Search result for sequence:
TACGAAGGGGGCTAGCGTTGCTCGGAATTACTGGGCGTAAAGGGAGCGTAGGCGGACATTTAAGTCAGGGGTGAAATCCCGGGGCTCAACCTCGGAATTGCCTTTGATACTGGGTGTCTTGAGTATGAGAGAGGTGTGTGGAACTCCGAG
common ontology terms
term enrichment score
TermScore
fresh water0.193314
skin0.188119
water0.185185
united states of america0.160218
river0.147560
rhizosphere0.138101
soil0.121918
depth 10 cm0.121212
wheat0.110429
depth 0-20cm0.108434
leaf0.108108
china0.105109
koshi river0.099379
sea water0.097561
nepal0.094675
LOWER IN soil0.088050
homo sapiens0.078379
state of florida0.078049
depth 0-5cm0.076433
north china plain0.076433
air0.074303
agricultural feature0.071006
building0.065574
filtered 2.7um0.065574
canada0.065574
state of california0.065574
urban biome0.064516
ph 60.064516
southern united states0.064516
agave0.064516
state of tennessee0.063492
mexico0.063492
snake0.062500
bird0.060606
israel0.060000
brazil0.058824
desert0.055556
tributary0.052288
sea urchin0.052288
state of rhode island0.052288
spring water0.052288
populus0.052288
solanum lycopersicum0.051613
japan0.051282
winter0.051064
filtered 0.2um0.050955
particle bound0.050955
lytechinus variegatus0.050955
free floating0.048485
tree0.048485
city0.047337
cultivated environment0.045198
pond0.040541
coelomic fluid0.040134
dust0.040134
greenhouse0.040134
eagle harbor0.039735
tomato0.039735
bon portage island0.039735
oceanodroma leucorhoa0.039735
seabird0.039735
coarse-loamy soil0.039735
depth 4m0.039735
guanajuato0.039735
foodon product type0.039344
foot0.038961
mucus0.038961
new york0.038961
soybean0.038961
frog0.038585
LOWER IN mouth0.038585
snow0.038217
leaf surface0.038217
glycine max0.038217
LOWER IN saliva0.037855
triticum aestivum0.037500
LOWER IN feces0.037267
pair of nares0.037152
larval stage0.036474
canis lupus familiaris0.035503
research facility0.035264
adult0.035191
infant0.034582
child0.033426
ocean0.031088
australia0.030151
floor0.027027
beetle0.027027
day 00.027027
hokkaido0.027027
toad0.027027
bathroom0.026846
shower0.026846
tile0.026846
building wall0.026846
lapland0.026846
kitchen0.026846
sink0.026846
anas platyrhynchos0.026846
mallard0.026846
Fraction of dbbact annotations with this term covered by the query
TermScore
pond1.000000
building0.666667
filtered 2.7um0.666667
coelomic fluid0.666667
floor0.666667
dust0.666667
beetle0.666667
day 00.666667
canada0.666667
hokkaido0.666667
toad0.666667
greenhouse0.666667
depth 10 cm0.500000
koshi river0.500000
bathroom0.500000
shower0.500000
tile0.500000
urban biome0.500000
building wall0.500000
tributary0.500000
depth 0-5cm0.500000
lapland0.500000
cinara0.500000
kitchen0.500000
sink0.500000
sea urchin0.500000
eagle harbor0.500000
cleanroom0.500000
anas platyrhynchos0.500000
mallard0.500000
ixodes scapularis0.500000
lesser treefrog0.500000
tomato0.500000
pixr immunized0.500000
influenza0.500000
hydrothermal vent0.500000
greece0.500000
marine hydrothermal vent0.500000
volcanic rock0.500000
volcanic crater0.500000
active vent0.500000
LOWER IN inactive vent0.500000
anoplophora glabripennis0.500000
reproductive system0.500000
reproductive organ0.500000
genitalia0.500000
zea mays subsp. mays0.500000
corn0.500000
fresh corn0.500000
LOWER IN fermented corn0.500000
bronchial brush0.500000
LOWER IN sputum0.500000
LOWER IN induced sputum0.500000
bon portage island0.500000
oceanodroma leucorhoa0.500000
seabird0.500000
brood patch0.500000
bedroom0.500000
state of rhode island0.500000
kimchi0.500000
LOWER IN days 1-90.500000
centrocercus urophasianus0.500000
greater sage-grouse0.500000
state of wyoming0.500000
fish sauce0.500000
middle timepoint0.500000
two weeks0.500000
LOWER IN fresh0.500000
LOWER IN food spoilage0.500000
age <=24 hours0.500000
LOWER IN age &gt;= 7 days0.500000
cabbage0.500000
starfish0.500000
