Search result for sequence:
TACGAAGGGGGCTAGCGTTGCTCGGAATTACTGGGCGTAAAGGGAGCGTAGGCGGACATTTAAGTCAGGGGTGAAATCCCGGGGCTCAACCTCGGAATTGCCTTTGATACTGGGTGTCTTGAGTATGAGAGAGGTGTGTGGAACTCCGAG
common ontology terms
term enrichment score
TermScore
skin0.203450
water0.172367
fresh water0.167598
river0.157385
united states of america0.153462
depth 10 cm0.129870
rhizosphere0.127660
wheat0.122034
leaf0.116279
koshi river0.106667
sea water0.104167
depth 0-20cm0.103896
nepal0.101266
china0.097826
LOWER IN soil0.095346
soil0.092736
homo sapiens0.084901
north china plain0.082192
air0.079734
agricultural feature0.075949
canada0.071942
building0.070671
filtered 2.7um0.070671
state of california0.069767
urban biome0.069444
southern united states0.069444
agave0.069444
state of tennessee0.068259
mexico0.068259
snake0.067114
bird0.066007
desert0.059172
tributary0.056338
sea urchin0.056338
state of rhode island0.056338
populus0.056338
japan0.055172
filtered 0.2um0.054795
particle bound0.054795
lytechinus variegatus0.054795
winter0.053571
free floating0.051948
israel0.051948
tree0.051948
city0.051064
brazil0.049383
cultivated environment0.048193
pond0.043796
coelomic fluid0.043321
dust0.043321
state of florida0.043011
eagle harbor0.042857
tomato0.042857
bon portage island0.042857
oceanodroma leucorhoa0.042857
seabird0.042857
depth 4m0.042857
guanajuato0.042857
foodon product type0.042403
depth 0-5cm0.041958
foot0.041958
mucus0.041958
leaf surface0.041958
soybean0.041958
frog0.041522
LOWER IN mouth0.041522
snow0.041096
solanum lycopersicum0.041096
glycine max0.041096
triticum aestivum0.041096
LOWER IN saliva0.040678
pair of nares0.040268
LOWER IN feces0.040268
adult0.039735
larval stage0.039088
research facility0.038853
canis lupus familiaris0.037975
infant0.037267
child0.036585
australia0.033520
ocean0.032967
floor0.029197
beetle0.029197
day 00.029197
hokkaido0.029197
toad0.029197
bathroom0.028986
shower0.028986
tile0.028986
building wall0.028986
lapland0.028986
kitchen0.028986
sink0.028986
anas platyrhynchos0.028986
mallard0.028986
tick0.028986
ixodes scapularis0.028986
hydrothermal vent0.028986
greece0.028986
marine hydrothermal vent0.028986
Fraction of dbbact annotations with this term covered by the query
TermScore
pond1.000000
canada1.000000
building0.666667
filtered 2.7um0.666667
coelomic fluid0.666667
floor0.666667
dust0.666667
beetle0.666667
day 00.666667
hokkaido0.666667
toad0.666667
wheat0.666667
LOWER IN soil0.545455
depth 10 cm0.500000
koshi river0.500000
bathroom0.500000
shower0.500000
tile0.500000
urban biome0.500000
building wall0.500000
tributary0.500000
lapland0.500000
cinara0.500000
kitchen0.500000
sink0.500000
sea urchin0.500000
eagle harbor0.500000
cleanroom0.500000
anas platyrhynchos0.500000
mallard0.500000
tick0.500000
ixodes scapularis0.500000
lesser treefrog0.500000
tomato0.500000
pixr immunized0.500000
influenza0.500000
hydrothermal vent0.500000
greece0.500000
marine hydrothermal vent0.500000
volcanic rock0.500000
volcanic crater0.500000
active vent0.500000
LOWER IN inactive vent0.500000
anoplophora glabripennis0.500000
reproductive system0.500000
reproductive organ0.500000
genitalia0.500000
zea mays subsp. mays0.500000
corn0.500000
fresh corn0.500000
LOWER IN fermented corn0.500000
bronchial brush0.500000
LOWER IN sputum0.500000
LOWER IN induced sputum0.500000
bon portage island0.500000
oceanodroma leucorhoa0.500000
seabird0.500000
brood patch0.500000
bedroom0.500000
chicago0.500000
state of rhode island0.500000
kimchi0.500000
LOWER IN days 1-90.500000
