower at 100-250 days compared to 7-28 days following heavy metal contamination ( high in spring compared to autumn summer in reservoir sediment depth 0-10cm heavy metal china xiannv lake lake fresh water sediment )2021-06-15v4No1 / 1962
357amnon high in ph>4.5 compared to ph<4.5 in soil topsoil depth (soil) 0-10cm moist tropical forest woodland area forest ecosystem 2018-08-18v4No1 / 2773
166amnoncommon in river sediment (5cm) without mussels (common freshwater biome, river, united states of america, sediment, mississippi river, depth 5cm, upper mississippi river)2017-07-18v4No1 / 2877
84amnoncommon depth 5cm, soil, temperate grassland biome, fen, peat soil, flooded grassland biome, united kingdom2017-03-07v4No1 / 3434
103amnonhigher in particle bound fraction compared to free floating bacteria in mississippi river ( high in particles compared to free floating in river united states of america mississippi river fresh water aquatic biome )2017-04-05v4No1 / 3559
462amnon high in rhizosphere compared to root in united states of america state of tennessee populus tree cultivated environment 2019-01-13v4No1 / 4630
271amnon high in soil rhizosphere compared to root structure root in depth (soil) 0-20cm glycine max soybean china 2018-01-09v4No1 / 7954

Problems / suggestions? Please email info AT dbbact DOT org