patiria pectinifera0.500000
coarse-loamy soil0.500000
ph 60.500000
day 120.500000
LOWER IN day 10.500000
bermuda0.500000
LOWER IN oral wash0.500000
rhinella icterica0.500000
yellow cururu toad0.500000
crotalus horridus0.500000
southern united states0.500000
timber rattlesnake0.500000
thamnophis sirtalis0.500000
common garter snake0.500000
aquatic snake0.500000
nerodia sipedon0.500000
northern water snake0.500000
train0.500000
boston0.500000
amphibia0.500000
rhaebo haematiticus0.500000
truando toad0.500000
stem surface0.500000
upper stem0.500000
exosphere0.500000
campinas0.500000
craugastor fitzingeri0.500000
Fraction of annotations for the query sequences containing the term
TermScore
united states of america0.337931
water0.172414
china0.137931
fresh water0.131034
skin0.131034
soil0.117241
homo sapiens0.110345
rhizosphere0.096552
river0.089655
depth 10 cm0.068966
sea water0.068966
leaf0.068966
depth 0-20cm0.062069
wheat0.062069
koshi river0.055172
nepal0.055172
state of florida0.055172
research facility0.048276
LOWER IN soil0.048276
depth 0-5cm0.041379
state of california0.041379
adult0.041379
air0.041379
north china plain0.041379
agricultural feature0.041379
winter0.041379
building0.034483
urban biome0.034483
filtered 2.7um0.034483
brazil0.034483
israel0.034483
canada0.034483
bird0.034483
ph 60.034483
snake0.034483
southern united states0.034483
state of tennessee0.034483
desert0.034483
agave0.034483
mexico0.034483
free floating0.027586
filtered 0.2um0.027586
tributary0.027586
particle bound0.027586
sea urchin0.027586
lytechinus variegatus0.027586
solanum lycopersicum0.027586
state of rhode island0.027586
city0.027586
japan0.027586
spring water0.027586
populus0.027586
tree0.027586
cultivated environment0.027586
pond0.020690
snow0.020690
coelomic fluid0.020690
eagle harbor0.020690
dust0.020690
larval stage0.020690
frog0.020690
tomato0.020690
australia0.020690
foot0.020690
canis lupus familiaris0.020690
pair of nares0.020690
mucus0.020690
LOWER IN saliva0.020690
LOWER IN mouth0.020690
bon portage island0.020690
oceanodroma leucorhoa0.020690
seabird0.020690
foodon product type0.020690
infant0.020690
new york0.020690
coarse-loamy soil0.020690
child0.020690
LOWER IN feces0.020690
greenhouse0.020690
feces0.020690
ocean0.020690
depth 4m0.020690
guanajuato0.020690
leaf surface0.020690
glycine max0.020690
soybean0.020690
triticum aestivum0.020690
bathroom0.013793
shower0.013793
tile0.013793
building wall0.013793
hunan province0.013793
jiangxi province0.013793
lapland0.013793
finland0.013793
sweden0.013793
kingdom of norway0.013793
kitchen0.013793
sink0.013793
floor0.013793
Exp. ID User ID Description Date Region Flag Sequences
534amnondominant river, water, fresh water, depth 10 cm, koshi river, nepal, free floating, filtered 0.2um2019-07-22v4No1 / 10
199amnonhigh freq. on shower wall tile (dominant bathroom, shower, building, tile, urban biome, united states of america, building wall)2017-10-01v4No1 / 13
315amnonhigh freq. in frog pond water (dominant hunan province, jiangxi province, water, fresh water, pond, china)2018-04-10v4No1 / 13
534amnondominant river, water, fresh water, depth 10 cm, koshi river, tributary, nepal, free floating, filtered 0.2um2019-07-22v4No1 / 13
511amnondominant snow, depth 0-5cm, lapland, finland, sweden, kingdom of norway2019-03-20v4No1 / 15
534amnondominant river, water, fresh water, depth 10 cm, koshi river, tributary, nepal, particle bound, filtered 2.7um2019-07-22v4No1 / 16
534amnondominant river, water, fresh water, depth 10 cm, koshi river, nepal, particle bound, filtered 2.7um2019-07-22v4No1 / 16
68amnonfound in some aphid samples (prevalence <=0.1) (other cinara)2017-02-20v4No1 / 17
199amnonhigh freq. in kitchen sink (dominant building, urban biome, united states of america, kitchen, sink)2017-10-01v4No1 / 17