centrocercus urophasianus0.500000
greater sage-grouse0.500000
state of wyoming0.500000
fish sauce0.500000
middle timepoint0.500000
two weeks0.500000
LOWER IN fresh0.500000
LOWER IN food spoilage0.500000
age <=24 hours0.500000
LOWER IN age >= 7 days0.500000
cabbage0.500000
starfish0.500000
patiria pectinifera0.500000
bermuda0.500000
LOWER IN oral wash0.500000
rhinella icterica0.500000
yellow cururu toad0.500000
crotalus horridus0.500000
southern united states0.500000
timber rattlesnake0.500000
thamnophis sirtalis0.500000
common garter snake0.500000
aquatic snake0.500000
nerodia sipedon0.500000
northern water snake0.500000
train0.500000
boston0.500000
amphibia0.500000
rhaebo haematiticus0.500000
truando toad0.500000
craugastor fitzingeri0.500000
common rain frog0.500000
LOWER IN estonia0.500000
greenhouse0.500000
dracaena marginata0.500000
hong kong0.500000
LOWER IN beginning0.500000
Fraction of annotations for the query sequences containing the term
TermScore
united states of america0.313433
water0.156716
skin0.141791
china0.134328
homo sapiens0.119403
fresh water0.111940
river0.097015
soil0.089552
rhizosphere0.089552
depth 10 cm0.074627
sea water0.074627
leaf0.074627
wheat0.067164
koshi river0.059701
nepal0.059701
depth 0-20cm0.059701
research facility0.052239
LOWER IN soil0.052239
state of california0.044776
adult0.044776
air0.044776
north china plain0.044776
agricultural feature0.044776
winter0.044776
building0.037313
urban biome0.037313
filtered 2.7um0.037313
canada0.037313
bird0.037313
snake0.037313
southern united states0.037313
state of tennessee0.037313
desert0.037313
agave0.037313
mexico0.037313
free floating0.029851
filtered 0.2um0.029851
tributary0.029851
particle bound0.029851
sea urchin0.029851
lytechinus variegatus0.029851
state of florida0.029851
brazil0.029851
israel0.029851
state of rhode island0.029851
city0.029851
japan0.029851
populus0.029851
tree0.029851
cultivated environment0.029851
pond0.022388
snow0.022388
depth 0-5cm0.022388
coelomic fluid0.022388
eagle harbor0.022388
dust0.022388
larval stage0.022388
frog0.022388
solanum lycopersicum0.022388
tomato0.022388
australia0.022388
foot0.022388
canis lupus familiaris0.022388
pair of nares0.022388
mucus0.022388
LOWER IN saliva0.022388
LOWER IN mouth0.022388
bon portage island0.022388
oceanodroma leucorhoa0.022388
seabird0.022388
foodon product type0.022388
infant0.022388
child0.022388
LOWER IN feces0.022388
feces0.022388
ocean0.022388
depth 4m0.022388
guanajuato0.022388
leaf surface0.022388
glycine max0.022388
soybean0.022388
triticum aestivum0.022388
bathroom0.014925
shower0.014925
tile0.014925
building wall0.014925
hunan province0.014925
jiangxi province0.014925
lapland0.014925
finland0.014925
sweden0.014925
kingdom of norway0.014925
kitchen0.014925
sink0.014925
floor0.014925
anas platyrhynchos0.014925
mallard0.014925
cloaca0.014925
tick0.014925
ixodes scapularis0.014925
Exp. ID User ID Description Date Region Flag Sequences
534amnonhighfreq river, water, fresh water, depth 10 cm, koshi river, nepal, free floating, filtered 0.2um2019-07-22v4No1 / 10
199amnonhigh freq. on shower wall tile (highfreq bathroom, shower, building, tile, urban biome, united states of america, building wall)2017-10-01v4No1 / 13
315amnonhigh freq. in frog pond water (highfreq hunan province, jiangxi province, water, fresh water, pond, china)2018-04-10v4No1 / 13
534amnonhighfreq river, water, fresh water, depth 10 cm, koshi river, tributary, nepal, free floating, filtered 0.2um2019-07-22v4No1 / 13
