Search result for sequence:
TACGAAGGGGGCTAGCGTTGCTCGGAATGACTGGGCGTAAAGGGCGCGTAGGCGGTTTATACAGTCAGATGTGAAATCCTTGGGCTTAACCTGAGAACTGCATTTGAGACGTGTAGACTAGAGTTCGAGAGAGGATTGTGGAATTCCCAG
common ontology terms
Fraction of dbbact annotations with this term covered by the query
TermScore
ant0.500000
pseudomyrmex spinicola0.500000
pheidole0.500000
pseudomyrmex nigropilosus0.500000
pseudomyrmex gracilis0.500000
pseudomyrmex flavicornis0.500000
pseudomyrmex cubaensis0.500000
pseudomyrmex elongatus0.500000
pseudomyrmex nigrocinctus0.500000
pseudomyrmex pallidus0.500000
pseudomyrmex simplex0.500000
pseudomyrmex viduus0.500000
acacia ants0.500000
LOWER IN pseudomyrmex gracilis0.500000
LOWER IN generalist0.500000
merlot0.500000
grapevine0.500000
camponotus0.333333
crematogaster0.333333
eciton0.333333
cephalotes0.333333
pseudomyrmex0.333333
vitis vinifera0.333333
LOWER IN larval stage0.166667
costa rica0.142857
state of new york0.100000
larval stage0.071429
stomach0.062500
soil0.010753
united states of america0.008264
Fraction of annotations for the query sequences containing the term
TermScore
united states of america1.000000
costa rica0.971429
ant0.971429
stomach0.485714
larval stage0.457143
pseudomyrmex spinicola0.171429
pseudomyrmex flavicornis0.142857
pseudomyrmex nigrocinctus0.142857
pseudomyrmex nigropilosus0.085714
pseudomyrmex gracilis0.085714
camponotus0.057143
crematogaster0.057143
pseudomyrmex elongatus0.057143
cephalotes0.057143
LOWER IN larval stage0.028571
pheidole0.028571
pseudomyrmex cubaensis0.028571
eciton0.028571
pseudomyrmex pallidus0.028571
pseudomyrmex simplex0.028571
pseudomyrmex viduus0.028571
acacia ants0.028571
LOWER IN pseudomyrmex gracilis0.028571
LOWER IN generalist0.028571
pseudomyrmex0.028571
soil0.028571
vitis vinifera0.028571
state of new york0.028571
merlot0.028571
grapevine0.028571
Exp. ID User ID Description Date Region Flag Sequences
408amnoncommon united states of america, stomach, costa rica, camponotus, ant2018-11-22v4No1 / 2
408amnoncommon united states of america, larval stage, costa rica, camponotus, ant2018-11-22v4No1 / 3
408amnondominant united states of america, stomach, costa rica, ant, pseudomyrmex spinicola2018-11-22v4No1 / 5
408amnon high in stomach compared to larval stage in united states of america costa rica ant pseudomyrmex spinicola 2018-11-22v4No1 / 5
408amnoncommon united states of america, stomach, costa rica, ant, pheidole2018-11-22v4No1 / 5
408amnondominant united states of america, stomach, costa rica, ant, pseudomyrmex nigropilosus2018-11-22v4No1 / 5
408amnoncommon united states of america, larval stage, costa rica, ant, pseudomyrmex gracilis2018-11-22v4No1 / 7
408amnoncommon united states of america, stomach, costa rica, ant, pseudomyrmex flavicornis2018-11-22v4No1 / 7
408amnondominant united states of america, stomach, costa rica, ant, pseudomyrmex flavicornis2018-11-22v4No1 / 7
408amnoncommon united states of america, stomach, costa rica, ant, pseudomyrmex gracilis2018-11-22v4No1 / 8
408amnoncommon united states of america, stomach, costa rica, crematogaster, ant2018-11-22v4No1 / 8
408amnoncommon united states of america, larval stage, costa rica, ant, pseudomyrmex cubaensis2018-11-22v4No1 / 8
408amnoncommon united states of america, stomach, costa rica, eciton, ant2018-11-22v4No1 / 9
408amnoncommon united states of america, stomach, costa rica, ant, pseudomyrmex elongatus2018-11-22v4No1 / 10
408amnoncommon united states of america, larval stage, costa rica, ant, pseudomyrmex elongatus2018-11-22v4No1 / 10
408amnondominant united states of america, stomach, costa rica, ant, pseudomyrmex nigrocinctus2018-11-22v4No1 / 11
408amnoncommon united states of america, larval stage, costa rica, ant, pseudomyrmex nigrocinctus2018-11-22v4No1 / 11
408amnoncommon united states of america, stomach, costa rica, ant, pseudomyrmex spinicola2018-11-22v4No1 / 11
408amnoncommon united states of america, stomach, costa rica, ant, pseudomyrmex nigropilosus2018-11-22v4No1 / 11
408amnoncommon united states of america, larval stage, costa rica, ant, pseudomyrmex pallidus2018-11-22v4No1 / 11
408amnondominant united states of america, stomach, costa rica, ant, pseudomyrmex gracilis2018-11-22v4No1 / 12
408amnoncommon united states of america, stomach, costa rica, ant, pseudomyrmex nigrocinctus2018-11-22v4No1 / 12
408amnondominant united states of america, larval stage, costa rica, ant, pseudomyrmex flavicornis2018-11-22v4No1 / 12
408amnondominant united states of america, larval stage, costa rica, ant, pseudomyrmex spinicola2018-11-22v4No1 / 14
408amnoncommon united states of america, larval stage, costa rica, ant, pseudomyrmex flavicornis2018-11-22v4No1 / 15
408amnoncommon united states of america, larval stage, costa rica, cephalotes, ant2018-11-22v4No1 / 16
408amnondominant united states of america, larval stage, costa rica, ant, pseudomyrmex nigrocinctus2018-11-22v4No1 / 17
408amnoncommon united states of america, stomach, costa rica, cephalotes, ant2018-11-22v4No1 / 18
408amnoncommon united states of america, larval stage, costa rica, ant, pseudomyrmex nigropilosus2018-11-22v4No1 / 18
408amnoncommon united states of america, larval stage, costa rica, crematogaster, ant2018-11-22v4No1 / 19
408amnoncommon united states of america, larval stage, costa rica, ant, pseudomyrmex spinicola2018-11-22v4No1 / 22
408amnoncommon united states of america, larval stage, costa rica, ant, pseudomyrmex simplex2018-11-22v4No1 / 23
408amnoncommon united states of america, larval stage, costa rica, ant, pseudomyrmex viduus2018-11-22v4No1 / 47
408amnon high in pseudomyrmex nigrocinctus pseudomyrmex flavicornis pseudomyrmex spinicola acacia ants compared to pseudomyrmex gracilis generalist in united states of america costa rica pseudomyrmex ant 2018-11-22v4No1 / 53
101amnoncommon united states of america, soil, vitis vinifera, state of new york, merlot, grapevine2017-04-03v4No1 / 2537

Problems / suggestions? Please email info AT dbbact DOT org