351amnondominant sea urchin, lytechinus variegatus, coelomic fluid, research facility, eagle harbor, state of florida, united states of america2018-07-30v4No1 / 17
308amnoncommon in spacecraft assembly cleanroom floor (common united states of america, state of california, floor, dust, cleanroom)2018-03-31v4No1 / 23
348amnonsuspected contaminant (found in H2O samples) (contamination)2018-07-16v4No1 / 25
81amnoncommon anas platyrhynchos, mallard, state of california, cloaca2017-03-05v4No1 / 30
262amnoncommon tick, ixodes scapularis, larval stage, body proper, research facility2017-12-10v4No1 / 31
492amnoncommon brazil, skin, frog, dendropsophus minutus, lesser treefrog, adult2019-02-27v4No1 / 31
146amnoncommon united states of america, solanum lycopersicum, tomato, botanical fruit food product2017-04-20v4No1 / 35
262amnonhigher in tick larvae fed on PIXR immunized mice compared to non immunized ( high in pixr immunized compared to control in tick ixodes scapularis larval stage body proper research facility )2017-12-10v4No1 / 35
81amnonhigh in influenza A positive mallards compared to healthy mallards ( high in influenza compared to control in anas platyrhynchos mallard state of california cloaca )2017-03-05v4No1 / 37
232amnoncommon in foot of diabetic patients (common homo sapiens, skin, australia, foot, diabetes mellitus)2017-11-05v4No1 / 37
362amnon high in active vent compared to inactive vent in hydrothermal vent greece marine sediment mediterranean sea marine hydrothermal vent volcanic rock volcanic crater water sea water 2018-08-29v4No1 / 37
243amnoncommon beetle, anoplophora glabripennis, digestive system, united states of america2017-11-15v4No1 / 38
231amnoncommon in dog genitalia (common dog, canis lupus familiaris, united states of america, reproductive system, reproductive organ, genitalia)2017-11-02v4No1 / 43
306amnondecreases after 2-30 days of fermentation of insiled whole plant corn ( high in fresh corn day 0 compared to fermented corn in zea mays subsp. mays corn whole plant israel )2018-03-19v4No1 / 45
354amnon high in bronchus bronchial epithelium bronchial brush compared to sputum induced sputum in homo sapiens united states of america adult 2018-07-30v4No1 / 55
63amnoncommon in skin in american gut (common homo sapiens, skin)2017-02-15v4No1 / 56
26amnon high in pair of nares mucus compared to saliva mouth in canis lupus familiaris united states of america 2016-12-05v4No1 / 57
237amnoncommon canada, bon portage island, bird, oceanodroma leucorhoa, seabird, brood patch2017-11-07v4No1 / 57
237amnoncommon bird, oceanodroma leucorhoa, seabird, canada, bon portage island, uropygial gland2017-11-07v4No1 / 58
523amnoncommon air, building, bedroom, united states of america, chicago, state of illinois2019-07-03v4No1 / 58
311amnonlower in fermneted kimchi days>1 compared to day 0 ( high in day 0 early timepoints compared to days 1-9 in united states of america state of rhode island kimchi food (fermented) )2018-04-09v4No1 / 62
558amnon high in duodenum compared to caecum in bird centrocercus urophasianus greater sage-grouse united states of america state of wyoming 2019-09-20v4No1 / 64
311amnoncommon united states of america, state of rhode island, fish sauce, foodon product type2018-04-09v4No1 / 68
231amnoncommon in dog urine (common dog, canis lupus familiaris, united states of america, urine)2017-11-02v4No1 / 69
534amnoncommon river, water, fresh water, depth 10 cm, koshi river, tributary, nepal, free floating, filtered 0.2um2019-07-22v4No1 / 80
269amnonpeaks at 2 weeks in refrigeration of yao meat ( high in middle timepoint two weeks compared to fresh food spoilage late timepoint in china foodon product type )2018-01-09v4No1 / 83