511amnonhighfreq snow, depth 0-5cm, lapland, finland, sweden, kingdom of norway2019-03-20v4No1 / 15
534amnonhighfreq river, water, fresh water, depth 10 cm, koshi river, tributary, nepal, particle bound, filtered 2.7um2019-07-22v4No1 / 16
534amnonhighfreq river, water, fresh water, depth 10 cm, koshi river, nepal, particle bound, filtered 2.7um2019-07-22v4No1 / 16
68amnonfound in some aphid samples (prevalence <=0.1) (other cinara)2017-02-20v4No1 / 17
199amnonhigh freq. in kitchen sink (highfreq building, urban biome, united states of america, kitchen, sink)2017-10-01v4No1 / 17
351amnonhighfreq sea urchin, lytechinus variegatus, coelomic fluid, research facility, eagle harbor, state of florida, united states of america2018-07-30v4No1 / 17
308amnoncommon in spacecraft assembly cleanroom floor (common united states of america, state of california, floor, dust, cleanroom)2018-03-31v4No1 / 23
348amnonsuspected contaminant (found in H2O samples) (contamination)2018-07-16v4No1 / 25
81amnoncommon anas platyrhynchos, mallard, state of california, cloaca2017-03-05v4No1 / 30
262amnoncommon tick, ixodes scapularis, larval stage, body proper, research facility2017-12-10v4No1 / 31
492amnoncommon brazil, skin, frog, dendropsophus minutus, lesser treefrog, adult2019-02-27v4No1 / 31
146amnoncommon united states of america, solanum lycopersicum, tomato, botanical fruit food product2017-04-20v4No1 / 35
262amnonhigher in tick larvae fed on PIXR immunized mice compared to non immunized ( high in pixr immunized compared to control in tick ixodes scapularis larval stage body proper research facility )2017-12-10v4No1 / 35
81amnonhigh in influenza A positive mallards compared to healthy mallards ( high in influenza compared to control in anas platyrhynchos mallard state of california cloaca )2017-03-05v4No1 / 37
232amnoncommon in foot of diabetic patients (common homo sapiens, skin, australia, foot, diabetes mellitus)2017-11-05v4No1 / 37
362amnon high in active vent compared to inactive vent in hydrothermal vent greece marine sediment mediterranean sea marine hydrothermal vent volcanic rock volcanic crater water sea water 2018-08-29v4No1 / 37
243amnoncommon beetle, anoplophora glabripennis, digestive system, united states of america2017-11-15v4No1 / 38
231amnoncommon in dog genitalia (common dog, canis lupus familiaris, united states of america, reproductive system, reproductive organ, genitalia)2017-11-02v4No1 / 43
306amnondecreases after 2-30 days of fermentation of insiled whole plant corn ( high in fresh corn day 0 compared to fermented corn in zea mays subsp. mays corn whole plant israel )2018-03-19v4No1 / 45
354amnon high in bronchus bronchial epithelium bronchial brush compared to sputum induced sputum in homo sapiens united states of america adult 2018-07-30v4No1 / 55
63amnoncommon in skin in american gut (common homo sapiens, skin)2017-02-15v4No1 / 56
26amnon high in pair of nares mucus compared to saliva mouth in canis lupus familiaris united states of america 2016-12-05v4No1 / 57
237amnoncommon canada, bon portage island, bird, oceanodroma leucorhoa, seabird, brood patch2017-11-07v4No1 / 57
237amnoncommon bird, oceanodroma leucorhoa, seabird, canada, bon portage island, uropygial gland2017-11-07v4No1 / 58
523amnoncommon air, building, bedroom, united states of america, chicago, state of illinois2019-07-03v4No1 / 58
311amnonlower in fermneted kimchi days>1 compared to day 0 ( high in day 0 early timepoints compared to days 1-9 in united states of america state of rhode island kimchi food (fermented) )2018-04-09v4No1 / 62