227amnonhiger in first 24hrs compared to later timepoints in baby nasopharynx ( high in age age <=24 hours compared to age >= 7 days in homo sapiens nasopharynx nasal cavity infant kingdom of the netherlands )2017-10-30v4No1 / 85
311amnoncommon in salted cabbage (common cabbage, united states of america, state of rhode island, foodon product type)2018-04-09v4No1 / 85
550amnoncommon city, hokkaido, starfish, coelomic fluid, wild, patiria pectinifera, japan2019-08-18v4No1 / 85
26amnon high in pair of nares mucus compared to saliva mouth in united states of america felis catus 2016-12-05v4No1 / 86
600sheryoIncearses after 12 days of biochar ammendment in soil ( high in day 12 compared to day 1 in soil depth 0-5cm united states of america new york coarse-loamy soil ph 6 biochar )2020-03-27v4No1 / 86
199amnoncommon on shower wall tile (common bathroom, shower, building, tile, urban biome, united states of america, building wall)2017-10-01v4No1 / 90
9amnoncommon bermuda, sea water2016-10-27v4No1 / 91
354amnon high in bronchus bronchial brush bronchial epithelium compared to saliva oral wash in homo sapiens united states of america adult 2018-07-30v4No1 / 94
492amnoncommon brazil, skin, adult, rhinella icterica, toad, yellow cururu toad2019-02-27v4No1 / 95
306amnoncommon at whole plant corn at time 0 (common zea mays subsp. mays, corn, whole plant, israel)2018-03-19v4No1 / 96
536amnoncommon crotalus horridus, snake, skin, united states of america, southern united states, timber rattlesnake2019-07-28v4No1 / 101
536amnoncommon snake, skin, united states of america, southern united states, thamnophis sirtalis, common garter snake2019-07-28v4No1 / 110
536amnoncommon snake, skin, united states of america, southern united states, aquatic snake, nerodia sipedon, northern water snake2019-07-28v4No1 / 111
195amnoncommon in boston subway surfaces (common city, urban biome, train, boston)2017-09-07v4No1 / 116
410amnonlower in feces compared to rectal biopsies in children with treatment naive uc ( high in rectum biopsy biopsy site compared to feces in homo sapiens child united states of america ulcerative colitis )2018-11-22v4No1 / 118
374amnoncommon skin, costa rica, amphibia, rhaebo haematiticus, truando toad, toad2018-09-09v4No1 / 121
113amnon high in larval stage compared to adult in danio rerio zebra fish research facility united states of america intestine 2017-04-10v4No1 / 128
615amnoncommon stem surface, upper stem, stem, exosphere, saccharum, sugarcane, campinas, brazil, greenhouse2020-04-27v4No1 / 129
199amnoncommon in kitchen sink (common building, urban biome, united states of america, kitchen, sink)2017-10-01v4No1 / 130
511amnoncommon snow, depth 0-5cm, united states of america, state of colorado2019-03-20v4No1 / 134
374amnoncommon skin, costa rica, amphibia, craugastor fitzingeri, common rain frog, frog2018-09-09v4No1 / 136
241amnonhigher in babies from russia compared to estonia ( high in russia compared to estonia in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 146
361amnoncommon leaf, austria, greenhouse, plant, dracaena marginata2018-08-21v4No1 / 146
475amnoncommon in air next to subway stations in hong kong (common air, hong kong, city)2019-01-20v4No1 / 147
362amnoncommon hydrothermal vent, greece, marine sediment, mediterranean sea, marine hydrothermal vent, volcanic rock, volcanic crater, water, sea water, active vent2018-08-29v4No1 / 150
9amnonhigher at end of experiment (grows at later times) ( high in end compared to beginning in bermuda sea water )2016-10-27v4No1 / 158
475amnoncommon in air in subway train in hong kong (common air, hong kong, city, subway)2019-01-20v4No1 / 161
232amnoncoomon in foot of healthy controls (common homo sapiens, skin, australia, foot)2017-11-05v4No1 / 166
534amnoncommon river, water, fresh water, depth 10 cm, koshi river, nepal, free floating, filtered 0.2um2019-07-22v4No1 / 172
536amnoncommon snake, skin, united states of america, southern united states, pantherophis obsoletus, black rat snake, arboreal snake2019-07-28v4No1 / 184
567amnon high in anterior naris pair of nares compared to nasopharynx in homo sapiens adult belgium 2019-12-05v4No1 / 186
534amnoncommon river, water, fresh water, depth 10 cm, koshi river, tributary, nepal, particle bound, filtered 2.7um2019-07-22v4No1 / 193
170amnoncommon river, water, fresh water, depth 10 cm, united states of america, stream2017-07-24v4No1 / 194
371amnoncommon homo sapiens, skin, amerindian, hunter gatherer, venezuela2018-09-06v4No1 / 195
600sheryoIncearses after 12 days of stover ammendment in soil ( high in day 12 compared to day 1 in soil depth 0-5cm united states of america new york coarse-loamy soil ph 6 stover ammendment soil )2020-03-27v4No1 / 196
6amnoncommon urine, female, homo sapiens, pregnancy, state of tennessee2016-10-13v4No1 / 201
511amnoncommon snow, depth 0-5cm, lapland, finland, sweden, kingdom of norway2019-03-20v4No1 / 213
433amnoncommon sea water, ocean, depth 4m, south china sea, coast2018-12-19v4No1 / 215
209amnon high in pacific ocean compared to atlantic ocean in north america megaptera novaeangliae humpback whale respiratory airway exhaled air condensate whale blow 2017-10-15v4No1 / 219
499amnoncommon brazil, pond, water, pond water, fresh water2019-03-05v4No1 / 228
351amnoncommon sea urchin, lytechinus variegatus, research facility, eagle harbor, state of florida, united states of america, feces2018-07-30v4No1 / 233
492amnoncommon skin, adult, rana catesbeiana, bullfrog, lithobates catesbeianus, frog, japan2019-02-27v4No1 / 236
536amnoncommon snake, skin, united states of america, southern united states, agkistrodon contortrix, copperhead snake2019-07-28v4No1 / 236
351amnoncommon sea urchin, lytechinus variegatus, coelomic fluid, research facility, eagle harbor, state of florida, united states of america2018-07-30v4No1 / 249
253amnoncommon in clouds in puy de dome mountain in france (common cloud, french republic, air, autumn)2017-11-22v4No1 / 267
361amnoncommon leaf, austria, greenhouse, plant, chlorophytum comosum2018-08-21v4No1 / 270
602sheryohigher in rhizoshere of tomato plant roots planted in potting mix amended with biochar ( high in amended with biochar compared to unamended in potting mix rhizosphere israel solanum lycopersicum )2020-04-05v4No1 / 270
558amnon high in summer compared to winter in bird centrocercus urophasianus greater sage-grouse united states of america state of wyoming 2019-09-20v4No1 / 274
433amnon high in indian ocean compared to south china sea coast in sea water ocean depth 4m 2018-12-19v4No1 / 283
37amnoncommon in plastic leaf plants (in field next to tomato plants) (common maryland county, leaf)2016-12-09v4No1 / 298
237amnonlower in burrow soil compared to bird ( high in oceanodroma leucorhoa bird seabird compared to soil burrow in canada bon portage island )2017-11-07v4No1 / 298
241amnonhigher in babies from russia compared to finland ( high in russia compared to finland in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 306
499amnoncommon brazil, pond, poecilia reticulata, digestive system, intestine, fish, guppy2019-03-05v4No1 / 308
534amnoncommon river, water, fresh water, depth 10 cm, koshi river, nepal, particle bound, filtered 2.7um2019-07-22v4No1 / 315
311amnoncommon in floor of kimchi production facility (common united states of america, state of rhode island, floor, food processing factory)2018-04-09v4No1 / 324
433amnoncommon sea water, ocean, depth 4m, indian ocean2018-12-19v4No1 / 333