558amnon high in duodenum compared to caecum in bird centrocercus urophasianus greater sage-grouse united states of america state of wyoming 2019-09-20v4No1 / 64
311amnoncommon united states of america, state of rhode island, fish sauce, foodon product type2018-04-09v4No1 / 68
231amnoncommon in dog urine (common dog, canis lupus familiaris, united states of america, urine)2017-11-02v4No1 / 69
534amnoncommon river, water, fresh water, depth 10 cm, koshi river, tributary, nepal, free floating, filtered 0.2um2019-07-22v4No1 / 80
269amnonpeaks at 2 weeks in refrigeration of yao meat ( high in middle timepoint two weeks compared to fresh food spoilage late timepoint in china foodon product type )2018-01-09v4No1 / 83
227amnonhiger in first 24hrs compared to later timepoints in baby nasopharynx ( high in age age <=24 hours compared to age >= 7 days in homo sapiens nasopharynx nasal cavity infant kingdom of the netherlands )2017-10-30v4No1 / 85
311amnoncommon in salted cabbage (common cabbage, united states of america, state of rhode island, foodon product type)2018-04-09v4No1 / 85
550amnoncommon city, hokkaido, starfish, coelomic fluid, wild, patiria pectinifera, japan2019-08-18v4No1 / 85
26amnon high in pair of nares mucus compared to saliva mouth in united states of america felis catus 2016-12-05v4No1 / 86
199amnoncommon on shower wall tile (common bathroom, shower, building, tile, urban biome, united states of america, building wall)2017-10-01v4No1 / 90
9amnoncommon bermuda, sea water2016-10-27v4No1 / 91
354amnon high in bronchus bronchial brush bronchial epithelium compared to saliva oral wash in homo sapiens united states of america adult 2018-07-30v4No1 / 94
492amnoncommon brazil, skin, adult, rhinella icterica, toad, yellow cururu toad2019-02-27v4No1 / 95
306amnoncommon at whole plant corn at time 0 (common zea mays subsp. mays, corn, whole plant, israel)2018-03-19v4No1 / 96
536amnoncommon crotalus horridus, snake, skin, united states of america, southern united states, timber rattlesnake2019-07-28v4No1 / 101
536amnoncommon snake, skin, united states of america, southern united states, thamnophis sirtalis, common garter snake2019-07-28v4No1 / 110
536amnoncommon snake, skin, united states of america, southern united states, aquatic snake, nerodia sipedon, northern water snake2019-07-28v4No1 / 111
195amnoncommon in boston subway surfaces (common city, urban biome, train, boston)2017-09-07v4No1 / 116
410amnonlower in feces compared to rectal biopsies in children with treatment naive uc ( high in rectum biopsy biopsy site compared to feces in homo sapiens child united states of america ulcerative colitis )2018-11-22v4No1 / 118
374amnoncommon skin, costa rica, amphibia, rhaebo haematiticus, truando toad, toad2018-09-09v4No1 / 121
113amnon high in larval stage compared to adult in danio rerio zebra fish research facility united states of america intestine 2017-04-10v4No1 / 128
199amnoncommon in kitchen sink (common building, urban biome, united states of america, kitchen, sink)2017-10-01v4No1 / 130
511amnoncommon snow, depth 0-5cm, united states of america, state of colorado2019-03-20v4No1 / 134
374amnoncommon skin, costa rica, amphibia, craugastor fitzingeri, common rain frog, frog2018-09-09v4No1 / 136
241amnonhigher in babies from russia compared to estonia ( high in russia compared to estonia in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 146