338amnonlower in wild salamanders compared to zoo grown salamanders ( high in zoological garden zoo compared to pond area designated as a nature reserve in skin andrias japonicus japanese giant salamander japan )2018-05-21v4No1 / 334
351amnoncommon in artificial sea water where sea urchins were grown (common sea urchin, lytechinus variegatus, research facility, state of florida, united states of america, artificial seawater, sea water)2018-07-30v4No1 / 338
254amnoncommon river, water, fresh water, depth 0.5m, jiulong river, fujian province, china2017-11-23v4No1 / 347
29amnon high in seed compared to seedling in brassica oleracea french republic 2016-12-05v4No1 / 379
612amnoncommon state of florida, united states of america, spring water, water, fresh water, location 52020-04-22v4No1 / 383
170amnonhigher in low turbidity river water ( high in low turbidity turbidity compared to high turbidity in river water fresh water depth 10 cm united states of america stream )2017-07-24v4No1 / 395
612amnoncommon state of florida, united states of america, spring water, water, fresh water, location 32020-04-22v4No1 / 420
99amnoncommon commonwealth of virginia, united states of america, skin, mucus, pseudacris crucifer, peeper2017-04-02v4No1 / 438
504amnoncommon nan'ao island, water, sea water, china2019-03-14v4No1 / 452
504amnon high in water sea water compared to sediment marine sediment in nan'ao island china 2019-03-14v4No1 / 462
360amnoncommon desert, soil, rhizosphere, agave, agave salmiana, mexico, guanajuato2018-08-21v4No1 / 484
360amnoncommon agave, desert, leaf, leaf surface, agave salmiana, mexico, guanajuato2018-08-21v4No1 / 492
315amnonhigher in frog pond water compared to frog gut ( high in water fresh water compared to digestive system colon frog quasipaa spinosa giant spiny frog in jiangxi province hunan province china )2018-04-10v4No1 / 505
352amnon high in small intestine duodenum compared to feces in homo sapiens new delhi india 2018-07-30v4No1 / 545
462amnon high in populus deltoides compared to populus trichocarpa x deltoides in united states of america state of tennessee populus tree leaf cultivated environment 2019-01-13v4No1 / 559
129amnoncommon mexico, myrtillocactus geometrizans, opuntia robusta, cactus, semi-arid, leaf2017-04-15v4No1 / 562
146amnon high in rhizosphere compared to soil in united states of america solanum lycopersicum tomato slit loam ph 6 2017-04-20v4No1 / 590
360amnon high in rhizosphere agave compared to soil in desert mexico state of california 2018-08-21v4No1 / 593
612amnoncommon state of florida, united states of america, spring water, water, fresh water, location 22020-04-22v4No1 / 596
360amnonhigher in leaf surface compared to soil in agave plants ( high in leaf leaf surface compared to soil in desert state of california mexico guanajuato agave )2018-08-21v4No1 / 645
360amnoncommon agave, desert, state of california, agave deserti, leaf, leaf surface2018-08-21v4No1 / 649
612amnoncommon state of florida, united states of america, spring water, water, fresh water, location 42020-04-22v4No1 / 655
271amnon high in rhizosphere glycine max soybean compared to soil in depth 0-20cm china 2018-01-09v4No1 / 750
206amnoncommon in air from israel particles <10um size (common air, dust, israel, size < 10um, clear day)2017-10-04v4No1 / 765
309amnon high in plantago lanceolata ribwort plantain compared to other plants in rhizosphere germany 2018-04-05v4No1 / 800
356amnoncommon in deciduous broad leaved forest top soil in japan (common soil, depth 0-10cm, hokkaido, topsoil, ph 5.4, japan, forest ecosystem)2018-08-15v4No1 / 834
232amnonlower in diabetec foot ulcers compared to non-ulcer skin in diabetic patients ( high in control compared to wound ulcer in homo sapiens skin australia foot diabetes mellitus )2017-11-05v4No1 / 836
517amnon high in skin arm forearm compared to feces in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 836
265amnoncommon canada, province of quebec, soilwater, water2017-12-11v4No1 / 841
462amnon high in leaf compared to stem in united states of america state of tennessee populus tree cultivated environment 2019-01-13v4No1 / 890
146amnoncommon united states of america, solanum lycopersicum, tomato, slit loam soil, ph 6, rhizosphere2017-04-20v4No1 / 894
206amnoncommon in dust storm air from israel particles <10um size (common israel, air, size < 10um, dust, dust storm)2017-10-04v4No1 / 902
609sheryoCommon in soil without tobacco plants amended with difenoconazole fungicide (common without plants, difenoconazole, fungicide, ph 7-8, china, tobacco field, limestone, depth 0-20cm, soil)2020-07-05v4No1 / 915
37amnonlower in tomato plant leaves compared to plastic control ( high in control compared to solanum lycopersicum in maryland county leaf )2016-12-09v4No1 / 950
624sheryoCommon in ryegrass rhizosphere soil after 30-40 days (common days 30-40, rhizosphere, ryegrass, ph 7-8, 10 cm depth, soil, jiangsu province, china)2020-05-11v4No1 / 966
517amnon high in skin arm forearm compared to mouth mucosa mouth in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 1014
515amnon high in carabidae compared to staphylinidae in whole body beetle carnivorous beetle river poland 2019-04-19v4No1 / 1130
600sheryoCommon in biochar ammended soil after 82 days (common soil, biochar, depth 0-5cm, united states of america, new york, coarse-loamy soil, ph 6, day 82)2020-03-27v4No1 / 1326
309amnoncommon rhizosphere, germany, plantago lanceolata, ribwort plantain2018-04-05v4No1 / 1386
462amnon high in rhizosphere compared to soil in united states of america state of tennessee populus tree cultivated environment 2019-01-12v4No1 / 1428
271amnoncommon rhizosphere, glycine max, depth 0-20cm, soybean, china2018-01-09v4No1 / 1459
296amnoncommon soil, north china plain, agricultural feature, wheat, winter, depth 0-20cm, ph>4, ph<5, china2018-02-11v4No1 / 1886
155amnoncommon in soil tightly bound to wheat root (common triticum aestivum, wheat, soil, root, china)2017-07-02v4No1 / 1977
296amnoncommon soil, north china plain, agricultural feature, wheat, winter, depth 0-20cm, ph>7, ph<8, china2018-02-11v4No1 / 2160
296amnoncommon soil, north china plain, agricultural feature, wheat, winter, depth 0-20cm, ph>6, ph<7, china2018-02-11v4No1 / 2223
443amnon high in particle filtered 2.7um compared to free floating filtered 0.2um in water river fresh water depth 1m united states of america mississippi river 2019-01-07v4No1 / 2266
296amnoncommon in wheat field soil (common soil, north china plain, depth 5cm, agricultural feature, wheat, winter, china)2018-02-11v4No1 / 2341
155amnoncommon in soil loosely bound to wheat root (common triticum aestivum, wheat, soil, rhizosphere, china)2017-07-02v4No1 / 2425
155amnoncommon in bulk soil in wheat field (common triticum aestivum, wheat, soil, bulk soil, china)2017-07-02v4No1 / 2594
296amnoncommon soil, north china plain, agricultural feature, wheat, winter, depth 0-20cm, ph>8, china2018-02-11v4No1 / 2646
265amnon high in soilwater water compared to soil in canada province of quebec 2017-12-11v4No1 / 3277
296amnoncommon soil, north china plain, agricultural feature, wheat, winter, depth 0-20cm, ph>5, ph<6, china2018-02-11v4No1 / 3508
462amnon high in rhizosphere compared to root in united states of america state of tennessee populus tree cultivated environment 2019-01-13v4No1 / 4630
271amnon high in soil rhizosphere compared to root structure root in depth 0-20cm glycine max soybean china 2018-01-09v4No1 / 7954

Problems / suggestions? Please email info AT dbbact DOT org