361amnoncommon leaf, austria, greenhouse, plant, dracaena marginata2018-08-21v4No1 / 146
475amnoncommon in air next to subway stations in hong kong (common air, hong kong, city)2019-01-20v4No1 / 147
362amnoncommon hydrothermal vent, greece, marine sediment, mediterranean sea, marine hydrothermal vent, volcanic rock, volcanic crater, water, sea water, active vent2018-08-29v4No1 / 150
9amnonhigher at end of experiment (grows at later times) ( high in end compared to beginning in bermuda sea water )2016-10-27v4No1 / 158
475amnoncommon in air in subway train in hong kong (common air, hong kong, city, subway)2019-01-20v4No1 / 161
232amnoncoomon in foot of healthy controls (common homo sapiens, skin, australia, foot)2017-11-05v4No1 / 166
534amnoncommon river, water, fresh water, depth 10 cm, koshi river, nepal, free floating, filtered 0.2um2019-07-22v4No1 / 172
536amnoncommon snake, skin, united states of america, southern united states, pantherophis obsoletus, black rat snake, arboreal snake2019-07-28v4No1 / 184
567amnon high in pair of nares anterior naris compared to nasopharynx in belgium adult homo sapiens 2019-12-05v4No1 / 186
534amnoncommon river, water, fresh water, depth 10 cm, koshi river, tributary, nepal, particle bound, filtered 2.7um2019-07-22v4No1 / 193
170amnoncommon river, water, fresh water, depth 10 cm, united states of america, stream2017-07-24v4No1 / 194
371amnoncommon homo sapiens, skin, amerindian, hunter gatherer, venezuela2018-09-06v4No1 / 195
6amnoncommon urine, female, homo sapiens, pregnancy, state of tennessee2016-10-13v4No1 / 201
511amnoncommon snow, depth 0-5cm, lapland, finland, sweden, kingdom of norway2019-03-20v4No1 / 213
433amnoncommon sea water, ocean, depth 4m, south china sea, coast2018-12-19v4No1 / 215
209amnon high in pacific ocean compared to atlantic ocean in north america megaptera novaeangliae humpback whale respiratory airway exhaled air condensate whale blow 2017-10-15v4No1 / 219
499amnoncommon brazil, pond, water, pond water, fresh water2019-03-05v4No1 / 228
351amnoncommon sea urchin, lytechinus variegatus, research facility, eagle harbor, state of florida, united states of america, feces2018-07-30v4No1 / 233
492amnoncommon skin, adult, rana catesbeiana, bullfrog, lithobates catesbeianus, frog, japan2019-02-27v4No1 / 236
536amnoncommon snake, skin, united states of america, southern united states, agkistrodon contortrix, copperhead snake2019-07-28v4No1 / 236
351amnoncommon sea urchin, lytechinus variegatus, coelomic fluid, research facility, eagle harbor, state of florida, united states of america2018-07-30v4No1 / 249
253amnoncommon in clouds in puy de dome mountain in france (common cloud, french republic, air, autumn)2017-11-22v4No1 / 267
361amnoncommon leaf, austria, greenhouse, plant, chlorophytum comosum2018-08-21v4No1 / 270
558amnon high in summer compared to winter in bird centrocercus urophasianus greater sage-grouse united states of america state of wyoming 2019-09-20v4No1 / 274
433amnon high in indian ocean compared to south china sea coast in sea water ocean depth 4m 2018-12-19v4No1 / 283
37amnoncommon in plastic leaf plants (in field next to tomato plants) (common maryland county, leaf)2016-12-09v4No1 / 298
237amnonlower in burrow soil compared to bird ( high in oceanodroma leucorhoa bird seabird compared to soil burrow in canada bon portage island )2017-11-07v4No1 / 298
241amnonhigher in babies from russia compared to finland ( high in russia compared to finland in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 306
499amnoncommon brazil, pond, poecilia reticulata, digestive system, intestine, fish, guppy2019-03-05v4No1 / 308
534amnoncommon river, water, fresh water, depth 10 cm, koshi river, nepal, particle bound, filtered 2.7um2019-07-22v4No1 / 315
311amnoncommon in floor of kimchi production facility (common united states of america, state of rhode island, floor, food processing factory)2018-04-09v4No1 / 324
433amnoncommon sea water, ocean, depth 4m, indian ocean2018-12-19v4No1 / 333
338amnonlower in wild salamanders compared to zoo grown salamanders ( high in zoological garden zoo compared to pond area designated as a nature reserve in skin andrias japonicus japanese giant salamander japan )2018-05-21v4No1 / 334
351amnoncommon in artificial sea water where sea urchins were grown (common sea urchin, lytechinus variegatus, research facility, state of florida, united states of america, artificial seawater, sea water)2018-07-30v4No1 / 338
254amnoncommon river, water, fresh water, depth 0.5m, jiulong river, fujian province, china2017-11-23v4No1 / 347
29amnon high in seed compared to seedling in brassica oleracea french republic 2016-12-05v4No1 / 379
170amnonhigher in low turbidity river water ( high in low turbidity turbidity compared to high turbidity in river water fresh water depth 10 cm united states of america stream )2017-07-24v4No1 / 395
99amnoncommon commonwealth of virginia, united states of america, skin, mucus, pseudacris crucifer, peeper2017-04-02v4No1 / 438
504amnoncommon nan'ao island, water, sea water, china2019-03-14v4No1 / 452
504amnon high in water sea water compared to sediment marine sediment in nan'ao island china 2019-03-14v4No1 / 462
360amnoncommon desert, soil, rhizosphere, agave, agave salmiana, mexico, guanajuato2018-08-21v4No1 / 484
360amnoncommon agave, desert, leaf, leaf surface, agave salmiana, mexico, guanajuato2018-08-21v4No1 / 492
315amnonhigher in frog pond water compared to frog gut ( high in water fresh water compared to digestive system colon frog quasipaa spinosa giant spiny frog in jiangxi province hunan province china )2018-04-10v4No1 / 505
352amnon high in small intestine duodenum compared to feces in homo sapiens new delhi india 2018-07-30v4No1 / 545
462amnon high in populus deltoides compared to populus trichocarpa x deltoides in united states of america state of tennessee populus tree leaf cultivated environment 2019-01-13v4No1 / 559
129amnoncommon mexico, myrtillocactus geometrizans, opuntia robusta, cactus, semi-arid, leaf2017-04-15v4No1 / 562
146amnon high in rhizosphere compared to soil in united states of america solanum lycopersicum tomato slit loam ph 6 2017-04-20v4No1 / 590
360amnon high in rhizosphere agave compared to soil in desert mexico state of california 2018-08-21v4No1 / 593
360amnonhigher in leaf surface compared to soil in agave plants ( high in leaf leaf surface compared to soil in desert state of california mexico guanajuato agave )2018-08-21v4No1 / 645
360amnoncommon agave, desert, state of california, agave deserti, leaf, leaf surface2018-08-21v4No1 / 649
271amnon high in rhizosphere glycine max soybean compared to soil in depth 0-20cm china 2018-01-09v4No1 / 750
206amnoncommon in air from israel particles <10um size (common air, dust, israel, size < 10um, clear day)2017-10-04v4No1 / 765
309amnon high in plantago lanceolata ribwort plantain compared to other plants in rhizosphere germany 2018-04-05v4No1 / 800
356amnoncommon in deciduous broad leaved forest top soil in japan (common soil, depth 0-10cm, hokkaido, topsoil, ph 5.4, japan, forest ecosystem)2018-08-15v4No1 / 834
232amnonlower in diabetec foot ulcers compared to non-ulcer skin in diabetic patients ( high in control compared to wound ulcer in homo sapiens skin australia foot diabetes mellitus )2017-11-05v4No1 / 836
517amnon high in skin arm forearm compared to feces in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 836
265amnoncommon canada, province of quebec, soilwater, water2017-12-11v4No1 / 841
462amnon high in leaf compared to stem in united states of america state of tennessee populus tree cultivated environment 2019-01-13v4No1 / 890
146amnoncommon united states of america, solanum lycopersicum, tomato, slit loam soil, ph 6, rhizosphere2017-04-20v4No1 / 894
206amnoncommon in dust storm air from israel particles <10um size (common israel, air, size < 10um, dust, dust storm)2017-10-04v4No1 / 902
37amnonlower in tomato plant leaves compared to plastic control ( high in control compared to solanum lycopersicum in maryland county leaf )2016-12-09v4No1 / 950
517amnon high in skin arm forearm compared to mouth mucosa mouth in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 1014
515amnon high in carabidae compared to staphylinidae in whole body beetle carnivorous beetle river poland 2019-04-19v4No1 / 1130
309amnoncommon rhizosphere, germany, plantago lanceolata, ribwort plantain2018-04-05v4No1 / 1386
462amnon high in rhizosphere compared to soil in united states of america state of tennessee populus tree cultivated environment 2019-01-12v4No1 / 1428
271amnoncommon rhizosphere, glycine max, depth 0-20cm, soybean, china2018-01-09v4No1 / 1459
296amnoncommon soil, north china plain, agricultural feature, wheat, winter, depth 0-20cm, ph>4, ph<5, china2018-02-11v4No1 / 1886
155amnoncommon in soil tightly bound to wheat root (common triticum aestivum, wheat, soil, root, china)2017-07-02v4No1 / 1977
296amnoncommon soil, north china plain, agricultural feature, wheat, winter, depth 0-20cm, ph>7, ph<8, china2018-02-11v4No1 / 2160
296amnoncommon soil, north china plain, agricultural feature, wheat, winter, depth 0-20cm, ph>6, ph<7, china2018-02-11v4No1 / 2223
443amnon high in particle filtered 2.7um compared to free floating filtered 0.2um in water river fresh water depth 1m united states of america mississippi river 2019-01-07v4No1 / 2266
296amnoncommon in wheat field soil (common soil, north china plain, depth 5cm, agricultural feature, wheat, winter, china)2018-02-11v4No1 / 2341
155amnoncommon in soil loosely bound to wheat root (common triticum aestivum, wheat, soil, rhizosphere, china)2017-07-02v4No1 / 2425
155amnoncommon in bulk soil in wheat field (common triticum aestivum, wheat, soil, bulk soil, china)2017-07-02v4No1 / 2594
296amnoncommon soil, north china plain, agricultural feature, wheat, winter, depth 0-20cm, ph>8, china2018-02-11v4No1 / 2646
265amnon high in soilwater water compared to soil in canada province of quebec 2017-12-11v4No1 / 3277
296amnoncommon soil, north china plain, agricultural feature, wheat, winter, depth 0-20cm, ph>5, ph<6, china2018-02-11v4No1 / 3508
462amnon high in rhizosphere compared to root in united states of america state of tennessee populus tree cultivated environment 2019-01-13v4No1 / 4630
271amnon high in soil rhizosphere compared to root structure root in depth 0-20cm glycine max soybean china 2018-01-09v4No1 / 7954

Problems / suggestions? Please email info AT dbbact DOT org